Table S1. qpcr primer list.

Similar documents
SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.

Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols

Differentiation of hypothalamic-like neurons from human pluripotent stem cells

Ophthalmology, Radiation Oncology,

Insulin-Leptin Interactions

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells

SUPPLEMENTARY INFORMATION

Supplementary Information

Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice

Hypothalamus. Small, central, & essential.

Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4

Supplementary Figure 1

Application of induced pluripotent stem (ips) cells in intractable childhood disorders

SUPPLEMENTARY INFORMATION

Supplementary Information

Supplementary Figure 1. Chimeric analysis of inner ears. (A-H) Chimeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears.

SUPPLEMENTARY INFORMATION

Examination of Thyrotropin-Releasing Hormone (TRH)-synthesizing System in the Rodent Hypothalamus

SUPPLEMENTARY INFORMATION

Cell Type Nervous System I. Developmental Readout. Foundations. Stem cells. Organ formation. Human issues.

mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons

Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus

SUPPLEMENTARY INFORMATION

BIOM2010 (till mid sem) Endocrinology. e.g. anterior pituitary gland, thyroid, adrenal. Pineal Heart GI Female

Ingestive Behaviors 33. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model)

Teratoma Formation Pluripotency Analysis Report

Cluster Dendrogram. dist(cor(na.omit(tss.exprs.chip[, c(1:10, 24, 27, 30, 48:50, dist(cor(na.omit(tss.exprs.chip[, c(1:99, 103, 104, 109, 110,

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1.

Fig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Supplementary Figure 1: Validation of labeling specificity of immature OSNs and presynaptic terminals. (A) (B) (C) (D) (E)

BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.

SUPPLEMENTARY FIGURES

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway

Prss56, a novel marker of adult neurogenesis in the mouse brain. - Supplemental Figures 1 to 5- Brain Structure and Function

Nature Neuroscience: doi: /nn Supplementary Figure 1

Forming Embryonic-Like Nervous Tissues and Organs by Muscle-Derived Neuroepithelial Myogenic Progenitors

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Zhu et al, page 1. Supplementary Figures

REPRODUCTIVE ENDOCRINOLOGY OF THE MALE

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane

MPB333:Molecular Endocrinology of Obesity and Diabetes

Endocrine Glands. Endocrine glands

SUPPLEMENTARY INFORMATION

In vivo reprogramming reactive glia into ipscs to produce new neurons in the

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.

Stage 5: Immature endocrine Stage 4 cells were cultured for seven days in DM-F12 medium supplemented with 1% B27 and 1 µm ALK5 inhibitor.

Supplementary Figure 1

Figure S1, Beyer et al.

Neuroendocrinology an integrative approach

Interactions between bone and the central nervous system Florent Elefteriou, PhD

SUPPLEMENTARY FIGURES

Temperature, Regulation, Thirst, and Hunger

Stem Cells and the Study of Neurodegeneration. Tracy Young-Pearse, PhD September 12, 2014!

Internal Regulation II Energy

ProteoScan Cancer Lysate Arrays. QC and Validation Data

Cell therapeutics for the Insulin-Dependent Diabetes Mellitus

Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like

DISCLOSURES FUNCTIONS OF THE HYPOTHALAMUS

Martínez, Schwartz, Smale & Nunez

Neocortex Zbtb20 / NFIA / Sox9

Cell Birth and Death. Chapter Three

CNS Control of Food Intake. Adena Zadourian & Andrea Shelton

ENDOCRINE SYSTEM. Endocrine

SUPPLEMENTARY INFORMATION

Brain Development III

SUPPLEMENTARY INFORMATION

-51mV 30s 3mV. n=14 n=4 p=0.4. Depolarization (mv) 3

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.

Boucher et al NCOMMS B

GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!

The Obesity Susceptibility Gene Carboxypeptidase E Links FoxO1 Signaling in Hypothalamic Pro opiomelanocortin Neurons with Regulation of Food Intake

Supplementary Fig. 1 Blocking shh function at the protein level confirms its role as a guidance cue for postcommissural axons.

