The mutations that drive cancer Paul Edwards Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge
Previously on Cancer... hereditary predisposition Normal Cell Slightly Abnormal More Abnormal Malignant? Gene changes mutations + epigenetic change + viruses + mobile elements accelerated by Genetic Instability
Which genes are altered in cancer? - all sorts of different pathways and systems - Mitogenic signalling pathways e.g. Wnt signalling pathway*, Receptor tyrosine kinase pathways* Rb control of cell cycle Hedgehog pathway, Notch pathway, Hippo pathway... - Inhibitory signalling, e.g. TGF-β pathway* - Transcription control systems - transcription factors - p53 - beta-catenin, MYC and ETS families - hormone receptors ER - chromatin / histone modifiers - Cell adhesion, e.g. cadherin E in breast - telomerase - DNA repair and mitotic processes - Carbohydrate metabolism (IDH1 in gliomas and AML) - etc., etc.!
A weird example
citric acid cycle citrate A weird example isocitrate isocitrate dehydrogenases hydroxyglutarate alphaketoglutarate DNA hypermethylation? = epigenetic instability? isocitrate dehydrogenase IDH1 mutated in majority glioblastomas, occasional leukaemias,
What sorts of mutations alter the genes? All sorts of mutation
What sorts of mutations alter the genes? Sequence changes, e.g. TCGAGCTATGTGTCTCTAGGTCGGT TCGAGCTATGAGTCTCTAGGTCGGT Small-scale changes STRUCTURAL changes, e.g. Large-scale changes
What sorts of mutations alter the genes? - single base pair change, e.g. RAS, p53... Small-scale changes - chromosome translocation - Amplification (lot of copies of gene) - Duplication - Deletion Large-scale changes
What sorts of mutations alter the genes? - single base pair change - Indel = Small insert or deletion ->frameshift Small-scale changes - chromosome translocation APC classic example, truncated in colon - Amplification (lot of copies of gene) - Duplication - Deletion Large-scale changes
What sorts of mutations alter the genes? - single base pair change - Indel = Small insert or deletion ->frameshift Small-scale changes - chromosome translocation APC classic example, truncated in colon - Amplification (lot of copies of gene) - Duplication - Deletion Large-scale changes
What sorts of mutations alter the genes? - single base pair change - Indel = Small insert or deletion ->frameshift Small-scale changes - chromosome translocation APC classic example, truncated in colon, first mutation in Vogelstein s model of colon cancer, - Amplification (lot of copies of gene) - Duplication - Deletion Large-scale changes
Deleting the APC gene in colon Wild-type APC deleted Crypt region Sansom, O.J. et al., 2004. Genes & development Crypt region has expanded
What sorts of mutations alter the genes? - single base pair change - Indel = Small insert or deletion ->frameshift Small-scale changes - chromosome translocation...cca ATA AAT TAT AGT...... P I N Y S... - Amplification (lot of copies of gene) - Duplication...CCA ATA AAT TTA TAG...... P I N L *STOP - Deletion APC classic example, truncated in colon T truncated APC protein Large-scale changes
What sorts of mutations alter the genes? - single base pair change - Indel = Small insert or deletion ->frameshift - (e.g. APC in practical) Small-scale changes - Deletion - Inversion - Duplication - Amplification - Chromosome translocation Large-scale changes
Duplication and amplification Gene e.g. EGFR Duplication tandem OR inverted Amplification Amplified gene
Chromosome translocation reciprocal translocation OR unbalanced translocation
Chromosome translocation translocation beginning of gene A end of gene B
What sorts of mutations alter the genes? How do we study these mutations?
How did we discover cancer genes historically before large scale sequencing Viruses: retrovirus oncogenes e.g. RAS, MYC (RAt Sarcoma, MYeloblastosis C) DNA tumour viruses p53 - Deletion Hereditary predisposition to cancer - Duplication e.g. breast cancer prediposition BRCA1, BRCA2 polyposis coli APC - Amplification (lot of copies of gene) Large-scale changes - Chromosome translocation
p53 is a hub for stress signalling DNA damage telomeres short aberrant growth signals ATM, ATR kinases (inhibits CDK/cyclin complexes) p21 p53 p53 p53 p53 p14 ARF DNA Viruses: e.g. HPV AdenoV RB pathway cycle arrest apoptosis
How do we study the alterations/mutations? sequencing Small-scale changes - Deletion - Duplication - Amplification (lot of copies of gene) Large-scale changes - Chromosome translocation
Passengers versus Drivers Normal Cell Slightly Abnormal More Abnormal Malignant A AB ABC ABCD Gene changes
Passengers versus Drivers Normal Cell Slightly Abnormal More Abnormal Malignant Random passenger mutations X Y A XY Y AB Z ABC XY X ABCD Z α γα γα β Z Gene changes random passenger mutations are difficult to distinguish from driver mutations
How do we study the alterations/mutations? sequencing Small-scale changes - Deletion started with cytogenetics... - Inversion - Duplication Large-scale changes - Amplification - Chromosome translocation
Metaphase chromosomes
Karyotype
Philadelphia chromosome 9:22 22:9
Breast Cancer Karyotype, from primary culture Pandis et al (1998) Genes Chromosomes Cancer 22, 122
Amplification of N-MYC Chr 12 * One copy N-MYC Hundreds of copies
