Pharmacokinetic Determinants of Statin-Induced Myopathy Rommel G. Tirona, B.Sc.Phm., Ph.D. Departments of Physiology & Pharmacology and Medicine The University of Western Ontario, London, Ontario, Canada ACS New Jersey Drug Metabolism Discussion Group Somerset, New Jersey Wednesday October 13, 21
Statins HMG-CoA reductase inhibitors Inhibit biosynthesis of cholesterol Highly effective for the treatment of hypercholesterolemia, a major risk factor for cardiovascular disease Lactone and hydroxyacid forms Varying in lipophilicity 4.7 4.5 4.5 2.2 5.7 logp in red 3.4 2.4 Tobert, Nat Rev Drug Discov 23
Statin-Associated Myopathy 3 million Americans on statin therapy Well tolerated Major complaint Myalgia Muscle pain/weakness Affects 5-15% of treated patients 3 million Americans experience skeletal muscle side effects Muscle effects range from myalgia to rhabdomyolysis
Proposed Mechanisms of Statin-Associated Myopathy STATIN HMG-CoA Mevalonate Necrosis Mitochondria Isoprenylation Geranylgeranylpyrophosphate Rab GTPase Atrophy Apoptosis Caspase 3/9 Activation
Risk Factors for Statin-Associated Myopathy Risk Factors Increased age Female sex Renal or hepatic impairment Hypothyroidism Small body frame and frailty Perioperative periods Statin Characteristics Dose Lipophilicity Potential for metabolic drug interactions Co-medications Other myotoxic drugs Metabolic inhibitors of CYP or UGT Jacobson, Am J Cardiol 26
Cytochrome P45 Polymorphisms Associate with Statin Disposition Fluvastatin Simvastatin Kirchheiner et al., Clin Pharmacol Ther 23. Kim et al., J Clin Pharmacol 27.
Hepatic Drug Transporters 2 (Ho and Kim, Clin Pharmacol Ther 25)
Uptake Transporters Organic anion transporting polypeptides (OATP) Organic anion transporter (OAT) Organic cation transporter (OCT) Sodium dependent tauocholate transporting polypeptide (NTCP) Peptide Transporter (PEPT) STATIN STATIN STATIN STATIN N
Rosuvastatin Uptake Transporters Rosuvastatin Uptake (% Vector-only Control) 2 1 Control OATP1A2 OATP2B1 OATP1B1 OATP1B3 NTCP ASBT OCT1 Ho et al., Gastroenterology 26
Hepatic Statin Uptake Transporters Transporter Simvastatin Acid Pravastatin Fluvastatin Atorvastatin Rosuvastatin Pitavastatin OATP1A2 + + + OATP1B1 + + + + + OATP1B3 + + + + OATP2B1 + + + + NTCP + + +
OATP1B1 Variants N151S R152K D462G C485F N13D P155T E156G D241N G488A V82A I353T L543W Extracellular L643F Intracellular F73L V174A P336R N432D D655G E667G Tirona et al., J Biol Chem 21
Allelic Frequencies of SLCO1B1 SNPs in Selected Populations SNP Frequency African American Caucasian American Finnish German Japanese South Asian c.388g>a (N13D).74.3.45.37.62.57 c.521t>c (V174A).2.14.21.15.14.7 Reference Tirona et al., 21 Tirona et al., 21 Niemi et al., 24 Mwinyi et al., 24 Nozawa et al., 22 Nishizato et al., 23 Jada et al., 27
Decreased Statin Transport by OATP1B1 Variants Percent OATP1B1*1a Activity 1 75 5 25 Rosuvastatin * *1a *1b *5 388 521 A T G T A C G C *1a *1b *5 *15 Ho et al., Gastroenterology 26 Nozawa et al., Drug Metab Disp 25 Ho et al., Gastroenterology 26
Membrane Trafficking Defect in OATP1B1 521C Variant Total Cell Surface kda 15 75 5 kda 15 75 5 Anti-OATP1B1 388 521 A T A C *1a *5 Tirona et al., J Biol Chem 21