Supplementary Figure 1. A microarray screen of organizers compared to non-organizer tissue reveals a putative organizer gene set.

Research programs involving human early embryos

NROSCI/BIOSC 1070 and MSNBIO 2070 September 11, 2017 Control Mechanisms 2: Endocrine Control

Supplemental Materials. Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in. Pancreatic Cancer.

Supplementary information. Nkx2.1 regulates the generation of telencephalic astrocytes during embryonic

FLASH CARDS. Kalat s Book Chapter 10 Alphabetical

Supplemental Information. Cell-Autonomous Regulation of Astrocyte. Activation by the Circadian Clock Protein BMAL1

Ingestive Behaviors 21. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model)

Neuroepithelial Cells and Neural Differentiation

Supplementary Figure S1: Pial and periventricular vascular networks and the dual GABA neuron streams of the early embryonic mouse telencephalon

Effect of neonatal treatment with MSG (Monosodium glutamate) on thyroid of the adult male rats

SUPPLEMENTARY INFORMATION

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,

Glioblastoma Multiforme

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

SUPPLEMENTARY FIGURES AND TABLE

Controlled induction of human pancreatic progenitors produces functional beta-like cells in vitro

The Pathology of Germ Cell Tumours of the Ovary

Orexin and Sleep. Team: A Little Bit of Leptin

Columbia College of P&S Sarah Huang Hans Snoeck biorxiv ; doi: /261461

Unique functional properties of somatostatin-expressing GABAergic neurons in mouse barrel cortex

Development Team. Department of Zoology, University of Delhi. Department of Zoology, University of Delhi

A Cxcl12-Cxcr4 Chemokine Signaling Pathway Defines

Hypothalamus & pituitary gland

Transcription:

Table S1. qpr primer list. Genes Forward primer Reverse primer NANOG AAATGGGAAGAATAGA GGTTAGTGGGTTA PAX6 TTTTGTTGGGAAATG TGGTTAAATTTAG ASL1 AAGATGAAAGAAAG GGAGTTTGATTAA NHLH GTGGATAGATATTT ATATTTTGGAATTT NKX.1 AAAAGGATAATTAAGG TGTGAGAGTGAAGTTTGGTT OTP GGAAAGTTGGTGTTTT TTGAAGATATA SIM1 TTTTGTGTGAAATGAA AATGATGAAAAG SF1 TGTATTGTAGATGGG GATGATGTAAATGG NESTIN GGGATAAGATGT TTGGGGTTGAAAGTG POM GAATGGTGTTAG AGAGTGAGAA AGRP GGATTGTTGAGGAGGTAG TGAAGAAGGGAGTAGAGT GGTTTAAGGAGTTTG AATATAAGGAGAG LEPR ATGTTGAAAAGAAT GGAAATGTATGATG SST AGATGTAGTTTTGA TTAGGGATATTTGT PMH ATTGGGGATGAAGAAAATAGT GATTGAAAAGGTGGTAG PSK1 AAGGTGTGATATTG AAATGATGAGGAGA PSK TTTGGTAAATTTTG TGAAAGGAAGAGAAGA PE TAAATTAGGTAAGG ATAGAGGATTTAAG MR AGTAGGGGTTATTGGGA ATAATGAATTG M3R GGTTGATGAAGATGT TAGAAATGTAATG M4R TTATGATGATAAG GTAGTTTGTTGAT OPRM1 TGGTGGAGTTTATTTG GATATGGTTATA OPRD1 GTAGATGTTGGTGGGTT ATAGGTTATG TP AAAAAGTGATTA GATAAGGATATTGGA M TAGTGTGTGGGTAT TTTGTGGATGAGG 35

