Significant Protection against High-Dose Simian Immunodeficiency Virus Challenge Conferred by a New Prime-Boost Vaccine Regimen

JOURNAL OF VIROLOGY, June 2011, p. 5764 5772 Vol. 85, No. 12 0022-538X/11/$12.00 doi:10.1128/jvi.00342-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Significant Protection against High-Dose Simian Immunodeficiency Virus Challenge Conferred by a New Prime-Boost Vaccine Regimen John B. Schell, 1 Nina F. Rose, 1 Kapil Bahl, 1 Kathryn Diller, 1 Linda Buonocore, 1 Meredith Hunter, 2 Preston A. Marx, 2 Ratish Gambhira, 2 Haili Tang, 3 David C. Montefiori, 3 Welkin E. Johnson, 4 and John K. Rose 1 * Yale University School of Medicine, New Haven, Connecticut 1 ; Tulane National Primate Research Center, Covington, Louisiana 2 ; Duke University Medical Center, Durham, North Carolina 3 ; and New England Regional Primate Research Center, Harvard University, Southborough, Massachusetts 4 Received 18 February 2011/Accepted 26 March 2011 We constructed vaccine vectors based on live recombinant vesicular stomatitis virus (VSV) and a Semliki Forest virus (SFV) replicon (SFVG) that propagates through expression of the VSV glycoprotein (G). These vectors expressing simian immunodeficiency virus (SIV) Gag and Env proteins were used to vaccinate rhesus macaques with a new heterologous prime-boost regimen designed to optimize induction of antibody. Six vaccinated animals and six controls were then given a high-dose mucosal challenge with the diverse SIVsmE660 quasispecies. All control animals became infected and had peak viral RNA loads of 10 6 to 10 8 copies/ml. In contrast, four of the vaccinees showed significant (P 0.03) apparent sterilizing immunity and no detectable viral loads. Subsequent CD8 T cell depletion confirmed the absence of SIV infection in these animals. The two other vaccinees had peak viral loads of 7 10 5 and 8 10 3 copies/ml, levels below those of all of the controls, and showed undetectable virus loads by day 42 postchallenge. The vaccine regimen induced high-titer prechallenge serum neutralizing antibodies (nabs) to some cloned SIVsmE660 Env proteins, but antibodies able to neutralize the challenge virus swarm were not detected. The cellular immune responses induced by the vaccine were generally weak and did not correlate with protection. Although the immune correlates of protection are not yet clear, the heterologous VSV/SFVG prime-boost is clearly a potent vaccine regimen for inducing virus nabs and protection against a heterogeneous viral swarm. Development of an effective HIV-1 (human immunodeficiency virus type 1) vaccine is a critical global health priority and has been a major scientific challenge for over 25 years. Initial clinical trials of an HIV-1 Env (envelope) protein vaccine showed no efficacy (10, 38). This failure was likely due to the inability of the vaccine to generate neutralizing antibodies (nabs) to the diverse HIV-1 Env proteins present in the infecting strains and potentially to the high-risk population used in the clinical trial. Studies of nonhuman primates using defective adenovirus type 5 (Ad5) vectors indicated that induction of potent cellular immunity to the simian immunodeficiency virus (SIV) proteins could reduce viral loads following SIV infection and at least slow disease progression (5, 26, 52, 56, 57). Such studies led to clinical trials of Ad5 vectors expressing HIV-1 Gag, Pol, and Nef proteins. Despite the induction of significant cellular immune responses in vaccinees, this vaccine failed to protect against HIV-1 infection or to reduce viral loads following infection (4, 18, 39). In addition, vaccinees with preexisting Ad5- specific nabs exhibited an enhanced rate of HIV-1 acquisition. The latter finding has led to major concerns with the use of * Corresponding author. Mailing address: Department of Pathology, Yale University School of Medicine, 310 Cedar St., New Haven, CT 06510. Phone: (203) 785-6795. Fax: (203) 785-7467. E-mail: john.rose @yale.edu. Supplemental material for this article may be found at http://jvi.asm.org/. Published ahead of print on 13 April 2011. vaccine vectors for which there is significant preexisting immunity in the human population. A more recent clinical trial in a low-risk population in Thailand generated renewed hope for HIV vaccine development because it showed marginally significant protection from infection (41). The vaccine employed a heterologous prime-boost strategy using the canary pox vector ALVAC-HIV, expressing HIV Gag, Pro, and Env, followed by boosting with purified HIV Env protein. The vaccine did not generate consistent cellular or detectable nab responses to HIV-1, and the immune correlates of protection remain unknown. These results suggest that a more potent vaccine regimen will be required to generate an HIV-1 vaccine providing more significant protection. Our own studies have been directed toward development of two virus-derived vaccine vectors for which there is no significant preexisting immunity in the human population. The two vector systems are based on attenuated vesicular stomatitis virus (VSV) (40, 45, 47, 49) and an alphavirus Semliki Forest Virus (SFV) replicon (SFVG) that is packaged by a VSV glycoprotein (G) into infectious vesicles (44, 46). VSV-based HIV vaccine vectors (6) are scheduled for clinical trials beginning in 2011. In previous studies, VSV vectors expressing Env and Gag proteins have provided protection against disease following challenge with an SIV/HIV (SHIV) hybrid virus (45). A heterologous prime-boost regimen employing VSV and modified vaccinia virus Ankara (MVA) vectors was also highly effective against this SHIV challenge (40) and provided protection lasting over 5 years (49). 5764

VOL. 85, 2011 VACCINE PROTECTION FROM SIV CHALLENGE 5765 Vaccine regimens using heterologous viral vectors for priming and boosting are highly effective at focusing the boost response on the vaccine antigens expressed in the vectors (1, 11, 31, 34, 48, 54). In addition, the potency of the vector combinations may derive from the induction of a more diverse set of innate immune responses that act as adjuvants. An extensive comparison of six different vaccine vectors in heterologous prime-boost combinations showed that a VSV vector combined with an alphavirus replicon was the most synergistic combination for induction of antibody to a viral protein (1). In the SIV vaccine study reported here, we have tested VSV and SFVG alphavirus replicon vectors expressing SIV Env and Gag proteins in a heterologous prime-boost regimen. Our goal was to induce optimal nab responses to the SIV challenge virus and determine if the vaccine regimen might be sufficient to provide protection against challenge with a highly pathogenic SIV quasispecies, SIVsmE660. We report that this vaccine regimen provided statistically