OATP1B1 Variants and Pravastatin Pharmacokinetics C H 3 CH3 HO O O HOOC H HO hydrophillic statin OATP1B1, OATP2B1 and NTCP substrate high liver distribution uptake rate-limited wide interindividual variability not metabolized H CH 3 OH 6 5 4 3 2 1 Blood 2 4 6 8 1 12 Time OATP 1B1 Hepatocyte Efflux Bile Decreased Activity Normal Activity Enhanced Activity (Hsiang et al., JBC 1999; Nakai et al., JPET 21 Kobayashi et al., JPET 23; Yamazaki et al., 1996/7; Neuvonen et al., 1998)
OATP1B1 521 Variants and Pravastatin Pharmacokinetics Pravastatin Concentration (ng/ml) 8 6 4 2 521 C/C (N=2) T/C (N=17) T/T (N=88) 388 521 T A T *1a *1a T G T *1b *1b C A C *5 *5 C G C *15 *15 2 4 6 8 1 12 Time (hr) Ho et al., Pharmacogenet Genomics 27
SLCO1B1 Haplotypes and Pravastatin Pharmacokinetics 2 Pravastatin AUC (ng hr/ml) 15 1 5 25 34 29 1 8 8 2 388 521 A T G T A C G C *1a *1b *5 *15 AUC 67 9 87 59 1 121* 167* Ho et al., Pharmacogenet Ho et al., Pharmacogenetics Genomics (in press) 27
Factors Associated with Pravastatin Exposure Model covariates P-value R 2 (%) Gender <.1 11.1 BSA <.1 12.2 Assay sensitivity.4 7.8 SLCO1B1 521T>C.31 6.5 Race.1 6.2 521T>C/Race.12 1. Gender/BSA/Assay sensitivity/521t>c/race <.1 3.7 Ho et al., Pharmacogenet Ho et al., Pharmacogenetics Pharmacogenomics Genomics 28 (in press)
OATP1B1 521T>C Polymorphism Differentially Affects Statin Pharmacokinetics Statin Relative Exposure Reference 521TT 521TC 521CC Pravastatin 1 1.5 2.3 Ho et al., 27 Simvastatin Acid 1 1.3 3.2 Pasanen et al., 26 Fluvastatin 1 1.1 1.2 Pasanen et al., 26 Atorvastatin 1 1.5 2.4 Pasanen et al., 27 Rosuvastatin 1 1.6 1.6 Pasanen et al., 27 Pitavastatin 1 1.8 Chung et al. 25
SLCO1B1 Genetics Associates with Skeletal Muscle Side Effects of Simvastatin Study of the Effectiveness of Additional Reductions in Cholesterol and Homocysteine (SEARCH) Niemi, Clin Pharmacol Ther 29 Link et al., NEJM 28
SLCO1B1 Genetics Associates with Skeletal Muscle Side Effects of Simvastatin STRENGTH (Statin Response Examined by Genetic Haplotype Markers) Study Statin Plasma Level (ng/ml) Voora et al., JACC 29
SLCO1B1 Genetics and Dose Recommendations (Niemi, Clin Pharmacol Ther, Nov 29)
mrna Copy Num kda 123 71 D. mrna E. kda 123 2 1 OATP1B3 Male OATP1B3 Female Variability in Hepatic OATP Expression OATP1B1 OATP1B3 OATP2B1 OATP1B1 Male OATP1B1 OATP1B3 OATP2B1 2 5 2 1 5 1 5 Human Liver Samples NTCP C. mrna Copy Number 175 15 125 1 75 5 OATP1B1 Female 25 Female HL 14 HL 13 HL 114 HL 116 HL 127 HL 129 HL HL 14 14 HL HL 131 131 HL 14 HL HL 14 14 HL 13 HL 136 HL 114 HL 38 HL 116 HL 111 HL 127 HL 135 HL 129 HL HL 14 14 HL 14 HL 13 HL 131 HL HL 1 1 HL HL 14 14 HL 134 HL 136 HL 123 HL HL 38 38 HL 19 HL HL 111 111 HL 118 HL 135 HL 132 HL HL 3 3 HL HL 14 14 HL HL 13 13 HL HL 1 1 HL HL 134 134 HL HL 123 123 HL HL 19 19 HL HL 118 118 HL HL 132 132 HL HL 3 3 OATP1B1 OATP1B3 OATP2B1 71 D. mrna kda HL HL 14 14 HL HL 13 13 HL HL 114 114 OATP1B3 Male HL HL 116 116 HL HL 127 127 HL HL 129 129 2 5 2 1 5 1 5 HL HL 14 14 HL HL 131 131 HL HL 14 14 HL HL 136 136 HL HL 38 38 HL HL 111 111 HL HL 135 135 HL HL 14 14 OATP1B3 Female HL HL 13 13 HL HL 1 1 HL HL 134 134 HL HL 123 123 HL HL 19 19 HL HL 118 118 HL HL 132 132 HL HL 3 3 123 71 2 5 2 1 5 1 Ho et al., Gastroenterology 26
