e-figure 1. The design of the study.

Similar documents
Hamilton Regional Laboratory Medicine Program

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Hamilton Regional Laboratory Medicine Program

Rapid Laboratories In House Tests

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ

NEW RCPCH REFERENCE RANGES-

NOTE: This table will be discontinued after this lot.

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev

BC Biomedical Laboratories Adult Reference Ranges

Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase

Clinician Blood Panel Results

GRADING CRITERIA for CMS Regulated Analytes

NORMAL LABORATORY VALUES FOR CHILDREN

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE

Differential Blood Smear H3

Clinician Blood Panel Results

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy

Tables of Normal Values (As of February 2005)

Supplementary Note Details of the patient populations studied Strengths and weakness of the study

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

Changes of hematological references depends on storage period and temperature conditions in rats and dogs

Please contact the Client Services Team if you require further information.

Senior Executive Wellness Profile

Test Result Reference Range Flag

COMPANY OR UNIVERSITY

CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies

Differential Blood Smear H3

Online catalog

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair

Complete Medical History

BASIC METABOLIC PANEL

CELL-DYN 3700 Strength in Technology, Proven Reliability

EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS

Laboratory Testing for the Primary Care Optometrist

Differential Blood Smear H3

Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How?

FBC interpretation. Dr. Gergely Varga

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.

NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital

EDUCATIONAL COMMENTARY DISTINGUISHING MORPHOLOGIC LOOK-ALIKES

The Effects of Competition Performance in Elite Male Football Players on Selected Biochemical and Hematological Parameters

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired

Clinician Blood Panel Results

ADPedKD: detailed description of data which will be collected in this registry

Date Time By Code Description Qty (Variance) Photo

ORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9

Weight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL

Weight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL

INFECTION/ INFLAMMATION

Supplemental Figure 1. Gating strategies for flow cytometry and intracellular cytokinestaining

Evaluation of haematology analyzer CELL-DYN 3700 SL

BIOCHEMISTRY of BLOOD

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter

Supplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms

Hematology Revision. By Dr.AboRashad . Mob

q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

Histopathology: granulomatous inflammation, including tuberculosis

Year 2003 Paper two: Questions supplied by Tricia

BLOOD. Dr. Vedat Evren

Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature

Clinical use of flow cytometry

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist

The Complete Blood Count

Case study for CME Diabetes up-to-date management

Complete Blood Count PSI AP Biology

HM5. Hematology Analyzer BETTER. ACTUALLY.

Cavitary Pulmonary Nontuberculous Mycobacterium Infection in an Adult Patient with Cyanotic Congenital Heart Disease

SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION

Hematology & Coagulation Practicum Objectives CLS - 647

Haematology Comparability Document

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)

LabDriver Audit Trail Example

Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure

Case Log Number(s) Veterinarian or VTS Accurately report test results, using appropriate units of measurement Quality Control/Assurance Date Mastered

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES

EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION

Total Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.

Step 2. Common Blood Tests, and the Coulter Counter Readout

Preferred Clinical Services for Leading Age Florida August 26-27, 2015

HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore

CIERNY CLASSIFICATION CIERNY CLASSIFICATION. Classification of Infection according to Severity LAUTENBACH CLASSIFICATION OF MUSCULO SKELETAL INFECTION

TEST NAME/ PSYCHE CODE COLLECTION GUIDELINES REFERENCE VALUES ROOM TEMP. REFRIGERATED FROZEN

Blood DLC, Retic count, PCV, Hb and ESR. Dr. Tamara Alqudah

Blood Cell Identification Graded

3. Blood Cell Histograms:

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD

Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa

Transcription:

e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli.

e-figure 2. Representative H&E (A) and Masson s trichrome staining (B) sections of granulomas with differential degrees of fibrotic encapsulation. Class 1+, reduced perinecrotic fibrosis, more multinucleated giant cells ( <200 M thick ) MNGCs; >3 MNGCs per 10 high power fields, HP >3/10 HP), epithelioid cells and inflammatory cells; Class 2+, moderate perinecrotic fibrosis (200-500 M thick), fewer MNGCs (1 2/10 HP), epithelioid cells and inflammatory cells; Class 3+, severe perinecrotic fibrosis (>500 M thick), collagen hyperplasia, absence of MNGCs (0/10 HP), epithelioid cells and inflammatory cells. C. Representative computed tomography (CT) scans at the time of diagnosis.1. a thin-walled cavity (arrow); 2. a thick-walled cavity ; 3. a tree-in-bud appearance (TIB); 4. lobular consolidations (LC), and 5. a thick-walled cavity with a fibrotic band (FB).