significant and apparently sterilizing protection from high-dose mucosal challenge. MATERIALS AND METHODS Vaccine vector construction. To construct a DNA vector expressing an SFV RNA replicon with two SFV subgenomic promoters, we started with the pbk- T-SFV plasmid that has a cytomegalovirus (CMV) promoter preceding the SFV replicon sequence (20). The single ApaI site in this vector was eliminated with T4 DNA polymerase. To generate a plasmid designated pbksfvg-gp140, an SpeI- SacI fragment containing the CMV promoter and the beginning of the SFV replicon (6,105 nucleotides) from this plasmid was ligated to a 10,347-nucleotide SpeI-SacI fragment from psfvg-gp140 (46). This vector encodes the SFV replicon, with one subgenomic promoter driving expression of VSV G and a second SFV subgenomic promoter driving expression of HIV gp140. ApaI sites flank the gp140 sequence in this plasmid. The E660 env and gag genes were obtained by PCR of DNA from CEMx174 cells infected with SIVsmE660 and cloned into pbssk. An E660 envg gene was then generated by overlap extension PCR (16). The E660 envg gene encodes an Env protein with its cytoplasmic domain replaced with the VSV G cytoplasmic domain for efficient incorporation into VSV particles. E660 envg was amplified by PCR from the plasmid pbse660envg using the forward primer 5 -GATCG ATCGGGCCCTTAATTAACTCGAGAAGATGGGATGTCTTGGGAATCA GC-3 and the reverse primer 5 -GATCCCCCCCGGGCCCTGCAGGCTAGC TTACTTTCCAAGTCGGTTCATCTC-3. Both primers contained ApaI sites (underlined) and also introduced unique PacI and SbfI sites for use in subsequent directional cloning. The PCR product was digested with ApaI and then cloned into pbksfvg-gp140 following excision of the gp140 insert with ApaI. The plasmid obtained was designated pbksfvg-e660envg. To construct pbksfvg-e660gag, the E660 gag gene was amplified by PCR using the forward primer 5 -GATCGATCGGGCCCTTAATTAAGGATCCAA GATGGGCGCGAGAAACTCCGTC-3, containing an underlined PacI site, and the reverse primer 5 -GATCGATCGGGCCCTGCAGGGATCCCTACTG GTCTTCTCCAAAGAGAG-3, containing an underlined SbfI site. The PCR product was digested with PacI and SbfI and cloned into pbksfvg-e660envg after excising the E660 EnvG with PacI and SbfI. The E660 gag and envg genes were also inserted into the fifth positions of the pvsv-xn2 plasmids expressing either the VSV Indiana (I) or New Jersey (NJ) serotype G proteins (25, 47, 51). VSV recombinants expressing the proteins were then derived by standard procedures (25). Correct protein expression was verified by [ 35 S]methionine labeling and SDS-PAGE of lysates from infected cells and by immunofluorescence microscopy. The vectors are shown in Fig. 1A. Preparation of vaccine stocks. To prepare SFVG replicon particles, BHK-21 cells on 10-cm-diameter dishes (4 10 6 cells/dish) were transfected with 10 g of pbksfvg-e660gag or pbksfvg-e660envg using Lipofectamine (Invitrogen) and Opti-MEM medium, according to the manufacturer s protocol. After 5 h, the transfection medium was removed and replaced with 10 ml Dulbecco modified Eagle medium (DMEM) plus 5% FBS. After 24 h, the cells were sonicated to obtain optimal release of the infectious particles, particles were concentrated, and titers were determined as described previously for cells transfected directly with SFVG replicon RNA (46). Serum-free stocks of VSV vectors FIG. 1. VSV and SFVG vaccine constructs, vaccination schedule, and immune responses to the vectors. (A) Diagram of the VSV and SFVG vector constructs. The VSV gene insertion sites are indicated by the flanking transcription and translation start and stop sequences. Positions of the same gene inserts are shown in the SFVG vector relative to the two subgenomic mrna promoters. (B) Schedule for vaccination and SIVsmE660 challenge. Days are given as days postprime. IR, intrarectal. (C) Postprime neutralizing antibody titers to the two VSV G proteins present in the vectors. Titers represent the reciprocal of the serum dilution that completely neutralized 100 PFU of the indicated VSV Indiana or New Jersey serotype viruses. were grown on BHK-21 cells, and titers were determined as described previously (47). Vaccinations. Indian rhesus macaques were housed and cared for at the Tulane National Primate Research Center (TNPRC). Vaccinations followed the schedule shown in Fig. 1B. For the VSV prime and second boost, a total of 1 10 8 PFU of both the VSV-E660Gag and VSV-E660EnvG viruses were delivered intramuscularly (i.m.; 6 10 7 PFU) and intranasally (i.n.; 4 10 7 PFU) to each monkey. The SFVG replicon particle boost was delivered by intramuscular injection only. Each animal received 1 10 6 infectious units (i.u.) of both SFVG-Gag and SFVG-EnvG. Animals in the control group were primed and boosted with VSV vectors expressing an influenza hemagglutinin protein. Samples and viral load assays. All tissue and serum samples were shipped cryogenically frozen to Yale University and were stored in liquid nitrogen upon arrival. Branched DNA (bdna) analysis on serum samples was done by Siemens Diagnostics Clinical Laboratory (Berkeley, CA). Neutralization assays. Neutralization was measured as a function of reductions in luciferase reporter gene expression after either a single round of infection in TZM-bl cells (27) or multiple rounds of replication in 5.25.EGFP.Luc.M7 (M7-Luc) cells (33). Neutralization titers in both assays are the dilutions at which relative luminescence units (RLUs) were reduced by 50% compared to those in virus control wells after subtraction of background RLUs. Assay stocks of molecularly cloned Env-pseudotyped virus E660/CR54-PK-2A5 and SIVsmE660.11 were prepared by transfection in 293T cells and were titrated in TZM-bl cells as described previously (27). E660/CR54-PK-2A5 and BR-CG7V.IR are single-

5766 SCHELL ET AL. J. VIROL. genome amplification (SGA)-derived plasma clones obtained at peak viremia during primary infection after intrarectal challenge (22) and exhibit a resistant tier 2 neutralization phenotype (D. C. Montefiori, unpublished data). E660.11 is a functional rev-env cassette cloned from DNA of peripheral blood mononuclear cells (PBMCs) infected in vitro and exhibits a highly sensitive tier 1A neutralization phenotype. An uncloned stock of SIVsmE660 was prepared in CEMx174 cells and titrated in M7-Luc cells (33) for use in neutralization assays. The VSV G-E660EnvG-GFP and VSV G neutralization assays were described previously (3, 45). The VSV GE660EnvG-GFP neutralization assay used HOS-CD4-CCR5 cells obtained from the NIH AIDS Research and Reference Reagent Program and were described previously (9). An endpoint of 90 percent neutralization of infection was scored by counting infected (green fluorescent protein-positive [GFP ]) cells by fluorescence microscopy. VSV vector neutralization assays were described previously (47). ELISA for serum antibody to oligomeric SIV Env. Enzyme-linked immunosorbent assays (ELISAs) were performed essentially as described previously for HIV Env (43), with modifications published previously (45). SIV gp140 was obtained from the medium of 293 cells infected with a vaccinia virus recombinant (vpaul) encoding the secreted SIVmac239 gp140 (a gift from R. Doms, University of Pennsylvania). Optical densities were determined at a wavelength of 415 nm in a Bio-Rad ELISA plate reader. Titers were determined from graphs of the data and are given as the reciprocal of the serum dilution that gave an absorbance of 0.2 after subtraction of background values obtained from an identical dilution series with preimmune sera. Flow cytometry. For cell surface marker and tetramer analyses, cryopreserved cells were washed in staining buffer (phosphate-buffered saline [PBS] containing 2% fetal calf serum) and stained for surface marker expression. Directly conjugated monoclonal antibodies (BD, San Jose, CA) CD3-V450 (SP34-2), CD4- PerCP (L200), and CD8-Alexa Fluor 700 (RPA-T8) were used to discern T cell subsets. Cells were costained with both Mamu-A*01-specific allophycocyanin (APC)- and phycoerythrin (PE)-conjugated tetramers containing the SIV Gag peptide p11c (Beckman Coulter, Fullerton, CA). Cell viability was assessed with the LIVE/DEAD fixable aqua dead cell stain kit (Molecular Probes, Eugene, OR). Following surface staining, cells were washed in staining buffer and fixed using Cytofix fixation buffer (BD). Cells were then resuspended in staining buffer prior to data acquisition using a multicolor LSR II flow cytometer (BD). Collected data were analyzed using FlowJo software, version 8.8.6 (Tree Star, Ashland, OR). ELISPOT assays. The enzyme-linked immunospot (ELISPOT) assay protocol has been described previously in greater detail (40). Cryopreserved PBMCs were thawed and pelleted by centrifugation. Cells were infected with recombinant vaccinia virus (rvv) expressing SIV Gag, Env, or bacteriophage T7 RNA polymerase (negative control) at a multiplicity of infection (MOI) of 2. In parallel, cells were either treated with phorbol myristate acetate (PMA; 50 ng/ml) and ionomycin (250 ng/ml) or mock infected and served as positive and negative controls, respectively. Cultures were stimulated for 16 h in a humidified incubator before being used in the ELISPOT assay. MultiScreen HTS 96-well plates (Millipore, Bedford, MA) were coated with mouse anti-human gamma interferon (IFN- ) antibody at a final concentration of 1 g/well (BD). After overnight infection or stimulation described above, 2 10 5 PBMCs were transferred to the antibody-coated plates. After a 5-h incubation at 37 C, the cells were washed off the plates using PBS-Tween (0.05%) and then treated with an antimouse IgG biotinylated antibody (Invitrogen, Camarillo, CA) for 1 h. Upon being washed, plates were then treated with streptavidin-horseradish peroxidase (HRP) (Southern Biotech, Birmingham, AL) and then exposed to one-step chromogenic substrate (Thermo Scientific, Rockford, IL). Plates were washed and allowed to air dry, and spot-forming cells (SFC) were finally counted. Data were analyzed and plotted using InStat software, version 3.0b (GraphPad Software, San Diego, CA). CD8 T cell depletion. For CD8 T cell depletion experiments, animals were injected 291 days postchallenge with a rhesus recombinant anti-cd8 antibody from the NIH Nonhuman Primate Reagent Resource (M-T807). The initial dose of antibody (10 mg/kg body weight) was delivered subcutaneously, whereas the three subsequent doses (5 mg/kg) were delivered intravenously. RESULTS Study design and antibody responses to vectors. In this study, two groups of rhesus macaques were vaccinated, boosted, and challenged according to the schedule shown in Fig. 1B. In each group, we included three animals carrying the Mamu-A*01 major histocompatibility complex class I (MHC-I) allele to allow enumeration of SIV Gag-specific CD8 T cells using MHC-I tetramers. Animals with other MHC-I alleles that have been associated with better control of SIV replication (B08 and B17) were excluded from the vaccine group. The six vaccine group animals were primed with VSV-based vectors expressing EnvG and Gag proteins derived from SIVsmE660 quasispecies (Fig. 1A). The EnvG protein is an E660 Env protein with its cytoplasmic tail replaced by the VSV G cytoplasmic tail. This modification enhances EnvG protein incorporation into VSV particles (15). The six control group animals received VSV vectors expressing an unrelated influenza antigen. The priming vector expressed the VSV New Jersey (NJ) serotype glycoprotein, and nabs to VSV NJ were detected in all animals by day 49 (Fig. 1C). The vaccine group animals were then boosted at day 49 with SFVG-propagating replicons expressing the same EnvG and Gag proteins (Fig. 1A) but expressing the Indiana (I) serotype glycoprotein to avoid nabs generated to the priming vector. At day 112, the animals had all developed nabs to VSV(I), but these were between 5- and 10-fold lower than those we had previously seen in macaques vaccinated with VSV(I) vectors (Fig. 1C) (40). We then boosted all vaccine group animals at day 112 with a VSV(I) vector expressing the E660 EnvG and Gag proteins. Following the boost, the nab responses to VSV(I) increased by more than 10-fold by day 147. This result suggested that the boost was effective despite the exposure to the VSV G(I) protein encoded by the SFVG boosting vector. Control and vaccine group animals were all given a high-dose intrarectal challenge (4,000 50% tissue culture infective dose [TCID 50 ]) of a SIVsmE660 stock at day 147 (Fig. 1B). Viral loads following SIVsmE660 challenge. For the initial evaluation of the vaccine effectiveness, we measured viral loads in the vaccine and control groups (Fig. 2A and B). After challenge, all control animals became infected and had peak viral loads between 1 10 6 and 2 10 8 copies/ml of plasma (Fig. 2A). The three control animals with the highest loads all progressed to AIDS within 3 to 8 months following the challenge. Interestingly, two of these animals, EN82 and N288, carried the Mamu-A*01 MHC allele that is associated with better control of SIVmac239/251 challenge (2, 23, 35), but it was not sufficient to provide control of SIVsmE660 loads. The three other control animals were able to reduce their viral loads to below detection within 8 months. The viral load results for the vaccine group were significantly different. No viral loads were detected at any time in four out of six vaccine group animals (Fig. 2B). The two vaccinees that became infected had lower peak viral loads than those of any of the control animals. Animal DG21 had a peak viral load of 8 10 3 copies/ml of plasma and had an undetectable load by 21 days following the challenge. Animal DF38 had a peak viral load of 6.8 10 5 copies/ml of plasma and controlled the infection to below the limit of detection by 42 days after the challenge. The control and vaccinee peak viral loads (geometric means) at 14 days postinfection were 1 10 7 and 8 10 2 copies/ml, respectively, and the difference is significant (P 0.001; two-tailed Mann-Whitney test). Effects of SIV challenge on CD4 T cells in the gut and peripheral blood. Pathogenic infection with SIV causes rapid

VOL. 85, 2011 VACCINE PROTECTION FROM SIV CHALLENGE 5767 FIG. 2. Vaccine group animals appear to be uninfected or have low viral loads compared to those of control animals. The graphs show the number of plasma viral RNA copies per ml of sera in control group animals (A) and vaccine group animals (B) on the indicated days following high-dose mucosal (rectal) challenge with the SIVsmE660 swarm. Control animals marked with an asterisk were euthanized when they developed AIDS. The plus symbols indicate the three animals in each group that carried the Mamu-A*01 allele. No viral loads were detectable in 4 of the 6 vaccine group animals at any time following challenge. The difference in peak viral loads between the two groups was significant (P 0.001; two-tailed Mann-Whitney test). depletion of the CCR5 memory CD4 T cells residing in the gut lamina propria without causing substantial depletion of the CD4 peripheral blood T cells that are largely naïve (28, 55). To examine the effects of the SIV challenge on these cells in the vaccine and control groups, we analyzed the percentages of total T cells in the gut that were CD4 on the day of challenge (day 0) and 25 and 60 days following challenge (Fig. 3A and B). CD4 T cell counts were also measured in the peripheral blood (expressed as percent prechallenge CD4 cell counts) at these same time points and at later times throughout the study (Fig. 3C and D). Five of the six control animals showed major depletion of the gut CD4 T cells by day 25 following challenge, while the CD4 T cell counts in the blood showed at most a 50% decrease. The animals showing the highest peak loads (Fig. 3, asterisks) also showed the largest decreases in gut CD4 T cells. Large decreases in the blood CD4 T cell counts were seen in three control animals at later times as they developed AIDS. In contrast, the vaccine group showed good preservation of the gut CD4 T cell population, as would be expected from the apparent lack of infection in four animals and the greatly reduced loads in the two animals that became infected. DF38, the animal with the highest peak viral load, did show an early decrease in gut CD4 T cells, followed by a recovery. Peripheral blood CD4 T cell counts in the vaccine group animals showed no significant decrease over time. Antibodies to SIV Envs. The SIVsmE660 quasispecies is relatively resistant to nabs, although antibodies capable of neutralizing it do develop following infection of macaques. These antibodies are, however, insufficient to control the virus (7, 36). To elucidate the immune correlates of protection in the vaccine group animals, we first tested for the presence of nabs to the SIVsmE660 quasispecies following priming, boosting, the day of challenge, and up to 100 days postchallenge. No nab to the quasispecies was detectable, even at serum dilutions of 1:20 in CEMx174 cells. Because the results of a nab assay using a complex quasispecies are difficult to interpret, we next measured nabs using two different Env pseudotypes derived from cloned Env sequences of SIVsmE660. No nabs to tier 2 Envs (CR54-PK-2A5 and BR-CG7V.IR) were detected, even at serum dilutions of 1:20. However, we did detect very high levels of nabs to the tier 1A E660.11 envelope (Fig. 4A). All vaccine group animals showed nabs to E660.11 after the prime, and a dramatic increase in neutralizing antibody (nab) titers (approximately 100-fold) was seen after the SFVG replicon boost. The second VSV boost was less effective but did increase waning Ab titers by an average of about 10-fold. At the time of challenge, all animals had antibodies capable of neutralizing the E660.11 envelope. We did not detect a correlation between the magnitude of the nab titers to the E660.11 Env and protection. The two animals that became infected (DF38 and DG21) had higher prechallenge nab titers than two of the protected animals (CM17 and FP72). Following challenge, nab titers continued to increase in DF38 and DG21, consistent with an anamnestic immune response following infection. In the four protected animals, nab titers decreased or stayed the same, consistent with these animals being protected from SIV infection. We also measured nabs to a VSV recombinant (VSV G- EGFP) expressing the E660-EnvG protein used in the vaccine. These surrogate viruses lack the VSV G protein but have the EnvG protein incorporated into the VSV envelope and infect cells via CD4 and CCR5 (3). In this assay, the nab titers were lower than, but largely paralleled, those seen in the E660.11 pseudotype assay. Total serum antibody to oligomeric SIV Env gp140 was also measured by ELISA at the time of challenge and postchallenge (see Fig. S1 in the supplemental material). The titers decreased following challenge in the four uninfected vaccinees, consistent with lack of infection, while anamnestic increases occurred in the two vaccinees that became infected. However, the prechallenge titers did not correlate with protection, since the animal with the highest prechallenge titer (DF38) was one of the two vaccinees that became infected. CD8 T cell responses did not correlate with protection. MHC class I tetramers were used to quantify the percentage of CD3 CD8 T cells capable of recognizing the immunodominant Gag epitope p11c from the three Mamu-A*01 animals in the vaccine group. Figure 5A shows the results of tetramer

5768 SCHELL ET AL. J. VIROL. FIG. 3. Gut and peripheral blood CD4 T cell levels in control and vaccine group animals. Bar graphs for the control group (A) and vaccine group (B) show the percentages of CD3 gut lymphocytes that are CD4 at the day of challenge and at 25 and 60 days postchallenge. Line graphs for the control group (C) and vaccine group (D) show the CD4 T cell counts in the blood, expressed as percentages of the average prechallenge CD4 T cell counts. Asterisks indicate the control animals with the highest virus loads and the two vaccine group animals that were initially infected but controlled their virus loads. analysis in these animals at 1 week after priming (day 7), 1 week after the second boost (day 119), and also at 25 days postchallenge (day 172 postprime). Two of the animals (DG21 and DT03) showed approximately 0.4% p11c cells after the second boost, while the third animal, CJ98, had a tetramer response that was less than 0.1%. Following challenge, the one Mamu-A*01 vaccine animal that was infected (DG21) showed a 6-fold increase in p11c CD8 cells consistent with an anamnestic response to infection. By day 263 postchallenge, p11c CD8 cells were low to undetectable in the uninfected animals and had decreased by 6-fold in DG21, consistent with effective control of the infection (data not shown). Therefore, p11c tetramer positivity was not predictive of protection, since an animal with the lowest response (CJ98) was protected from infection while DG21, an animal with a much greater response, was infected. We next measured functional responses of the T cells isolated from these animals to Gag by using an gamma interferon (IFN- ) ELISPOT assay (Fig. 5B). Gag-specific responses were minimal in all animals but were generally consistent with the tetramer results. While an anamnestic response in DG21 was apparent postchallenge, none of the animals made significant pre- or postchallenge responses to SIV Env in ELISPOT assays (data not shown). T cell responses in the non-mamu-a*01 animals were also analyzed using Gag and Env ELISPOT assays. The responses to Gag and Env were at the background level in these animals and also did not correlate with protection from infection (data not shown). CD8 depletion in the vaccine group animals confirms apparent sterilizing immunity. The lack of detectable viral loads and absence of anamnestic antibody and T cell responses in the four protected animals in the vaccine group was consistent with complete protection but did not rule out a very low level of infection. To determine if the four protected animals in the vaccine group had a low-level infection that was being controlled by CD8 T cells, we depleted this population in all six vaccine group animals by four subcutaneous injections of rhesus anti-cd8 Ab given at 3-day intervals. Depletion was started 291 days after the SIV challenge. By 3 days following the first subcutaneous injection, all animals showed complete depletion of CD8 T cells in the peripheral blood (Fig. 6A). The two animals that were definitely infected initially, DF38 and DG21, showed a rapid reappearance of viral RNA in the blood by 3 and 7 days postdepletion. In contrast, there was no detectable viral RNA in the four protected animals, consistent with lack of any initial infection. The rate of reappearance of viral RNA in DF38 and DG21 correlated with their initial peak viral loads. Interestingly, while DF38 was able to control its viral load within a month following the last injection, DG21 was not. The control by DF38 corresponded to a rapid reappearance of CD8 T cells

VOL. 85, 2011 VACCINE PROTECTION FROM SIV CHALLENGE 5769 FIG. 4. Pre- and postchallenge serum nab responses from the vaccine group animals. (A) Serum nab to a pseudovirus expressing the E660.11 envelope, measured by the TZM-bl assay. (B) nab responses to the EnvG protein present in the vaccine using a VSV G surrogate virus. The initial VSV vector prime was on day 0. The black arrows indicate the days of the SFVG and VSV vector boosts. The days of SIVsmE660 challenge are indicated by the red arrows. Note that the two infected animals in the vaccine group (indicated by asterisks) showed a strong anamnestic response in antibody production following challenge in both assays. FIG. 5. Tetramer and ELISPOT assays of vaccine group Mamu- A*01 PBMCs. (A) Results from tetramer staining analysis of CD8 T cells recognizing the immunodominant Gag p11c epitope. Data are presented as the percentages of CD3 CD8 cells that are also p11c tetramer positive. (B) Levels of IFN- secreting specific for SIV Gag, as detected by ELISPOT assay. Data are presented as the number of spot-forming cells (SFC) per 1 10 6 cells. in this animal. CD8 T cells in DG21 did not return to normal levels, and this animal maintained high levels of viremia. DISCUSSION Virus-based vaccine vectors are often strong inducers of immune responses and can be particularly potent when used in a heterologous prime-boost regimen. The goal of our current study was to test a new vaccine vector prime-boost combination for its ability to induce immune responses and protect macaques against a single, high-dose mucosal challenge with a highly pathogenic SIV quasispecies, SIVsmE660 (14). We chose to challenge them with SIVsmE660 because this virus swarm shows a moderate degree of resistance to nab; however, some nabs to the swarm typically develop in infected animals within 2 to 3 months postinfection, much like in HIV-1 infection (7). In contrast, the more commonly used SIVmac251 quasispecies is extremely resistant to nab (58). Therefore, E660 might be a more relevant model for obtaining sterilizing immunity based on induction of nab. As with other pathogenic SIV challenges, high-dose SIVsmE660 challenge has proven difficult to protect against. Several vaccine studies have employed intravenous challenges with SIVsmE660, with only partial success at obtaining control of virus replication (8, 17, 19, 36, 37). A vaccine study employing a high-dose rectal challenge with SIVsmE660 was reported by Johnston et al. (19). In that study, they observed better control of peak virus load in vaccinees than in controls, and one out of six vaccinees appeared not to be infected after challenge (19). A more recent vaccine study employed multiple low-dose rectal challenges with the E660 virus swarm (42). A significant reduction in the rate of acquisition of E660 infection was seen in animals vaccinated with the heterologous live-attenuated SIVmac239 nef. In addition, reductions in viral loads were seen in animals that became infected. However, much like the study presented here, the immune correlates of protection were not clear. In the present study, we used a mucosal challenge because this mode of transmission accounts for the majority of human HIV infections. Although a multiple low-dose challenge might better mimic typical human HIV transmission, we used a highdose challenge to ensure infection of all control animals after a single challenge. Protection from high-dose challenge could also provide stronger evidence of vaccine effectiveness because multiple distinct viral genotypes should be transmitted simultaneously (53). The level of protection we observed was strik-

5770 SCHELL ET AL. J. VIROL. FIG. 6. CD8 T cell depletion in vaccinees shows virus rebound in only the 2/6 animals that showed initial viral loads. All vaccine group animals were depleted for CD8 T cells by treatment with rhesus anti-cd8 monoclonal antibody administered on the days indicated by the red arrows. (A) Rapid and sustained CD8 T cell depletion in all animals after the antibody treatment. Values are represented as the total CD8 cells counts per l of blood. (B) Postdepletion analysis of plasma viral RNA levels. ing, with all six controls infected and only two of six vaccinees infected. The protection from infection was statistically significant (P 0.03; Fisher s exact test) and was verified by CD8 cell depletion, which showed no virus rebound in the four completely protected animals. Virus rebound in the two initially infected animals indicated an important role for CD8 cells in control of replication. The ability of CD8 T cells to control SIV infection is well established (30, 32, 50). The results also show that any antibodies that may have been present at the time of depletion were insufficient to prevent a rapid rebound of virus replication. The immune correlates of apparently sterilizing protection in our study are not yet clear. Cellular immune responses to both Gag and Env antigens in the vaccine were modest prior to challenge and their magnitudes did not correlate with protection. It is, of course, possible that cellular immune responses at the site of infection were generated and were sufficient to clear brief transient infection that went undetected (29). Such a mechanism has been reported for a rhesus cytomegalovirusvectored SIV vaccine inducing strong effector-memory T cells (12). There was clear evidence of anamnestic antibody and cellular immune responses in the vaccinees that became infected in that study. However, the lack of any anamnestic T cell or antibody responses in our protected animals argues against infection in these animals. Determining the possible contribution of virus-neutralizing antibody to protection is especially complicated when multiple genotypes are present in the quasispecies challenge. After the priming vaccination, all vaccinees made detectable serum nabs to a specific Env clone (E660.11) derived from the quasispecies and to the cloned E660 EnvG envelope used in the vaccine. There was a striking increase in these nab titers (100-fold) after the SFVG vector boost, with titers exceeding 10 6 in one animal. However, we did not detect nabs to the E660 quasispecies itself or to other E660 Env clones (CR54-PK-2A5 and BR-CG7V.IR). Despite the absence of nab to the quasispecies in the in vitro assay, it is still possible that the majority of the viruses infecting in vivo are nab sensitive and that mucosal nab responses could explain the protection. Recent studies indicate that even relatively low levels of mucosal nabs can protect against mucosal SHIV challenge (13). Detection of nabs in fecal samples or rectal washes is difficult and has not yet given us consistent results, even in SIVsmE660-infected animals with high serum nab titers. It is also possible that nonneutralizing mucosal antibodies played a role in protection through clearance of immune complexes or antibody-dependent cell-mediated cytotoxicity. We analyzed the E660 challenge stock by single-genome amplification (SGA) and sequencing of 60 env genes (21, 22). The results showed a mixture of sequences (see Fig. S2A and B in the supplemental material). The complexity was high, with a maximum difference of 1.4% between individual sequences, similar to the result of 1.8% obtained by Keele et al. in 2009 using a related SIVsmE660 stock (22). The portion of the env gene used in the vaccine (lacking the Env cytoplasmic tail coding sequence) was an outlier sequence (see Fig. S2C in the supplemental material) and differed from the consensus sequence of the quasispecies at 15 out of 725 amino acid positions (2%). In the future, it should be possible using SGA to determine the sequences of the founder virus env genes from the control and vaccinated animals. Analysis of the nab sensitivities of these viruses could provide support for a role of nab in protection if the majority of control animals were infected with founder viruses sensitive to nab induced in the protected vaccinees. A recent study assessed the effect of TRIM5 on viral load in rhesus macaques infected with SIVsmE543-3 (24), a clone of a virus related to the SIVsmE660 quasispecies. That study showed a trend toward better control of SIVsmE543-3 replication in animals homozygous for the TRIM5 TFP/TFP allele than in animals heterozygous for the TRIM5 TFP/Q allele. Although it is not known if the SIVsmE660 quasispecies are subject to TRIM5 restriction, we retrospectively determined the TRIM5 status of the animals in this study. The results are shown in Table S1 in the supplemental material. All animals were either heterozygous TFP/Q or homozygous TFP/TFP at the TRIM5 locus. The only TRIM5 TFP/TFP animal in the control group (FT80) had a low viral set point at day 164, but this set point was no lower than those of other control animals that were

VOL. 85, 2011 VACCINE PROTECTION FROM SIV CHALLENGE 5771 TRIM5 TFP/Q (DD04 and EP84). Three control animals developed high viral loads by day 164 and were also predicted to be moderate controllers (TFP/Q). Therefore, it is not clear from our limited data if SIVsmE660 replication is affected by TRIM5. A larger study of more than 100 control animals (including the animals from this study) infected with SIVsmE660 has not revealed statistically significant effects of TRIM5 alleles on SIVsmE660 replication (W. E. Johnson, unpublished results). In the vaccine group, there were three TFP/TFP animals, and all of these as well as one TFP/Q animal were protected from infection. The two vaccine group animals that became infected were TFP/Q and exhibited rapid control of viral loads. Although vaccinated animals were protected from infection independently of their TRIM5 allele status, it remains possible that the TRIM5 status could limit initial virus replication and thereby enhance vaccine efficacy. This issue can be avoided in future studies by eliminating potentially protective TRIM5 alleles from control and vaccine groups. Recent results from the Thai vaccine trial suggest that a modest level of protection from HIV infection is possible (41). The consistent immune response seen in vaccinees was induction of anti-hiv Env antibody, suggesting that antibody may have played a role in protection. Given the marginal effects of that vaccine, it would be useful to have an animal model in which consistent protection from SIV infection can be achieved. The experimental vaccine that we describe here combining VSV and SFVG replicon particles generates robust nab responses and provides a high level of protection. It could prove useful for understanding mechanisms of sterilizing protection from immunodeficiency virus challenge as well as control of virus replication following infection. This vector system should also be considered a strong candidate for future SIV and HIV vaccine studies attempting to elicit broadly neutralizing antibodies with novel antigens. ACKNOWLEDGMENTS We thank Philip Johnson for a generous supply of the SIVsmE660 challenge stock and for helpful suggestions. We thank Gunilla Karlsson and Peter Lilejstrom for providing the pbk-t-sfv vector and Robert Doms for providing vaccinia virus recombinants expressing SIV Env proteins. This work was supported by NIH grants AI45510 and AI-40357, Tulane National Primate Research Center base grant RR000164, and NIAID contract AI8534. REFERENCES 1. Barefoot, B., et al. 2008. Comparison of multiple vaccine vectors in a single heterologous prime-boost trial. Vaccine 26:6108 6118. 2. Barouch, D. H., et al. 2002. Eventual AIDS vaccine failure in a rhesus monkey by viral escape from cytotoxic T lymphocytes. Nature 415:335 339. 3. Boritz, E., J. Gerlach, J. E. Johnson, and J. K. Rose. 1999. Replicationcompetent rhabdoviruses with human immunodeficiency virus type 1 coats and green fluorescent protein: entry by a ph-independent pathway. J. Virol. 73:6937 6945. 4. Buchbinder, S. P., et al. 2008. Efficacy assessment of a cell-mediated immunity HIV-1 vaccine (the Step study): a double-blind, randomised, placebocontrolled, test-of-concept trial. Lancet 372:1881 1893. 5. Casimiro, D. R., et al. 2005. Attenuation of simian immunodeficiency virus SIVmac239 infection by prophylactic immunization with DNA and recombinant adenoviral vaccine vectors expressing Gag. J. Virol. 79:15547 15555. 6. Cooper, D., et al. 2008. Attenuation of recombinant vesicular stomatitis virus-human immunodeficiency virus type 1 vaccine vectors by gene translocations and g gene truncation reduces neurovirulence and enhances immunogenicity in mice. J. Virol. 82:207 219. 7. Davis, N. L., et al. 2000. Vaccination of macaques against pathogenic simian immunodeficiency virus with Venezuelan equine encephalitis virus replicon particles. J. Virol. 74:371 378. 8. Davis, N. L., et al. 2002. Alphavirus replicon particles as candidate HIV vaccines. IUBMB Life 53:209 211. 9. Deng, H., et al. 1996. Identification of a major co-receptor for primary isolates of HIV-1. Nature 381:661 666. 10. Flynn, N. M., et al. 2005. Placebo-controlled phase 3 trial of a recombinant glycoprotein 120 vaccine to prevent HIV-1 infection. J. Infect. Dis. 191:654 665. 11. Haglund, K., et al. 2002. Robust recall and long-term memory T-cell responses induced by prime-boost regimens with heterologous live viral vectors expressing human immunodeficiency virus type 1 Gag and Env proteins. J. Virol. 76:7506 7517. 12. Hansen, S. G., et al. 2009. Effector memory T cell responses are associated with protection of rhesus monkeys from mucosal simian immunodeficiency virus challenge. Nat. Med. 15:293 299. 13. Hessell, A. J., et al. 2009. Effective, low-titer antibody protection against low-dose repeated mucosal SHIV challenge in macaques. Nat. Med. 15:951 954. 14. Hirsch, V. M., R. A. Olmsted, M. Murphey-Corb, R. H. Purcell, and P. R. Johnson. 1989. An African primate lentivirus (SIVsm) closely related to HIV-2. Nature 339:389 392. 15. Johnson, J. E., W. Rodgers, and J. K. Rose. 1998. A plasma membrane localization signal in the HIV-1 envelope cytoplasmic domain prevents localization at sites of vesicular stomatitis virus budding and incorporation into VSV virions. Virology 251:244 252. 16. Johnson, J. E., M. J. Schnell, L. Buonocore, and J. K. Rose. 1997. Specific targeting to CD4 cells of recombinant vesicular stomatitis viruses encoding human immunodeficiency virus envelope proteins. J. Virol. 71:5060 5068. 17. Johnson, P. R., et al. 2005. Novel adeno-associated virus vector vaccine restricts replication of simian immunodeficiency virus in macaques. J. Virol. 79:955 965. 18. Johnston, M. I., and A. S. Fauci. 2008. An HIV vaccine challenges and prospects. N. Engl. J. Med. 359:888 890. 19. Johnston, R. E., et al. 2005. Vaccination of macaques with SIV immunogens delivered by Venezuelan equine encephalitis virus replicon particle vectors followed by a mucosal challenge with SIVsmE660. Vaccine 23:4969 4979. 20. Karlsson, G. B., and P. Liljestrom. 2004. Delivery and expression of heterologous genes in mammalian cells using self-replicating alphavirus vectors. Methods Mol. Biol. 246:543 557. 21. Keele, B. F., et al. 2008. Identification and characterization of transmitted and early founder virus envelopes in primary HIV-1 infection. Proc. Natl. Acad. Sci. U. S. A. 105:7552 7557. 22. Keele, B. F., et al. 2009. Low-dose rectal inoculation of rhesus macaques by SIVsmE660 or SIVmac251 recapitulates human mucosal infection by HIV-1. J. Exp. Med. 206:1117 1134. 23. Kim, E. Y., et al. 2008. Contribution of CD8 T cells to containment of viral replication and emergence of mutations in Mamu-A*01-restricted epitopes in simian immunodeficiency virus-infected rhesus monkeys. J. Virol. 82: 5631 5635. 24. Kirmaier, A., et al. 2010. TRIM5 suppresses cross-species transmission of a primate immunodeficiency virus and selects for emergence of resistant variants in the new species. PLoS Biol. 8:e1000462. 25. Lawson, N. D., E. A. Stillman, M. A. Whitt, and J. K. Rose. 1995. Recombinant vesicular stomatitis viruses from DNA. Proc. Natl. Acad. Sci. U. S. A. 92:4477 4481. 26. Letvin, N. L., et al. 2006. Preserved CD4 central memory T cells and survival in vaccinated SIV-challenged monkeys. Science 312:1530 1533. 27. Li, M., et al. 2005. Human immunodeficiency virus type 1 env clones from acute and early subtype B infections for standardized assessments of vaccineelicited neutralizing antibodies. J. Virol. 79:10108 10125. 28. Li, Q., et al. 2005. Peak SIV replication in resting memory CD4 T cells depletes gut lamina propria CD4 T cells. Nature 434:1148 1152. 29. Li, Q., et al. 2009. Visualizing antigen-specific and infected cells in situ predicts outcomes in early viral infection. Science 323:1726 1729. 30. Lifson, J. D., et al. 2001. Role of CD8( ) lymphocytes in control of simian immunodeficiency virus infection and resistance to rechallenge after transient early antiretroviral treatment. J. Virol. 75:10187 10199. 31. Liu, J., et al. 2009. Immune control of an SIV challenge by a T-cell-based vaccine in rhesus monkeys. Nature 457:87 91. 32. Metzner, K. J., et al. 2000. Effects of in vivo CD8( ) T cell depletion on virus replication in rhesus macaques immunized with a live, attenuated simian immunodeficiency virus vaccine. J. Exp. Med. 191:1921 1931. 33. Montefiori, D. C. 2005. Evaluating neutralizing antibodies against HIV, SIV, and SHIV in luciferase reporter gene assays. Curr. Protoc. Immunol. Chapter 12:Unit 12.11. 34. Nilsson, C., et al. 2001. Enhanced simian immunodeficiency virus-specific immune responses in macaques induced by priming with recombinant Semliki Forest virus and boosting with modified vaccinia virus Ankara. Vaccine 19:3526 3536. 35. O Connor, D. H., et al. 2003. Major histocompatibility complex class I alleles associated with slow simian immunodeficiency virus disease progression bind epitopes recognized by dominant acute-phase cytotoxic-t-lymphocyte responses. J. Virol. 77:9029 9040.