Table S. List of primary Abs and their concentrations and sources used in this study. Antibody Species Dilution Source atalog No. Sheep 1:1 Millipore A587 POM chicken 1:5 Abcam ab1464 Rabbit 1:15 Novus npb1-1988 Somatostatin Rat 1:5 Abcam ab3788 MH Rabbit 1:5 Sigma M844 AGRP Rabbit 1: Phoenix Pharmaceuticals H-3-53 AGRP Goat 1:5 Neuromics GT153 TH Rabbit 1:5 Abcam ab7613 GAA Rabbit 1:5 Sigma A5 GAD67 Mouse 1:5 Millipore MA546 Mash1 Rabbit 1: W 1:5 Abcam ab7465 Pax6 Rabbit 1:1 W 1:5 ovance PR-78P Nkx.1(TTF1) Rabbit 1: W 1:1 Abcam ab7613 FoxG1 Rabbit 1: Abcam ab1859 Sox1 Goat 1:5 R&D AF3369 Nestin Mouse 1:5 Stemgent 9-45 β endorphin Rabbit 1: From Sharon Wardlaw PE Goat 1:3 R&D AF3587 MAP hicken 1:1, Abcam A539 Tra-1-6 Mouse 1:3 Millipore MA436 Tra-1-81 Mouse 1:3 Millipore MA4381 Nanog Goat 1:5 R&D Systems AF1997 Sox Rabbit 1:5 Stemgent 9-4 Oct4 Rabbit 1:5 Stemgent 9-3 SSEA4 Mouse 1:3 R&D Systems MA1435 p-stat3 Mouse 1: W 1:1 ell signaling 4113 p-stat3 Rabbit 1: W 1:1 ell signaling 9145 p-akt(t38) Rabbit W 1:1 ell signaling 975 p-akt(s473) Rabbit W 1:1 ell signaling 46 -FOS Rabbit 1: ell signaling 5 STAT3 Rabbit W 1:1 ell signaling 164 AKT Rabbit W 1:1 ell signaling 97 ATIN Rabbit W 1:1 ell signaling 8457 36

OTP ARNT SIM1 POU3F SF1 NKX.1 MASH1 NHLH OTP 3V ME PVH AR VMH GHRH AVP TRH OXT RH LH POM DA GAA AGRP SST GAA SST 1 3 4 5 6 7 8 MH OREXIN F 1k/well,E Rocki LS SHH 1ng/ml PM um a. 7 b. LS/SHH/PM c. 7/DAPT Day 1 3 4 5 6 7 8 11 KSR bfgf KSR KSR N 7/DNF N NKX.1-GFP+ Day 1 3 5 7 9 11 13 6 KSR KSR/N N No Tx LS LS+SHH 1ng/ml (Day3-13) LS+SHH 1ng/ml (Day5-13) LS+SHH 1ng/ml (Day7-13) LS+SHH 1ng/ml (Day9-13) LS+SHH 1ng/ml (Day11-13) 14 1 1 3 4 5 6 7 8 9 1 11 LS+SHH 1ng/ml (Day3-11) LS+SHH 1ng/ml (Day3-9) LS+SHH 1ng/ml (Day3-7) LS+SHH 1ng/ml (Day3-5) Day 11 cells N/7 GFP+ N/LS/SHH/PM D 9 1 11 Day6 E E Day1 Day 6 1 8 6 4 ** * ** N/7/DAPT % NKX.1-GFP 8 6 4 No SHH PM SHH+PM NKX.1-GFP % 1 8 6 4 No SHH SHH+PM ASL1 NHLH NKX.1 OTP SIM1 SF1 FOXG1 PAX6 NESTIN Figure S1. Early activation of SHH signaling and subsequent inhibition of Notch signaling induces the production of hypothalamic NKX.1 progenitors. (A) Illution of the adult medial hypothalamus with region-related gene expression of hypothalamic markers based on published data(1, 16-1). AR: arcuate nucleus, VMN: ventromedial nucleus, PVN: paraventricular nucleus, LH: lateral hypothalamus, ME: median eminence. Markers on the left indicate the transcription factors expressed while markers on the right display the gene expressed in specific hypothalamic nuclei; (-) The timing of SHH influences the expression of NKX.1-GFP in day 6 differntiated Es. 11 conditions and 9 timings of SHH were indicated in while the actual expression of NKX.1-GFP were shown in for each condit; (D-E) FAS analysis of the percentage of NKX.1-GFP cells in day 6 Es treated with no SHH, um Purmorphamine (PM) and SHH 1ng/ml + μm PM from days 3 to 13 (D) and day 1 cells. N=1 for each bar; (E) from monolayer feeder-free differentiation with (n=3) or without (n=1) SHH 1ng/ml + um PM (from days 1-8). LS were used in both cases; (F) qpr of transcription factor genes in day 11 cells from three conditions (only differ from day 8 to day 11). N=3 for each bar.