e-figure 3. Changes in WBC and RBC indices between NDM-TB and DM-TB groups during TB progression. Horizontal lines represent median values. Gray areas represent normal ranges of the indices. SN, smear negative TB;SP, smear positive TB;WBC, white blood cell;rbc, red blood cell;hgb, hemoglobin;neu/lym, neutrophil to lymphocyte ratio; Mon/Lym, monocyte to lymphocyte ratio. Differences between groups were analyzed by Mann Whitney tests.

e-figure 4. Changes in antibody isotypes, complements and RBC indices between NDM-TB and DM-TB during TB progression. Horizontal lines represent median values. Gray areas represent the normal ranges of the indices. SN, smear negative TB;SP, smear positive TB; C3, complement component 3; MCV, erythrocyte mean corpuscular volume;hct, hematocrit; MCH, Mean corpuscular hemoglobin The differences between groups were analyzed by Mann Whitney tests.

e-table 1. CT findings of NDM-TB and DM-TB patients Prevalence of CT findings, No. (%) Prevalence of CT findings, No (%) CT findings SN-NDM-TB SN-DM-TB P-value* SP-NDM-TB SP-DM-TB P-value* (n=40) (n=40) (n=87) (n=92) Centrilobular nodule or 9 (22.50) 15(37.50) 0.143 50 (57.47) 68 (73.91) 0.020 a branching Tree-in-bud appearance 9 (22.50) 13 (32.50) 0.317 35 (40.23) 49 (53.26) 0.081 Poorly defined ( fuzzy ) 9 (22.50) 17 (42.50) 0.056 37 (42.53) 51 (55.43) 0.084 nodule Cavity 6 (15.00) 13 (32.50) 0.066 59 (67.82) 80 (86.96) 0.002 a Thin-walled cavity 0 (0.00 ) 2 (5.00) 0.152 9 (10.34) 6 (6.52) 0.356 Thick-walled cavity 5 (12.50 ) 8 (20.00) 0.363 38 (43.68) 64 (69.57) <0.001 a Lobular consolidations 34 (85.00) 33 (82.50) 0.762 68 (78.16) 80 (86.96) 0.120 Bronchovascular distortion 1 (2.50) 2 (5.00) 0.556 48 (55.17) 55 (59.78) 0.533 Fibrotic band 24 (60.00) 10 (25.00) 0.002 a 47 (54.02) 36 (39.13) 0.046 a Bronchiectasis 3 (7.50) 1 (2.50) 0.305 52 (59.77) 58 (63.04) 0.653 Miliary nodules 0 (0.00) 1 (2.50) 0.314 3 (0.03) 3 (3.26) 0.944 Hilar and mediastinal adenopathy 11 (27.50) 14 (35.00) 0.469 14 (16.09) 68 (73.91) <0.001 a Table notes: CT, computed tomography; DM, diabetes mellitus; DM-TB, TB patients with DM; NDM-TB, TB patients without DM; TB: tuberculosis; SN, smear negative; SP, smear positive. * 2 test a P <0.05.