5772 SCHELL ET AL. J. VIROL. 36. Ourmanov, I., M. Bilska, V. M. Hirsch, and D. C. Montefiori. 2000. Recombinant modified vaccinia virus Ankara expressing the surface gp120 of simian immunodeficiency virus (SIV) primes for a rapid neutralizing antibody response to SIV infection in macaques. J. Virol. 74:2960 2965. 37. Ourmanov, I., et al. 2009. Improved survival in rhesus macaques immunized with modified vaccinia virus Ankara recombinants expressing simian immunodeficiency virus envelope correlates with reduction in memory CD4 T-cell loss and higher titers of neutralizing antibody. J. Virol. 83:5388 5400. 38. Pitisuttithum, P., et al. 2006. Randomized, double-blind, placebo-controlled efficacy trial of a bivalent recombinant glycoprotein 120 HIV-1 vaccine among injection drug users in Bangkok, Thailand. J. Infect. Dis. 194:1661 1671. 39. Priddy, F. H., et al. 2008. Safety and immunogenicity of a replicationincompetent adenovirus type 5 HIV-1 clade B gag/pol/nef vaccine in healthy adults. Clin. Infect. Dis. 46:1769 1781. 40. Ramsburg, E., et al. 2004. Highly effective control of an AIDS virus challenge in macaques by using vesicular stomatitis virus and modified vaccinia virus Ankara vaccine vectors in a single-boost protocol. J. Virol. 78:3930 3940. 41. Rerks-Ngarm, S., et al. 2009. Vaccination with ALVAC and AIDSVAX to prevent HIV-1 infection in Thailand. N. Engl. J. Med. 361:2209 2220. 42. Reynolds, M. R., et al. 2010. Macaques vaccinated with simian immunodeficiency virus SIVmac239Delta nef delay acquisition and control replication after repeated low-dose heterologous SIV challenge. J. Virol. 84:9190 9199. 43. Richardson, T. M., Jr., et al. 1996. Humoral response to oligomeric human immunodeficiency virus type 1 envelope protein. J. Virol. 70:753 762. 44. Rolls, M. M., P. Webster, N. H. Balba, and J. K. Rose. 1994. Novel infectious particles generated by expression of the vesicular stomatitis virus glycoprotein from a self-replicating RNA. Cell 79:497 506. 45. Rose, N. F., et al. 2001. An effective AIDS vaccine based on live attenuated vesicular stomatitis virus recombinants. Cell 106:539 549. 46. Rose, N. F., J. Publicover, A. Chattopadhyay, and J. K. Rose. 2008. Hybrid alphavirus-rhabdovirus propagating replicon particles are versatile and potent vaccine vectors. Proc. Natl. Acad. Sci. U. S. A. 105:5839 5843. 47. Rose, N. F., A. Roberts, L. Buonocore, and J. K. Rose. 2000. Glycoprotein exchange vectors based on vesicular stomatitis virus allow effective boosting and generation of neutralizing antibodies to a primary isolate of human immunodeficiency virus type 1. J. Virol. 74:10903 10910. 48. Santra, S., et al. 2009. Heterologous prime/boost immunizations of rhesus monkeys using chimpanzee adenovirus vectors. Vaccine 27:5837 5845. 49. Schell, J., et al. 2009. Long-term vaccine protection from AIDS and clearance of viral DNA following SHIV89.6P challenge. Vaccine 27:979 986. 50. Schmitz, J. E., et al. 2005. Effect of CD8 lymphocyte depletion on virus containment after simian immunodeficiency virus SIVmac251 challenge of live attenuated SIVmac239delta3-vaccinated rhesus macaques. J. Virol. 79: 8131 8141. 51. Schnell, M. J., L. Buonocore, M. A. Whitt, and J. K. Rose. 1996. The minimal conserved transcription stop-start signal promotes stable expression of a foreign gene in vesicular stomatitis virus. J. Virol. 70:2318 2323. 52. Shiver, J. W., et al. 2002. Replication-incompetent adenoviral vaccine vector elicits effective anti-immunodeficiency-virus immunity. Nature 415:331 335. 53. Stone, M., et al. 2010. A limited number of simian immunodeficiency virus (SIV) env variants are transmitted to rhesus macaques vaginally inoculated with SIVmac251. J. Virol. 84:7083 7095. 54. Tan, G. S., et al. 2005. Strong cellular and humoral anti-hiv Env immune responses induced by a heterologous rhabdoviral prime-boost approach. Virology 331:82 93. 55. Veazey, R. S., et al. 1998. Gastrointestinal tract as a major site of CD4 T cell depletion and viral replication in SIV infection. Science 280:427 431. 56. Watkins, D. I., D. R. Burton, E. G. Kallas, J. P. Moore, and W. C. Koff. 2008. Nonhuman primate models and the failure of the Merck HIV-1 vaccine in humans. Nat. Med. 14:617 621. 57. Wilson, N. A., and D. I. Watkins. 2009. Is an HIV vaccine possible? Braz. J. Infect. Dis. 13:304 310. 58. Yeh, W. W., et al. 2010. Autologous neutralizing antibodies to the transmitted/founder viruses emerge late after simian immunodeficiency virus SIVmac251 infection of rhesus monkeys. J. Virol. 84:6018 6032.