NESTIN SOX1 FOXG1 Tra-1-6 Day 1 Day 4 Day 8 Day 1 Figure S. Temporal expression of transcription factors in early hypothalamic neuron induction and patterning. Immunocytochemical analysis of neuron progenitor markers and stem cell marker in cells of 1, 4, 8 and 1 days of differentiation. Tra-1-6 is a pluripotency marker. FOXG1 is a telencephalon progenitor markers. SOX1 and NESTIN are general markers for neuron progenitors. Scale bar, μm.

NKX.1 Day 4 GAD67 Day 46 GAD67 Day 4 Figure S3. -derived neurons express hypothalamic neuron markers. (A) Immunocytochemical analysis of day 4 differentiated neurons with alphamsh and NKX.1; () Immunostaining of day 46 neurons with and GAA; () Immunocytochemical analysis of day 4 neurons with alphamsh and GAD67. Scale bar,1μm.

F iotin iotin iotin D E F POM+ + POM- + POM- - mv ms current step Figure S4. Neurons made from hypothalamic NKX.1+ cells fire action potentials. Representative current clamp recordings and post hoc identification of POM+ or + neurons (days 4 to 33). After recording, cultures were fixed and stained for, and recorded cells (biotin+) cells identified with streptavidin-alexa-488.(a) POM++; () POM-+; () POM-- neurons. Left column of images: DI image (4x) of live cells prior to recording. Arrows indicate the recorded neurons.scale bar, 1μm; (D-F) Action potential firing in the neurons identified in (A ). Membrane potential traces in response to a 1s current step, as shown under trace (E), were recorded. The amplitude of the current step was dependent on the individual cell. (D) POM++ (neuron in A), (E) POM- + (neuron in ),(F) POM-- (neuron in ). Dashed lined = -6 mv. Total number of identified cells recorded: POM++ N= 3, POM-+ N=, POM-- N= 4.

Day1 Day 7 Day 8 luster1 GOTERM_P_FAT Term ount % P-Value 35.61.14E-15 GO:3595~tube development 5 3.3 1.6E-11 95 6. 6.68E-11 luster gene expression 97 6.15 6.74E-11 56 16.3 1.16E-1 GO:45165~cell fate commitment 34.16 3.3E-8 development 41.6 3.85E-7 system development 38.41 1.43E-6 luster3 luster4 GOTERM_P_FAT Term ount % P-Value 147 6. 7.77E-4 GO:749~cell cycle 49 1. 1.4E-4 GO:4~cell cycle process 197 8.7 1.57E-37 15 6.14 5.1E-37 157: 6.43 1.11E-34 GO:43~cell cycle phase GO:767~mitosis 98 4.1 4.53E-8 GO:5131~cell division 113 4.63 1.84E-5 83 3.4 3.54E-3 luster5 luster6 PATHWAY ANALYSIS ategory Term ount % P-Value KEGG_PATHWAY hsa47: Neurotrophin signaling pathway 6 1.85 5.79E-4 KEGG_PATHWAY hsa491: GnRH signaling pathway 19.793.9 P4379: eta3 adrenergic receptor P4391: Oxytocin receptor mediated P4374:5HT type receptor mediated P5915:Opioid proenkephalin pathway P4385:Histamine H1 receptor mediated 1 15 15 1 1 11.418.66.668.418.418.459.3.6.9.1.13.19 luster7 luster8 P4378: eta adrenergic receptor 11.459.3 P4386: Histamine H receptor mediated 8.334.3 P15: ircadian clock system 6.51.3 P5916: Opioid prodynorphin pathway 9.376.31 1 8 6 4 POM AGRP SST 15 5 8 Day1 4 6 Day18 1 3 Day4 4 Day36 5 Day4 1 15 1 5 OTP 4 3 1 PMH 6 4 M3R 1 8 6 4 M4R Figure S5. RNA sequencing of differentiated neurons reveals hypothalamic gene signatures. (A) Heatmap from hierarchical clustering analysis of RNA sequencing results from undifferentiated ; day1 neuron progenitors; days 7 and 8 of neuronal differentiation. Gene Ontology and pathway analysis were performed for genes in eight major clusters defined by the gene expression patterns according to all samples. Data are shown for Gene Ontology results for clusters 1 (highly expressed in day 1 progenitor cells) and 3 (highly expressed in s), and pathway analysis for the top hits in cluster 6 (highly expressed in differentiated neurons); () Temporal expression of hypothalamic transcripts during Nkx.1 GFP/W- neuronal differentiation. qpr analysis of RNA samples from, and cells at 1, 18, 4, 36 and 4 days of neuronal differentiation. N=3 for each bar.