Variability in Hepatic OATP Expression Meyer zu Schwabedissen et al., Hepatology 21
Regulation of Transporters by the Bile-Acid Sensor, Farnesoid X Receptor Eloranta et al., Physiology 28
A Common Polymorphism in the Farnesoid X Receptor With Decreased In Vitro Activity Chromosome 12 FXR cdna E1 E2 E3 E4 E5 E6 E7 E8 E9 E1 E11 FXR ORF AF -1 DNA Binding Hinge Ligand Binding G-1T(*1B) C643T(*2) G646T(*3) FXR G-1T (*1B) M G S K M N L Exon 3 GAAAAATTTGGATGGGATCAAAAATGAATCTC +1 FXR Transcriptional Activity 2. 15. 1. 5. 1..5 Control CDCA 2 mm * * SNP Exon Amino acid change Allele frequencies (%) European African Chinese Hispanic. G-1T(*1B) 3 non coding 2.5 3.2 12.1 5.8 C643T (*2) 6 H215Y.7 G646T (*3) 6 A216S.5 C783T 7 N261N.5 C1341T 11 H447H.5 Marzolini et al., Mol Endocrinol 27 27
FXR*1b Polymorphism is Associated with Decreased Hepatic OATP mrna Expression Relative OATP1B1 Expression 4. 35. 3. 25. 2. 15. 1. 5.. OATP1B1 OATP1B1 p =.2693 FXR*1B Relative OATP 1B3 Expression 45. 4. 35. 3. 25. 2. 15. 1. 5.. OATP1B3 p =.11 FXR*1B Marzolini et al., Mol Endocrinol 27 27
Efflux Transporters P-glycoprotein (P-gp) Multidrug Resistance Associated Proetin (MRP) Breast Cancer Resistance Protein (BCRP) Bile Salt Export Pump (BSEP) N STATIN STATIN STATIN STATIN
Hepatic Statin Efflux Transporters Transporter Simvastatin Acid Pravastatin Fluvastatin Atorvastatin Rosuvastatin Pitavastatin P-gp + + + + MRP2 + + + + BCRP + + + + BSEP +
ABCG2 (BCRP) 421C>A Polymorphisms Differentially Affect Statin Pharmacokinetics ABCG2 Caucasian African Asian c.421c>a Q141K.15.5.3 Zhang et al., Clinica Chimica Acta 26 Keskitalo et al. Clin Pharmacol Ther 29 Keskitalo et al., Pharmacogenomics 29
ABCB1 (P-gp) Polymorphisms Differentially Affect Statin Pharmacokinetics Simvastatin Fluvastatin Pravastatin Simvastatin Acid Lovastatin Lovastatin Lactone Atorvastatin Atorvastatin Lactone Rosuvastatin 2677TT 893Ser 2677GG 893Ala Keskitalo et al., CPT 28 Keskitalo et al., Br J Clin Pharm 29
Statin Transporter Polymorphisms and Pharmacodynamics HMG-CoA Statins Uptake Mevalonate Efflux Blood Hepatocyte Cholesterol Bile
OATP1B1 521T>C Transporter Polymorphisms and Pharmacodynamics Statin (daily dose in mg) Number of Subjects Effect of SNP on Lipid Response Reference Several Statins (dose not controlled) Several Statins (dose not controlled) Pravastatin (4 mg) Pravastatin (mean 9.4 mg) Pravastatin (2 mg) Simvastatin (4 mg) 66 Reduced effect on LDL-C lowering 2735 Enhanced effect on HDL-C for AVA and FVA Tachibana-Iimori et al., Drug Metab Pharmacokinet 24 Thompson et al., Pharmacogenomics J 25 16 No effect on lipids Igel et al., CPT 26 33 Reduced effect on Tchol and LDL-C lowering at 56 days Takane et al., J Human Gen 26 45 Reduced effect on Tchol Zhang et al., Br J Clin Pharmacol 27 1666 Reduced effect on LDL-C lowering Link et al., NEJM 28
Breast Cancer Resistance Protein (ABCG2) Polymorphisms and Pharmacodynamics Transporter (SNP) 421C>A Statin (dose in mg) Rosuvastatin (1 mg) Number of Subjects Effect of SNPs on Lipid Response 35 Enhanced effect on LDL-C Reference Tomlinson et al., CPT 21 421C>A Rosuvastatin 3 Enhanced effect on LDL-C Bailey et al., Circ Cardiovasc Genet 21
What about skeletal muscle distribution of statins?