e-table 2. Association of immune, biochemical indices with granuloma caseous necrosis in 67 TB (34NDM, 33DM) patients. Parameters Area of caseous necrosis Odd Ratio (95% CI) P Odd Ratio1 (95% CI) P Odd Ratio 2 (95% CI) P Demographic indices Age (year) 0.926 (0.860, 0.997) 0.041 0.962 (0.885, 1.046) 0.367 0.955 (0.872, 1.046) 0.322 Height (cm) 1.085 (1.000, 1.177) 0.049 0.976 (0.854, 1.114) 0.715 0.964 (0.832, 1.117) 0.628 Weight (Kg) 1.061 (1.001, 1.124) 0.045 0.970 (0.818, 1.151) 0.731 0.956 (0.796, 1.150) 0.634 BMI 1.123 (0.928, 1.358) 0.233 1.084 (0.889, 1.322) 0.425 1.014 (0.819, 1.254) 0.900 Immune cells and inflammatory indices WBC ( 10 9 / L) 1.052 (0.770, 1.437) 0.750 0.975 (0.686, 1.387) 0.890 0.917 (0.619, 1.359) 0.666 Neu (%) 0.971 (0.902, 1.046) 0.439 0.996 (0.915, 1.085) 0.935 0.996 (0.907, 1.093) 0.929 Neu ( 10 9 /L) 1.004 (0.649, 1.554) 0.984 0.973 (0.590, 1.605) 0.914 0.912 (0.520, 1.600) 0.749 Mon (%) 1.166 (0.862, 1.577) 0.319 1.147 (0.793, 1.660) 0.466 1.028 (0.703, 1.504) 0.885 Mon ( 10 9 /L) 7.687 (0.159, 372.376) 0.303 2.940 (0.042, 204.954) 0.618 0.640 (0.006, 70.411) 0.853 Lym (%) 1.015 (0.927, 1.111) 0.746 0.976 (0.876, 1.088) 0.666 0.973 (0.864, 1.096) 0.651 Lym ( 10 9 /L) 1.146 (0.496, 2.645) 0.750 0.794 (0.317, 1.991) 0.623 0.679 (0.246, 1.877) 0.456 Eo (%) 1.045 (0.851, 1.283) 0.675 1.044 (0.860, 1.245) 0.665 1.080 (0.881, 1.324) 0.458 Baso (%) 6.579 (1.003, 43.153) 0.050 7.253 (0.692, 76.060) 0.098 8.468 (0.554, 129.552) 0.125 Eo ( 10 9 /L) 3.446 (0.102, 116.917) 0.491 2.328 (0.075, 72.649) 0.630 3.500 (0.108, 113.247) 0.480 Baso ( 10 9 /L) 0.414 (0.000, 736.456) 0.817 0.225 (0.000, 1029.395) 0.729 1.499 (0.000, 0.928 10122.018) Neu/Lym 0.864 (0.420, 1.778) 0.692 1.166 (0.481, 2.828) 0.734 1.152 (0.440, 3.015) 0.773 Mon/Lym 12.206 (0.011, 13767.318) 0.485 29.837 (0.004, 232549.928) 0.458 2.768 (0.000, 0.825 22939.028) PLT/Neu 0.997 (0.974, 1.020) 0.780 1.000 (0.977, 1.024) 0.979 1.002 (0.976, 1.028) 0.897 PLT/Lym 0.997 (0.987, 1.008) 0.589 1.001 (0.988, 1.014) 0.852 1.003 (0.989, 1.016) 0.707 Platelet and coagulation indices PLT ( 10 9 /L) 0.997 (0.990, 1.005) 0.483 0.997 (0.988, 1.005) 0.463 0.997 (0.989, 1.006) 0.566 PCT (%) 0.001 (0.000, 6.366) 0.125 0.002 (0.000, 38.353) 0.213 0.012 (0.000, 445.629) 0.412 MPV (fl) 0.861 (0.604, 1.228) 0.409 0.942 (0.619, 1.433) 0.780 1.144 (0.661, 1.977) 0.631 INR 0.001 (0.000, 3.406) 0.093 0.000 (0.000, 5.343) 0.100 0.000 (0.000, 4.415) 0.090 Fibrinogen (g/l) 1.245 (0.704, 2.200) 0.452 1.488 (0.755, 2.931) 0.251 0.995 (0.443, 2.235) 0.990 D-Dimer (ng/ml) 0.998 (0.996, 1.001) 0.189 0.999 (0.996, 1.002) 0.344 0.999 (0.996, 1.003) 0.722 Glucose and lipid-associated indices TCH (mmol/l) 0.712 (0.408, 1.243) 0.232 0.668 (0.352, 1.267) 0.217 0.707 (0.363, 1.379) 0.309 TG (mmol/l) 1.197 (0.726, 1.975) 0.481 0.926 (0.436, 1.965) 0.841 0.708 (0.301, 1.664) 0.428 HDL-C (mmol/l) 0.734( 0.217, 2.483) 0.619 2.256 (0.388, 13.128) 0.365 6.435 (0.693, 59.741) 0.102 ApoA (mmol/l) 0.427 (0.073, 2.512) 0.347 1.465 (0.165, 13.033) 0.732 4.950 (0.352, 69.606) 0.236 ApoB (mmol/l) 0.315 (0.038, 2.625) 0.286 0.170 (0.015, 1.942) 0.154 0.186 (0.013, 2.617) 0.213 ApoE (mmol/l) 0.980 (0.946, 1.014) 0.251 0.987 (0.946, 1.028) 0.523 0.988 (0.946, 1.032) 0.588 LPA (mmol/l) 0.998 (0.996, 1.001) 0.130 0.999 (0.996, 1.001) 0.328 0.998 (0.995, 1.001) 0.204 GLU (mmol/l) 1.266 (0.934, 1.717) 0.129 1.144 (0.828, 1.579) 0.415 0.833 (0.555, 1.250) 0.378

Red blood cell-associated indices RBC ( 10 12 / L) 1.474 (0.414, 5.246) 0.549 0.256 (0.041, 1.587) 0.143 0.247 (0.031, 1.977) 0.188 HGB (g/l) 1.008 (0.971, 1.046) 0.672 0.955 (0.902, 1.011) 0.117 0.962 (0.904, 1.024) 0.223 HCT (%) 14.776 (0.000, 10047137.413) 0.694 0.000 (0.000, 95.782) 0.134 0.000 (0.000, 735.983) 0.169 MCV (fl) 0.956 (0.829, 1.101) 0.531 0.951 (0.794, 1.140) 0.589 0.956 (0.794, 1.151) 0.634 MCH (pg) 0.943 (0.652, 1.366) 0.757 0.821 (0.532, 1.289) 0.391 0.935 (0.577, 1.513) 0.783 MCHC (g/l) 0.998 (0.969, 1.028) 0.908 0.986 (0.941, 1.034) 0.560 1.002 (0.956, 1.051) 0.928 Table notes: BMI, body mass index; WBC, white blood cell; Neu (%), percentage of neutrophil; Neu ( 10 9 /L), counts of neutrophil; Mon (%), percentage of monocyte; Mon ( 10 9 /L), counts of monocyte; Lym (%), percentage of lymphocyte; Lym ( 10 9 /L), counts of lymphocyte; Eo (%), percentage of eosinophil; Baso (%), percentage of basophil; Eo ( 10 9 /L), counts of eosinophil; Baso ( 10 9 /L), counts of basophil; Neu/Lym, neutrophil to lymphocyte ratio; Mon/Lym, monocyte to lymphocyte ratio; PLT/Neu, platelet to neutrophil ratio; PLT/Lym, platelet to lymphocyte ratio; PLT, counts of platelets; PCT, plateletcrit; MPV, Mean platelet volume; INR, international normalized ratio; TCH, total cholesterol; TG, triglyceride; HDL-C, high density lipoprotein cholesterol; ApoA, apolipoprotein A; ApoB, apolipoprotein B; ApoE, apolipoprotein E; LPA, lipoprotein A; GLU, fasting glucose level; RBC, red blood cell; HGB, hemoglobin; HCT, red blood cell specific volume; MCV, erythrocyte mean corpuscular volume; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration. Odd ratios are calculated from binary logistic analysis. Patients were divided into two groups according to the 15.2 mm 2 or >15.2 mm 2 caseous necrotic areas of the granuloma under 5 microscope observation. aor1, odd ratios after adjusted for gender, age and BMI; aor2, odd ratios after adjusted for gender, age, BMI and NDM/DM status. Bold numbers indicate a P value of < 0.05.