-Leptin -Leptin A 15 INSR IRS 6 IRS4 FPKM 1 5 FPKM 15 1 5 FPKM 4 Day 1 Day 5-7 Day 8 Day 1 Day 5-7 Day 8 Day 1 Day 5-7 Day 8 D Day 9 neurons E MAP p-stat3 F Normaolized to TP 8 6 4 c-fos LEPR SOS3 No leptin 1ug/ml leptin +Leptin Day 35 +Leptin Day 53 G Day 35 Figure S6. Mouse cortical astrocyte co-culture induces leptin responsiveness of differentiated hypothalamic neurons. (A-) RNA-seq data for insulin signaling molecules INSR, IRS and IRS4 expression in, 1 (n=3), 5-7 (n=3) and 8 days of differentiated cells; (D) qpr analysis of LEPR and SOS3 in leptin-treated day 9 differentiated neurons (n=3); (E) Immunostaining for p-stat3 and MAP in leptin treated day 35 neurons. Scale bar, μm; (F) Immunocytochemical analysis for c-fos and in day 53 -derived hypothalamic neurons co-cultured with mouse astrocytes. Scale bar, 1μm; (G) Immunostaining of and in day 35 mouse astrocyte co-cultured neurons. Scale bar, 1μm.

SOX OT4 NANOG SSEA4 TRA-1-6 TRA-1-81 ontrol 1 ontrol S1A S1 S1 Ectoderm Mesoderm Endoderm x ontrol 1 ontrol 1 Neural rossett artilage Gut endocrine cells S1A artilage S1A Gut endocrine cells Neural epithelium Epidermis S1 S1 artilage Gut endocrine cells S1 artilage S1 Gut endocrine cells Neural epithelium Figure S7. All control and S ipss are pluripotent and have normal karyotypes. (A) Immunocytochemistry analysis of two control (ontrol 1, ontrol ) and three S (S1A, S1, S1) ipss with pluripotency markers as indicated. Scale bar, μm; () H&E staining of control and S ips-derived teratoma sections. We identified cell types representing all three germ layers in all ips-derived terotomas; Images were taken with x objective lens; () Karyotyping of control and S ips lines. All of these lines had normal karyotypes.

ontrol 1 Nkx.1 Hoechst ontrol S1A S1 S1 Day 1 POM POM SST EP ontrol 1 S1 Day 5 Day 5 EP EP ontrol S1 Day 5 Day 5 EP ontrol (day 3) S1 (day 35) S1A mv ms Day 5 urrent step urrent step Figure S8. Efficient generation of hypothalamic neurons from human ipss. (A) Immunostaining of NKX.1 in Day 1 progenitors derived from five independent ips lines: ontrol1, ontrol, S1A, S1 and S1; Scale bar, μm; () Immunostaining of day 5 neurons with hypothalamic neuron markers. Scale bar, 1μm; () Action potential firing in ontrol (day 3) and S1 (day 35) ips-derived neurons. Membrane potential traces in response to a 1s current step, as shown under trace, were recorded. Dashed lined = -6 mv.

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback