Journal of Plant Pathology (2012), 94 (1), 249-253 Edizioni ETS Pisa, 2012 249 SHORT COMMUNICATION EVALUATION OF THE PHYTOSANITARY STATUS OF THE PRUNUS SPECIES IN THE NATIONAL CLONAL GERMPLASM REPOSITORY IN CALIFORNIA: SURVEY OF VIRUSES AND VIROIDS F. Osman 1, M. Al Rwahnih 1, D. Golino 1, T. Pitman 2, F. Cordero 1, J.E. Preece 3 and A. Rowhani 1 1 Department of Plant Pathology, University of California, Davis, CA 95616, USA 2 Foundation Plant services, University of California, Davis, CA 95616, USA 3 National Clonal Germplasm Repository, USDA-ARS, Davis, CA 95616, USA SUMMARY The USDA National Clonal Germplasm Repository (NGCR) at the University of California, Davis is recognized as one of the richest sources of Prunus species material in the US. The repository maintains more than 2450 trees representing 96 taxa collected from around the world. However, the phytosanitary status of the NCGR Prunus collection has not been thoroughly evaluated. In this study, a comprehensive screening of a selected subset of the collection for virus and virus-like diseases affecting Prunus trees has been completed. Two factors were considered for selecting the trees: the country of origin and the observation of suspicious disease symptoms. A total of 221 trees representing 185 different cultivars of cherry, almond, peach, apricot and plum were sampled. Conventional RT-PCR detection was used to test for 13 different viruses and two viroids. The pathogens included in the survey were Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), Plum bark necrosis stem pitting-associated virus (PBNSPaV), American plum line pattern virus (APLPV), Cherry virus A (CVA), Cherry leafroll virus (CLRV), Cherry rasp leaf virus (CRLV), Cherry green ring mottle virus (CGRMV), Cherry necrotic rusty mottle virus (CNRMV), Apple chlorotic leafspot virus (ACLSV) Tomato ringspot virus (ToRSV), Little cherry virus 1 (LChV-1), Little cherry virus 2 (LChV-2), Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd). Though the majority of these trees were asymptomatic, all tested pathogens were detected except for ToRSV and CRLV. Two of the viruses detected (ACLSV and LChV-2) had never been reported from California. Incidence of PNRSV in tested trees was the highest (55 trees) followed by the two viroids (PLMVd and HSVd), with 33 and 32 infected trees, respectively. The incidence for the rest of the pathogens ranged between 0 to 19 trees. The infection rate of all tested samples ranged from 0.5 to 24.9. Key words: California Prunus germplasm, Prunus viruses, viroids, RT-PCR, diagnosis. Corresponding author: A. Rowhani Fax: +1.530.752.2132 E-mail: akrowhani@ucdavis.edu The National Clonal Germplasm repository (NCGR) in Davis (USA) holds a rich collection of 2,450 trees of Prunus species from around the world. To qualify the introduced Prunus material for planting in an isolated field, they are propagated and observed for suspicious symptoms related to viruses, viroids and phytoplasma in the greenhouse for 2-3 years and also tested by ELISA for Plum pox virus (PPV). These resources are preserved to ensure that crop diversity in these species will be continuously available for future generations and to support research efforts in various areas of plant research. The genus Prunus comprises more than 400 species that include stone fruits, almonds and many ornamentals. The diversity of the genus is reflected in the large number of virus and virus-like diseases that are known to infect these species. Fruit trees in the Prunus genus are therefore hosts for many viruses and virus-like agents (viroids and phytoplasmas). Desvignes et al. (1999) and Nemeth (1986) list more than 100 diseases infecting these species worldwide. In many cases the infection remains latent and the trees do not show visible symptoms. However, in other cases, severe symptoms may develop due to infection, which can cause substantial yield losses, unmarketable crops or even death of the trees (Hadidi et al., 2011; Ogawa et al., 1995). PPV, family Potyviridae, is recognized as the most damaging virus of Prunus species. Other common viruses infecting Prunus species belong to diverse virus families including Flexiviridae, Closteroviridae, Secoviridae and Bromoviridae. Viroids of concern infecting these crops are from the family Pospiviroideae (Flores et al., 2005). Many of these viruses are efficiently transmitted in nature by pollen [e.g. Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), Cherry leafroll virus (CLRV), American plum line pattern virus (APLPV)], nematodes [e.g. Tomato ringspot virus (ToRSV)] and mealybugs [Little cherry virus 2 (LChV-2)]. The mode of natural spread for some of these viruses is yet to be determined [e.g. Little cherry virus 1 (LChV-1), Prunus bark necrosis stem pitting-associated virus (PBNSPaV) and Cherry virus A (CVA)] (Fulton, 1986; Martelli and Uyemoto, 2008; Milne and Walter, 1977; Nyland et al., 1969; Ogawa et al., 1995; Raine et al., 1986; Teliz et al., 1966; Uyemoto et al., 1992, Hadidi et al., 2011).
250 Infectious agents infecting Prunus species in California Journal of Plant Pathology (2012), 94 (1), 249-253 Table 1. Sequences of RT-PCR primers designed in this study and used for the detection of fruit tree viruses in the NGCR, Davis, CA. All RT-PCR primers were designed from the coat protein (CP) gene. Virus Primer Primer sequence (5-3 ) PDV PNRSV APLPV ToRSV CLRV CVA CNRMV ACLSV LChV-1 PDV V2 PDV C PNRSV 1425F PNRSV 1805R APLPV 1518 F APLPV-1906 R TORSV-62 F TORSV-738 R CLRV-1385 F CLRV-1720 R CVA-6170 F CVA-6736 R CNRMV-7626 F CNRMV-8210 R ACLSV sense ACLSV-anti.-F.O. LChV1 F1 LChV1 R1 Forward primers: V, F and sense Reverse primers: C, R and anti CCGGTATGATATCTCGTACCGAG TAGTGCAGGTTAACCAAAAGGAT GACTTCACGACCACTCTCCCTC CTAGATCTCAAGCAGGTCTTCATCG GGTCGTCAAGGGAGAGGC TCATCAGGGACTAGTAAATTTGCG ACGCCAAGGGTGGAACTTT CCCATGTAAAGTGCCATTCG GACCGTGTAACGGCAACAGT TGAGTCCGACACTCATACAATAAGC AGCCAGAAGGTATCATGCCAG ATGACATGCCTGCTGGGAG TCCCACCTCAAGTCCTAGCAG TGAACTTGGCCAGTTCTGCC TTCATGGAAAGACAGGGGCAA AAGTCTACAGGCTATTTATTATAAGTCTAA AACCCTCTGCTGCTGCTATGC CCCACCATACAAACCAAAGCC Product size (bp) 181 380 388 676 335 566 584 309 400 Because Prunus species in the collection have not been extensively screened for viral pathogens and because many Prunus viruses and their biological vectors are reported to exist in California (Uyemoto et al., 1989, 1992; Uyemoto and Scott, 1992), there is a compelling need to better understand and evaluate the phytosanitary status of the fruit trees within the Prunus species in the NCGR at Davis. In this study, cultivars of different Prunus species in the NCGR have been surveyed for the presence of 13 different viruses and two viroids. Cultivars were selected from different species of cherry (Prunus avium, P. cerasus L., P. tomentosa, P. mahaleb, P. pseudocerasus, P. virginiana and P. serotina), almond (P. bucharia, P. dulcis, P. triloba, P. petunnikowii and P. pedunculata), peach (P. persica), apricot (P. armeniaca, P. mume and P. manddhurica), and plum (Prunus domestica, P. salicina, P. bokhariensis, and P. munsoniana). The pathogens included in the survey were PNRSV, PDV, PBNSPaV, APLPV, CVA, CLRV, CRLV, CGRMV, CN- RMV, ACLSV, ToRSV, LChV-1, LChV-2, PLMVd and HSVd. Samples from 221 trees were collected in the spring for selected trees represented worldwide geographical regions. Samples included: 63 peach, 50 cherry, 45 apricot, 40 plum, and 23 almond species and cultivars. The primary target for sampling were the trees with symptoms suspected to be of virus and virus-like origin, such as chlorotic spots and rings, oak leaf pattern, yellow leaves, shoot proliferation and stunting, but not many trees with symptoms were found. Eight leaves/petioles from at least six different branches from each tree were randomly collected, combined and immediately frozen at -80 C. Petioles and basal leaves were combined and used for testing. For sample preparation, 0.2 g of basal (mature) leaves were placed in a pre-chilled 2 ml safe lock tube (Qiagen, USA), two pre-chilled tungsten beads (5 mm diameter) were added to each tube and placed in a prechilled cold rack (Geno/Grinder, USA). The racks were placed in a Cryo Station filled with liquid nitrogen. Samples were then homogenized using the 2010 Geno/Grinder (SPEX SamplePrep, USA). One ml guanidine isothiocyanate lysis buffer [4 M guanidine isothiocyanate, 0.2 M sodium acetate ph 5.0, 2 mm EDTA, 2.5 (w/v) PVP-40] was added and homogenized using the Geno/Grinder for 1 min at 1,200 rpm. The homogenate was clarified by centrifugation at 9,960 g for 8 min. Eight hundred µl of the aqueous phase were then subjected to RNA extraction using the Mag- Max TM Express-96 (Applied Biosystems, USA) with the MagMax TM 96 Viral RNA isolation kit (Life Technologies, USA) as per manufacturer s instructions. Total RNA was eluted in 100 µl Diethylpyrocarbonate (DE- PC) treated water. For RT-PCR two µl of the total RNA
Journal of Plant Pathology (2012), 94 (1), 249-253 Osman et al. 251 Table 2. Infection profile of the USDA NCGR Prunus collection, including list of viruses found and the geographical locations of the cultivars from which the trees are originated. Total number of trees used in the experiment was: apricot, 45; cherry, 50; peach, 63; plum, 40; almond, 23. Virus Apricot Cherry Peach Plum Almond Total Trees per virus Geographical locations PDV 0 0 19 38 0 0 0 0 0 0 19 8.6 PNRSV 3 6.7 6 12 34 54 11 27.5 6 26 55 24.9 PBNSPaV 0 0 2 4 5 7.9 9 22.5 0 0 16 7.2 People s Republic of China, UK, France, Germany, Italy, Poland, Switzerland, Turkey, Ukraine, USA, Unknown Turkistan., USA, France, UK, Switzerland, UK, Czech Republic, Brazil, Mexico, Spain, Pakistan, South Africa, Russia, People s Republic of China, Uzbekistan, Canada, Australia, Iran Spain, People s Republic of China, Japan, USA, Unknown APLPV 0 0 0 0 2 3.2 2 5 0 0 4 1.8 Brazil, Unknown CVA 0 0 12 24 0 0 1 2.5 1 4.3 14 6.3 Bulgaria, UK, Germany, Japan, Italy, Netherland., Romania, Sweden, Switzerland, Ukraine CNRMV 0 0 2 4 2 3.2 1 2.5 0 0 5 2.3 Unknown ACLSV 0 0 4 8 9 14.3 2 5 0 0 15 6.8 Germany, Netherland, Czech Republic, Japan, Unknown CLRV 0 0 1 2 0 0 0 0 0 0 1 0.5 New Zealand CGRMV 0 0 9 18 8 12.7 0 0 0 0 17 7.7 UK, France, Netherland, Switzerland, USA, Mexico LChV-1 2 4.4 3 6 2 3.2 1 2.5 0 0 8 3.6 Hungary, USA, Romania, UK, Unknown LChV-2 0 0 1 2 0 0 2 5 0 0 3 1.4 Japan, Unknown HSVd 13 28.9 5 10 11 17.5 2 5 1 4.3 32 14.5 PLMVd 0 0 1 2 31 49.2 1 2.5 0 0 33 14.9 France, Hungary, India, Italy, Japan, Pakistan, USA, Romania, Turkey, Yugoslavia, Netherland, Russia, New Zealand, Brazil, Mexico, Japan, Spain, Nepal, British Columbia, Unknown Czech Republic, Brazil, Mexico, Japan, USA, Pakistan, Romania, People s Republic of China, India, Unknown Total # of samples tested 45 20.26 50 22.62 63 28.51 40 18.10 23 0.41 221 were used as templates in a 25 µl final volume as described by Osman et al. (2007). The enzymes and reagents used for RT-PCR were obtained from Life Technologies. RT-PCR primers available in the literature were used for PBNSPaV (Al Rwahnih et al., 2007), CGRMV (Li and Mock, 2005), CRLV (James and Upton, 2005), HSVd (Astruc et al., 1996), PLMVd (Loreti et al., 1999), LChV-2 (Rott and Jelkmann, 2001) and ACLSV (Menzel et al., 2002 and this study), while the primers for the rest of the viruses were designed in this study (Table 1) and manufactured by Life Technologies. PPV was not included in this survey because: (i) it is a quarantine virus and it was difficult to access a positive con-
252 Infectious agents infecting Prunus species in California Journal of Plant Pathology (2012), 94 (1), 249-253 Table 3. The number of PCR products per virus sequenced (number sequenced) including the number of nucleotide in each fragment (fragment size) and the range of percent nucleotide identity with the published sequences ( homology). Virus Number of PCR products sequenced Size of sequenced fragment range nucleotide sequence identify with published sequences PDV 12 181 92-99 PNRSV 48 380 86-97 PBNSPaV 19 400 87-98 APLPV 2 388 94-100 CVA 10 566 88-99 CNRMV 6 584 90-100 ACLSV 16 309 84-95 CLRV 1 335 96 CGRMV 19 948 88-94 LChV-1 8 400 92-99 LChV-2 2 438 86-94 HSVd 17 297 86-97 PLMVd 32 337 99-100 trol and (ii) the trees in the collection had already been tested for the pathogen by ELISA before planting. All samples were tested by RT-PCR according to Osman et al. (2007), except for the two viroids (Loreti et al., 1999) with a minor modification in which the RNA was denatured at 95 C for 5 min prior to adding to the RT step. RT step was run at 50 C for 60 min followed by PCR amplification. RT-PCR products for all viruses were eluted from the gels using the ZymoClean Gel DNA Recovery Kit (Zymo Research, USA) and sequenced. Sequences were piled up with corresponding sequences available in GenBank using Sequence Analysis and Molecular Biology Data Management software Vector NTI Advance 11 (Invitrogen, USA). The aligned sequences were subjected to BLAST analysis (Altschul et al., 1997; Thompson et al., 1994) through the NCBI (http://www.ncbi.nlm.nih.gov). Table 3 lists the number of PCR products sequenced and their percentage sequence identity at the nucleotide level with the GenBank published sequences. The minimum sequence identity was found among isolates of ACLSV (84) and maximum identity was found among isolates of APLPV and PLMVd (100). General visual inspection of the Prunus collection revealed very few trees with clear symptoms to indicate virus infection. However, the survey showed that large numbers of trees were infected with PNRSV, followed by the two viroids, PLMVd and HSVd. Of the 221 trees sampled, 55 (24.9) were positive for PNRSV, 33 (14.9) for PLMVd and 32 (14.5) for HSVd. The percent infection by other viruses is summarized in Table 2. This survey was conducted in the spring and was not an ideal season for testing phloem-limited closteroviruses such as LChV-1 and LChV-2 which are known to have higher virus titer in late summer and fall. Therefore the total number of trees tested positive for these two viruses may have been higher if tests were performed in the autumn. Different peach species and cultivars were among the most affected trees with 54 infection with PNRSV and 49.2 infection with PLMVd. Cherry trees were next with 38 infection with PDV followed by apricots with 28.9 infection with HSVd, plums and almonds with 27.5 and 26, respectively, with PNRSV. Twenty four percent or less infection per tree is shown for the rest of the trees (Table 2). The Prunus collection at the NCGR is composed of relatively large number of different species collected from different regions worldwide and maintained in this collection with minimal testing and phytosanitary status. This collection is relatively isolated and distant from commercial orchards. However, this study was initiated to better understand and evaluate the phytosanitary status of the collection. Many viruses and viroids were found to be present in this collection including ACLSV and LChV-2 which are detected for the first time in California and have not been reported previously in this region. It is difficult to compare the incidence of viral infection in this collection to commercial orchards in the region, because such an intensive testing have never been performed on commercial orchards, however, one could argue that the phytosanitary status of the majority of the fruit tree orchards in California is much higher because most trees are produced from certified materials. As a consequence of detecting this wide range of viruses and viroids in Prunus cultivars in NCGR collection, a disease elimination therapy is recommended.