e-table 3. Association analysis of immune and biochemical indices with extent of peri-necrosis fibro-encapsulation of granuloma in 67 TB (34NDM, 33DM) patients. Parameters Fibro-encapsulation Odd Ratio (95% CI) P Odd Ratio1 (95%CI) P Odd Ratio 2 (95%CI) P Demographic indices Male a 3.273 (1.082, 9.895) 0.036 2.371 (0.747, 7.526) 0.143 2.581 (0.727, 9.159) 0.142 Weight (kg) 0.977 (0.932, 1.024) 0.334 0.963(0.833, 1.115) 0.617 0.949 (0.806, 1.118) 0.534 Height (cm) 0.968 (0.902, 1.039) 0.368 0.963 (0.858, 1.080) 0.518 0.946 (0.828, 1.080) 0.411 Age (year) 1.016 (0.951, 1.086) 0.631 0.978 (0.908, 1.053) 0.554 0.975 (0.897, 1.059) 0.544 BMI 1.036 (0.883, 1.215) 0.664 1.016 (0.864, 1.195) 0.848 0.934 (0.777, 1.122) 0.465 Immune cell and inflammatory indices WBC ( 10 9 / L) 1.017 (0.769, 1.346) 0.904 1.005 (0.747, 1.351) 0.975 0.921 ( 0.654, 1.296) 0.637 Neu (%) 1.006 (0.939, 1.078) 0.866 1.018 (0.943, 1.099) 0.641 1.021 (0.936, 1.113) 0.646 Neu ( 10 9 /L) 0.979 (0.654, 1.464) 0.916 1.054 (0.685, 1.621) 0.811 0.964 (0.588, 1.579) 0.884 Lym (%) 0.997 (0.917, 1.085) 0.949 0.962 (0.874, 1.059) 0.424 0.956 (0.857, 1.066) 0.416 Lym ( 10 9 /L) 0.946 (0.453, 1.978) 0.883 0.787 (0.360, 1.719) 0.548 0.626 (0.256, 1.533) 0.306 Mon (%) 1.000 (0.775, 1.290) 0.999 0.942 (0.710, 1.250) 0.678 0.820 (0.592, 1.134) 0.230 Mon ( 10 9 /L) 0.817 (0.037, 18.166) 0.898 0.698 ( 0.025, 19.193) 0.831 0.078 (0.001, 4.019) 0.204 Eo (%) 0.954 (0.791, 1.149) 0.618 1.058 (0.876, 1.278) 0.558 1.107 (0.918, 1.336) 0.288 Baso (%) 2.523 (0.557, 11.428) 0.230 1.971 (0.368, 10.554) 0.428 1.509 (0.209, 10.888) 0.683 Eo ( 10 9 /L) 0.340 (0.015, 7.588) 0.496 0.387 (0.019, 7.779) 0.464 5.241 (0.220, 124.697) 0.306 Baso ( 10 9 /L) 2.165 (0.002, 2563.059) 0.831 0.379 (0.000, 665.711) 0.799 3.274 (0.001, 7672.588) 0.765 Neu/Lym 0.926 (0.457, 1.874) 0.831 1.411 (0.622, 3.198) 0.410 1.414 (0.572, 3.493) 0.453 Mon/Lym 0.754 (0.002, 280.650) 0.926 1.185 (0.001, 948.519) 0.960 0.072 (0.000, 134.456) 0.494 PLT/Neu 0.995 (0.974, 1.016) 0.616 0.998 (0.976, 1.020) 0.847 1.001 (0.977, 1.027) 0.916 PLT/Lym 0.996 (0.986, 1.006) 0.406 0.999 (0.988, 1.010) 0.936 1.001 (0.989, 1.012) 0.916 Platelet and coagulation indices PLT ( 10 9 /L) 0.997 (0.990, 1.004) 0.377 0.998 (0.990, 1.005) 0.549 0.998 (0.990, 1.007) 0.703 PCT (%) 0.001 (0.000, 6.366) 0.125 0.043 (0.000, 244.169) 0.476 0.717 (0.000, 8249.061) 0.944 MPV (fl) 1.160 (0.845, 1.591) 0.359 0.945 (0.661, 1.350) 0.755 1.149 (0.726, 1.820) 0.552 PT (seconds) 0.641 (0.333, 1.233) 0.183 0.668 (0.308, 1.449) 0.307 0.657 (0.283, 1.527) 0.329 INR 0.044 (0.000,74.194) 0.410 0.094 (0.000, 483.530) 0.588 0.047 (0.000, 505.134) 0.519 Fibrinogen (g/l) 1.488 (0.863, 2.566) 0.153 1.771 (0.959, 3.272) 0.068 1.187 (0.575, 2.450) 0.642 D-Dimmer (ng/ml) b 0.997 (0.994, 1.000) 0.022 0.997 (0.994, 1.000) 0.046 0.998 (0.994, 1.001) 0.155 Glucose and lipid-associated indices TCH (mmol/l) 0.807 (0.483, 1.349) 0.413 0.844 (0.485, 1.466) 0.547 0.924 (0.508, 1.678) 0.795 TG (mmol/l) 1.362 (0.810, 2.289) 0.245 1.355 (0.674, 2.725) 0.394 1.166 (0.529, 2.568) 0.703 LDL-C (mmol/l) 0.617(0.328, 1.159) 0.133 0.660 (0.342, 1.273) 0.215 0.795 (0.396, 1.597) 0.520 ApoB (mmol/l) 0.499 (0.070, 3.570) 0.489 0.503 (0.060, 4.193) 0.525 0.794 (0.075, 8.345) 0.847 ApoE (mmol/l) 1.025 (0.992, 1.059) 0.143 0.980 (0.944, 1.018) 0.296 0.980 (0.940, 1.021) 0.334 LPA (mmol/l) 1.001 (0.999, 1.003) 0.422 0.999 (0.997, 1.002) 0.659 0.999 (0.996, 1.002) 0.459 GLU (mmol/l) 1.221 (0.946, 1.577) 0.125 1.139 (0.879, 1.475) 0.325 0.775 (0.541, 1.111) 0.165

Red blood cell-associated indices RBC ( 10 12 / L) b 0.722 (0.221, 2.364) 0.590 0.192 (0.037, 1.004) 0.051 0.140 (0.020, 0.998) 0.050 HGB (g/l) 0.995 (0.961, 1.029) 0.758 0.966 (0.921, 1.013) 0.155 0.973 (0.923, 1.025) 0.304 HCT (%) 0.559 (0.000, 133477.645) 0.927 0.000 (0.000, 38.365) 0.129 0.000 (0.000, 50.973) 0.122 MCV (fl) 0.918 (0.806, 1.047) 0.202 1.064 (0.907, 1.249) 0.444 1.068 (0.899, 1.267) 0.454 MCH (pg) 1.303 (0.922, 1.842) 0.133 1.120 (0.747, 1.681) 0.583 1.404 (0.878, 2.243) 0.156 MCHC (g/l) 1.000 (0.974, 1.027) 0.973 0.994 (0.961, 1.027) 0.700 1.011 (0.979, 1.045) 0.507 Table notes: BMI, body mass index; WBC, white blood cell; Neu (%), percentage of neutrophil; Neu ( 10 9 /L), counts of neutrophil; Mon (%), percentage of monocyte; Mon ( 10 9 /L), counts of monocyte; Lym (%), percentage of lymphocyte; Lym ( 10 9 /L), counts of lymphocyte; Eo (%), percentage of eosinophil; Baso (%), percentage of basophil; Eo ( 10 9 /L), counts of eosinophil; Baso ( 10 9 /L), counts of basophil; Neu/Lym, neutrophil to lymphocyte ratio; Mon/ Lym, monocyte to lymphocyte ratio; PLT/Neu, platelet to neutrophil ratio; PLT/Lym, platelet to lymphocyte ratio; PLT, counts of platelets; PCT, plateletcrit; MPV, Mean platelet volume; INR, international normalized ratio; TCH, total cholesterol; TG, triglyceride; ApoA, apolipoprotein A; ApoB, apolipoprotein B; ApoE, apolipoprotein E; LPA, lipoprotein A; GLU, fasting glucose level; RBC, red blood cell; HGB, hemoglobin; HCT, red blood cell specific volume; MCV, erythrocyte mean corpuscular volume; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration. Odd ratios are calculated from binary logistic analysis. Patients were divided into two groups with slight (1+) and moderate plus severe (2+ plus 3+ ) fibro-encapsulation. aor1, odd ratios after adjusted for gender, age and BMI; aor2, odd ratios after adjusted for gender, age, BMI and NDM/DM status. Bold numbers indicate a P value of < 0.05. a female as reference. b indice with P<0.05, but the value of aor ratio (95% CI) includes /close to 1.000.

e-table 4. Association of immune and biochemical indices with sputum bacteria counts in 139 SP-TB (67NDM, 72DM) patients. Parameters Sputum bacteria counts Odd Ratio (95% CI) P Odd Ratio 1 (95%CI) P Odd Ratio 2 (95%CI) P Demographic indices Male a 0.454 (0.184, 1.117) 0.086 0.475 (0.188, 1.205) 0.117 0.407 (0.154, 1.075) 0.070 Age (year) 1.002 (0.975, 1.029) 0.904 0.997 (0.969, 1.026) 0.841 0.995 (0.966, 1.025) 0.741 Height (cm) 0.999 (0.955, 1.044) 0.957 1.067 (0.992, 1.148) 0.079 1.070 (0.993, 1.154) 0.075 Weight (Kg) 0.979 (0.946, 1.014) 0.239 1.081 (0.975, 1.199) 0.140 1.081 (0.971, 1.204) 0.153 BMI b 0.926 (0.825, 1.040) 0.195 0.931 (0.827, 1.049) 0.240 0.873 (0.767, 0.995) 0.041 Immune cell and inflammatory indices Neu (%) 1.027 (0.991, 1.064) 0.149 1.027 (0.987, 1.068) 0.186 1.022 (0.982, 1.064) 0.277 Lym (%) 0.972 (0.933, 1.013) 0.179 0.972 (0.929, 1.016) 0.213 0.973 (0.929, 1.018) 0.235 Lym ( 10 9 /L) 1.156 (0.670, 1.993) 0.603 1.460 (0.784, 2.719) 0.233 1.356 (0.707, 2.600) 0.359 Mon (%) 1.076 (0.941, 1.231) 0.284 1.103 (0.956, 1.273) 0.179 1.125 (0.967, 1.310) 0.128 Eo ( 10 9 /L) 0.034 (0.001, 1.004) 0.050 0.046 (0.002, 1.409) 0.078 0.052 (0.002, 1.512) 0.082 Baso ( 10 9 /L) 0.000 (0.000, 1.020) 0.050 0.000 (0.000, 197.356) 0.125 0.000 (0.000, 1435.196) 0.162 Neu/Lym 1.057 (0.975, 1.145) 0.178 1.045 (0.955, 1.144) 0.340 1.045 (0.955, 1.143) 0.339 PLT/Lym 1.002 (1.000, 1.004) 0.091 1.002 (0.999, 1.004) 0.206 1.002 (0.999, 1.005) 0.118 PLT/Neu 0.998 (0.986, 1.010) 0.748 0.995 (0.982, 1.008) 0.453 0.999 (0.985, 1.014) 0.936 CRP (mg/l) b 1.009 (1.001, 1.018) 0.027 1.012 (1.002, 1.021) 0.013 1.010 (1.001, 1.020) 0.030 ESR (mm/h) b 1.017 (1.006, 1.029) 0.003 1.020 (1.007, 1.032) 0.002 1.018 (1.005, 1.031) 0.006 Immune globins and complements IGG (g/l) 1.080 (0.988, 1.181) 0.091 1.090 (0.994, 1.197) 0.068 1.072 (0.971, 1.182) 0.169 IGA (g/l) 1.143 (0.897, 1.457) 0.281 1.206 (0.928, 1.567) 0.161 1.152 (0.877, 1.513) 0.309 IGM (g/l) 0.794 (0.472, 1.337) 0.386 0.752 (0.443, 1.277) 0.292 0.679 (0.382, 1.204) 0.185 C3 (g/l) 1.700 (0.579, 4.995) 0.334 2.359 (0.716, 7.769) 0.158 1.325 (0.362, 4.854) 0.671 C4 (g/l 0.517 (0.015, 18.018) 0.716 0.560 (0.014, 22.339) 0.758 0.123 (0.002, 6.252) 0.296 TRF (g/l) 0.715 (0.403, 1.269) 0.251 0.781 (0.427, 1.428) 0.422 0.592 (0.305, 1.146) 0.120 Platelet and coagulation indices PLT ( 10 9 /L) b 1.005 (1.001, 1.009) 0.010 1.006 (1.002, 1.010) 0.008 1.006 (1.002, 1.010) 0.005 PT (seconds) 0.981 (0.703, 1.369) 0.910 0.974 (0.685, 1.385) 0.884 1.032 (0.715, 1.488) 0.868 INR 9.541 (0.250, 364.633) 0.225 9.117 (0.200, 415.934) 0.257 24.611 (0.436, 1390.314) 0.120 Fibrinogen (g/l) 1.114 (0.844, 1.472) 0.446 1.173 (0.872, 1.577) 0.293 1.128 (0.826, 1.541) 0.448 D-Dimmer (ng/ml) 1.000 (1.000, 1.000) 0.284 1.000 (1.000, 1.000) 0.291 1.000 (1.000, 1.000) 0.177 FDP (mg/l) 1.035 (0.984, 1.089) 0.179 1.039 (0.985, 1.095) 0.161 1.050 (0.990, 1.114) 0.101 Glucose and lipid-associated indices TCH (mmol/l) 0.958 (0.676, 1.359) 0.812 1.017 ( 0.695, 1.486) 0.932 0.949 (0.632, 1.425) 0.801 TG (mmol/l) 1.549 (0.755, 3.179) 0.232 1.847 (0.839, 4.064) 0.127 2.111 (0.920, 4.845) 0.078 HDL-C (mmol/l) 0.477 (0.163, 1.399) 0.178 0.353 (0.113, 1.107) 0.074 0.356 (0.112, 1.137) 0.081 LDL-C (mmol/l) 1.090 (0.730, 1.630) 0.673 1.205 (0.774, 1.875) 0.409 1.058 (0.659, 1.698) 0.817 ApoB (mmol/l) 1.795 (0.465, 6.929) 0.396 2.732 (0.593, 12.582) 0.197 2.151 (0.429, 10.780) 0.352 ApoE (mmol/l) 1.011 (0.986, 1.036) 0.407 1.005 (0.979, 1.032) 0.709 1.010 (0.983, 1.038) 0.464 LPA (mmol/l) 1.000 (0.999, 1.001) 0.608 1.000 (0.999, 1.001) 0.605 1.000 (0.998, 1.001) 0.562

GLU (mmol/l) 1.040 (0.956, 1.132) 0.360 1.076 (0.976, 1.187) 0.141 0.981 (0.871, 1.105) 0.755 GA-L (%) 1.040 (0.995, 1.086) 0.082 1.055 (1.005, 1.107) 0.030 1.008 (0.944, 1.077) 0.807 Red blood cell-associated indices RBC ( 10 12 / L) 0.924 (0.560, 1.526) 0.759 1.118 (0.612, 2.041) 0.717 0.938 (0.498, 1.767) 0.843 HGB (g/l) b 0.976 (0.958, 0.995) 0.013 0.977 (0.955, 1.000) 0.045 0.972 (0.949, 0.996) 0.023 MCHC (g/l) 0.999 (0.971, 1.027) 0.932 1.006 (0.976, 1.037) 0.990 0.999 (0.968, 1.031) 0.945 Table notes: BMI, body mass index; Neu (%), percentage of neutrophil; Lym (%), percentage of lymphocyte; Lym ( 10 9 /L), counts of lymphocyte; Mon (%), percentage of monocyte; Eo ( 10 9 /L), counts of eosinophil; Baso ( 10 9 /L), counts of basophil; Neu/Lym, neutrophil to lymphocyte ratio; PLT/Lym, platelet to lymphocyte ratio; PLT/Neu, platelet to neutrophil ratio; CRP, C- reactionprotein; ESR, erythrocyte sedimentation rate; IGG, Immunoglobulin G; IGA, Immunoglobulin A; IGM, Immunoglobulin M; C3, complement component 3; C4, complement component 4; TRF, transferrin; PLT, counts of platelets; PT, prothrombin time; INR, international normalized ratio; FDP, Fibrinogen degradation product; TCH, total cholesterol; TG, triglyceride; HDL-C, high density lipoprotein cholesterol; LDL-C, low density lipoprotein cholesterol; ApoB, apolipoprotein B; ApoE, apolipoprotein E; GLU, fasting glucose level; GA-L (%), percentage of glycosylated hemoglobin; RBC, red blood cell; HGB, hemoglobin; MCHC, mean corpuscular hemoglobin concentration. Odd ratios are calculated from binary logistic analysis. Patients were divided into two groups according to less (class 1 and 2) and more (class 3 and 4 ) sputum bacteria amounts. aor1, odd ratios after adjusted for gender, age and BMI; aor2, odd ratios after adjusted for gender, age, BMI and NDM/DM status. Bold numbers indicate a P value of < 0.05. a female as reference; b indice with P<0.05, but the value of aor ratio (95% CI) includes /close to 1.000. 171706