Tissue Distribution of Rosuvastatin in the Mouse [ 3 H]Rosuvastatin 1mg/kg IV Mouse Tissue/Plasma Ratio 1 1 1 Liver Kidney Brain Testis Heart Quadriceps Gastrocnemius EDL.1
A B Drug Transporter Expression in Human MRP1 mrna (Relative Expression) MRP5 mrna (Relative Expression) 1.5 1..5. 3 2 1 MRP1 MRP5 Skeletal Muscle HSMM Liver Kidney Small Intestine MRP2mRNA (Relative Expression) OATP2B1 mrna (Relative Expression) 25 2 15 1 5 8 6 4 2 1 8 6 4 2 Skeletal Muscle HSMM MRP2 OATP2B1 Liver Kidney Small Intestine Skeletal Muscle MRP4 mrna (Relative Expression) BCRP mrna (Relative Expression) 8 6 4 2 6 5 4 3 2 5 4 3 2 1 Skeletal Muscle HSMM MRP4 BCRP Liver Kidney Small Intestine Knauer et al., Circ Res 21
OATP2B1 in Skeletal Muscle Transports Statins Rosuvastatin Uptake (fmol/mg protein) Atorvastatin Uptake (fmol/mg protein) 4 3 2 1 2 19 18 17 5 4 3 2 1 Sk. Muscle Liver Intestine Kidney Vector Control ** *** OATP2B1 + * ** ** * *** *** *** OATP1B1 OATP1B3 OATP1A2 OAT3 - - - - + + +++ --+ -- -- ** ** roatp1b2 - + -- Rosuvastatin Uptake (fmol/mg protein) Atorvastatin Uptake (fmol/mg protein) 1.5 1..5. 5 4 3 2 1 DMSO DMSO Vector Control ** ** * ** OATP2B1 ** ** *** *** *** ** ** ** * * Cerivastatin Gemfibrozil Gemfibrozil-Glu Fenofibrate Rifampin Glyburide Cyclosporine A Knauer et al., Circ Res 21
Novel Statin Efflux Transporters in Skeletal Muscle Knauer et al., Circ Res 21
OATP2B1 and MRP1 Modulate Statin Accumulation in Cultured Human Skeletal Myotubes Knauer et al., Circ Res 21
OATP2B1 and MRP1 Modulate Statin Toxicity in Cultured Skeletal Myotubes 1 * 1 ATP Level (% Control) 8 6 4 2 ATP Level (% Control) 8 6 4 2 * * * Formazan Formation (% Control) 1 1 Rosuvastatin (mm) 1 * 8 6 4 2 1 1 Rosuvastatin (mm) Formazan Formation (% Control) 1 8 6 4 2 1 1 Atorvastatin (mm) * * 1 1 Atorvastatin (mm) * Caspase 3/7 Activation (% Control) 2 15 1 5 *** *** ** * 1 1 Rosuvastatin (mm) Caspase 3/7 Activation (% Control) Ad-LacZ Ad-MRP1 Ad-OATP2B1 2 15 1 5 ** * ** 1 1 Atorvastatin (mm) Ad-OATP2B1 + Ad-MRP1 Knauer et al., Circ Res 21
Liver - Skeletal Muscle Transporter Axis And Statin Therapeutic Window % Population Reaching Outcome 1 8 6 4 2 LDL-C Hepatic Transporters SLCO1B1 SNP ABCG2 SNP Myopathy Sk. Muscle Transporters SLCO2B1 SNP ABCC1 SNP.1.1 1 1 1 1 Plasma Statin Concentration
Acknowledgments Michael Knauer Henriette Meyer zu Schwabedissen Neha Khandekar Catia Marzolini Guillermo Gervasini Wooin Lee Marianne DeGorter Brad Urquhart Brenda Leake Chris Lemke Richard Kim Ute Schwarz Richard Ho Erin Schuetz John Schuetz
Ethnic Difference in Rosuvastatin Pharmacokinetics
P-glycoprotein (ABCB1) Polymorphisms and Pharmacodynamics SNPs 2677G and 3435C 2677G>T Statin (daily dose in mg) Atorvastatin (1 mg) Atorvastatin (1 mg) Number of Subjects Effect of SNPs on Lipid Response 344 Reduced effect on LDL-C in women 192 Reduced effect on LDL-C Reference Kajinami et al., Am J Cardiol 24 Thompson et al., Pharmacogenomics J 25 2677G>T/A Simvastatin (2 mg) 116 Increased LDL-C response Fiegenbaum et al., CPT 25 4 allele haplotype Fluvastatin (4 mg) 76 Increased LDL-C response Bercovich et al., Atherosclerosis 26 2677G>T/A Pravastatin (4 mg) ~ 7 Reduced effect on LDL-C Mega et al., ATVB 29