Journal of Plant Pathology (2012), 94 (1), 249-253 Osman et al. 253 ACKNOWLEDGEMENTS Many thanks to Bernard Prins from the USDA NC- GR for his help in providing a list of Prunus cultivars and the map of the orchards. REFERENCES Al Rwahnih M., Uyemoto J.K., Falk B.W., Rowhani A., 2007. Molecular characterization and detection of plum bark necrosis stem pitting-associated virus. Archives of Virology 152: 2197-2206. Altschul S.F., Madden T.L., Schäffer A.A., Zhang J., Zhang Z., Miller W., Lipman D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25: 3389-33402. Astruc N., Marcos J.F., Macquaire G., Candresse T., Pallás V., 1996. Studies on the diagnosis of hop stunt viroid in fruit trees: Identification of new hosts and application of a nucleic acid extraction procedure based on non-organic solvents. European Journal of Plant Pathology 102: 837-846. Desvignes J.C., Boyé R., Cornaggia D., Grasseau N., 1999. Maladies a Virus des Arbres Fruitiers. Editions CTIFL, Paris, France. Flores R., Randles J.W., Owens R.A., Bar-Joseph M., Diener T.O., 2005. Subviral agents: viroids. In: Fauquet C.M., Mayo M.A., Maniloff J., Desselberger U., Ball L.A. (eds). Virus Taxonomy: Classification and Nomenclature of Viruses. 8th Report of the International Committee on Taxonomy of Viruses, pp 1147-1161. Elsevier/Academic Press, San Diego, CA, USA. Fulton R.W., 1986. Practices and precautions in the use of cross-protection for plant virus disease control. Annual Review of Phytopathology 24: 67-81. Hadidi A., Barba M., Candresse T., Jelkmann W., 2011. Virus and Virus-like Diseases of Pome and Stone Fruits. APS Press, St. Paul, MN, USA. James D., Upton C., 2005. Genome segment RNA-1 of a flat apple isolate of Cherry rasp leaf virus: nucleotide sequence analysis and RT-PCR detection. Archives of Virology 150: 1469-1479. Li R., Mock R., 2005. An improved reverse transcriptionpolymerase chain reaction (RT-PCR) assay for the detection of two cherry flexiviruses in Prunus spp. Journal of Virological Methods 129: 162-169. Loreti S., Faggioli F., Cardoni M., Mordenti G., Babini A.R., Pollini C.P., Barba M., 1999. Comparison of different diagnostic methods for detection of peach latent mosaic viroid. Bulletin OEPP/EPPO Bulletin 29: 433-438. Martelli G.P., Uyemoto J.K., 2008. Plant virus diseases: fruit trees and grapevine. In: Mahy B.W.J., Van Regenmortel M.H.V. (eds). Encyclopedia of Virology, 3rd Ed, Vol 4, pp 201-207. Elsevier/Academic Press, San Diego, CA, USA. Menzel W., Jelkmann W., Maiss E., 2002. Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mrna as internal control. Journal of Virological Methods 99: 81-92. Milne J.R., Walter G.H., 1977. The potential for pollen borne virus transfer in a plum orchard infected with prunus necrotic ringspot virus. Phytopathology 145: 105-111. Nemeth M., 1986. Virus, Mycoplasma, and Rickettsia Diseases of Fruit Trees. Martinus Nijhoff, Dordrecht, The Netherlands. Nyland G., Lownsbery B.F., Low S.K., Mitchell J.F., 1969. The transmission of cherry raspleaf virus by Xiphinema americanum. Phytopathology 59: 1111-1112. Ogawa J.M., Zehr E.I., Bird G.W., Ritchie D.F., Uriu K., Uyemoto J.K., 1995. Compendium of Stone Fruit Diseases. APS Press, St. Paul, MN, USA. Osman F., Leutenegger C., Golino D., Rowhani A., 2007. Real-time RT-PCR (TaqMan) assays for the detection of Grapevine leafroll-associated viruses 1 5 and 9. Journal of Virological Methods 141: 22-29. Raine J., McMullen R., Forbs A., 1986. Transmission of the agent causing little cherry disease by the apple mealybug Phenacoccus aceris and the dodder Cuscuta lupuliformis. Canadian Journal of Plant Pathology 8: 6-11. Rott M.E., Jelkmann W., 2001. Detection and partial characterization of a second closterovirus associated with little cherry disease, Little cherry virus-2. Phytopathology 91: 261-267. Teliz D., Grogan R.G., Lownsbery G.F., 1966. Transmission of tomato ringspot, peach yellow bud mosaic and grape yellow vein viruses by Xiphinema americanum. Phytopathology 56: 658-663. Thompson J.D., Higgins D.G., Gibson T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673-4680. Uyemoto J.K., Grant J.A., Krueger W.A., Olson W.H., Osgood J.M., Sibbet G.S., Viveros M., Weakley C.V., 1989. Survey detects viruses in almond, prune, and sweet cherry orchads. California Agriculture 43: 14-15. Uyemoto J.K., Asai W.K., Luhn C.F., 1992. Ilarviruses: evidence for rapid spread and effects on vegetative growth and fruit yields of peach trees. Plant Disease 76: 71-74. Uyemoto J.K., Scott S.W., 1992. Important diseases of Prunus caused by viruses and other graft-transmissible pathogens in California and South Carolina. Plant Disease 76: 5-11. Received September 29, 2011 Accepted October 30, 2011