Breast Cancer Cell Line MDA-MB-361 Joanne Davidson
CGH Hybridization: Search for deletions and amplifications Amplification EGFreceptor (ERBB/ HER-1) Number of copies 2 1 0 Genome position glioblastoma Deletion P16/CDKN2A/INK4A implicated in senescence
Examples of mutations Tyrosine kinases and signalling downstream from them
Receptor Tyrosine Kinase (RTK) signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor / ERBB, HER-1 PIP2/ PI3KCA PIP3 AKT ERBB2/HER-2 PTEN tyrosine kinases
POINT Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor A.k.a ERBB, HER-1 Ras GTP (ac,ve) PI3KCA PIP3 AKT SOS PTEN GAP ERBB2/HER-2 Ras GDP (inac,ve)
POINT Mutations in RTK signalling pathways EGF EGF-Receptor RAS Grb2, SoS B-RAF RAS family: HRAS, KRAS, NRAS MAP Kinase pathway PI3KCA PIP3 AKT ERBB2/HER-2 PTEN
POINT Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor PI3KCA ERBB2/HER-2 - Activating mutations, act like ras mutations. PIP3K AKT - In tumours that otherwise have Ras PTEN mutations e.g. 60% of melanomas, some colon cancers - Commonest mutation V600E (valine 600 -> glutamic acid),
BRAF V600E activation valine glutamic acid V600 595 594 598 596 T599 Activation segment is thought to move when Thr599 is phosphorylated, activating kinase. V600E where valine replaced by Gutamic acid doesn t need phosphorylation. Wan et al, 2004 PMID 15035987
POINT Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor PI3KCA ERBB2/HER-2 notes: PIP3 AKT activating mutations are highlyspecific PTEN pathways mutated rather than genes
POINT Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor PI3KCA ERBB2/HER-2 - Activating mutations. - One PIP3K of the Common AKT mutations - E542K (glutamic acid 542 -> lysine) PTEN - 40% of breast cancers, several other cancers
POINT Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor PI3KCA PIP3 AKT PTEN ERBB2/HER-2 Both occasionally point mutated in lung cancers
POINT Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor PI3KCA PIP3 AKT ERBB2/HER-2 PTEN
POINT Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor PI3KCA PIP3 PTEN AKT ERBB2/HER-2 RAS, RAF and PI3KCA feature in Vogelstein s model of colon cancer
Examples of alterations/mutations? - single base pair change - Indel = Small insert or deletion Small-scale changes - Deletion - Inversion - Duplication - Amplification - Chromosome translocation Large-scale changes
Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor PI3KCA PIP3 AKT PTEN ERBB2/HER-2 Deletions common (as well as point mutations)
What sorts of mutations alter the genes? - single base pair change - Indel = Small insert or deletion -> Small-scale changes - Deletion - Inversion - Duplication - Amplification - Chromosome translocation Large-scale changes
Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor Activated by tandem duplication! PI3KCA PIP3K AKT ERBB2/HER-2 PTEN
Tandem duplications causing gene fusion of BRAF About 2 Mb BRAF KIAA1549 tandem duplication BRAF KIAA-BRAF Astrocytomas KIAA1549 BRAF fusion
Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor PI3KCA take home message 3: PIP3 AKT same gene can be mutated in multiple PTEN ways ERBB2/HER-2
Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor both fused by translocation (rarely) PI3KCA PIP3 AKT ERBB2/HER-2 PTEN
Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor Amplified in brain tumours PI3KCA PIP3 AKT PTEN ERBB2/HER-2 Amplified in breast
What sorts of mutations alter the genes? - single base pair change - Indel = Small insert or deletion -> Small-scale changes - Deletion - Inversion - Duplication - Amplification - Chromosome translocation Large-scale changes
The first human cancer mutation: The Philadelphia chromosome translocation
Philadelphia chromosome 9:22 9:22 reciprocal translocation of chronic myeloid leukaemia fuses BCR to ABL 22:9
BCR-ABL fusion protein Abl is a tyrosine kinase, controlled by N-terminal domain N-term ABL kinase Normal Abl BCR BCR Normal Bcr likes to form dimers Tyrosine kinases are activated by dimerisation BCR BCR ABL kinase -> Activated tyrosine kinase ABL kinase Iconic translocation; diagnostic of CML; target for drug Glivec/Gleevec
There are fusion genes in common epithelial cancers
There are fusion genes in common epithelial cancers TMPRSS2-ERG ~50% prostate cancers Chr. 21 TMPRSS2 ERG Deletion TMPRSS2- ERG fusion
There are fusion genes in common epithelial cancers TMPRSS2-ERG ~50% prostate cancers promoter only (intact) transcription factor TMPRSS2- ERG fusion
Rearrangement more often INactivates a gene A rearrangement can inactivate a gene, - by breaking it or - by gene loss
Don t forget epigenetics! Examples of genes silenced by DNA methylation: Gene Function Cancer MLH1 mismatch DNA repair colorectal Cadherin E cell-cell adhesion lobular breast cell membrane adherens junction Cadherin Cadherin beta-catenin beta-catenin
Viruses e.g. several viruses encode proteins that block p53 and Rb: Human papillomavirus(es) (HPVs) proteins E6, E7 Adenovirus E1a, E1b
and hot topic LINE-1 retrotransposons? We know even less, but LINE1 retrotransposons form 10-1000 new insertions in some tumours can interrupt genes and turn genes on so far one inactivation of APC reported watch this space!