Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Similar documents
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplementary. presence of the. (c) mrna expression. Error. in naive or

Nature Medicine doi: /nm.3957

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

SUPPLEMENTARY INFORMATION

Supplemental Table I.

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Information:

SUPPLEMENTARY INFORMATION

Supplementary Figure 1 IL-27 IL

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table

Supplementary Figures

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY FIGURES

NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies

Supplemental Figure 1

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast

The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF

Examples of questions for Cellular Immunology/Cellular Biology and Immunology

SUPPORTING INFORMATIONS

Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ

Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +

NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow

Supplementary Materials for

Supplementary Information

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN

NK cell flow cytometric assay In vivo DC viability and migration assay

Supporting Information Table of Contents

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed

Nature Immunology: doi: /ni Supplementary Figure 1. Id2 and Id3 define polyclonal T H 1 and T FH cell subsets.

Eosinophils are required. for the maintenance of plasma cells in the bone marrow

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

SUPPLEMENT Supplementary Figure 1: (A) (B)

ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.

Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018

D CD8 T cell number (x10 6 )

Transcription factor Foxp3 and its protein partners form a complex regulatory network

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Supplementary Figure 1.

Supplemental Information. Checkpoint Blockade Immunotherapy. Induces Dynamic Changes. in PD-1 CD8 + Tumor-Infiltrating T Cells

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Table 1. Oligonucleotide primers used in quantitative and qualitative PCRs of this study.

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Nature Medicine: doi: /nm.3922

Supplementary Figure 1. Example of gating strategy

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

Supplemental Figure Legends

Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice

Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik

Adaptive (acquired) immunity. Professor Peter Delves University College London

pro-b large pre-b small pre-b CCCP (µm) Rag1 -/- ;33.C9HCki

Fig. S1 A. week 4 week 6

Peli1 negatively regulates T-cell activation and prevents autoimmunity

activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Therapeutic efficacy of MUC1- specific CTL and CD137 costimulation. mammary cancer model. Pinku Mukherjee & Sandra Gendler

Supplementary Figures

CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas

Supplemental Information. Regulatory T Cells Promote Macrophage. Efferocytosis during Inflammation Resolution

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Dendritic cell subsets and CD4 T cell immunity in Melanoma. Ben Wylie 1 st year PhD Candidate

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages

Supplementary Information

ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and

Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.

NMED-A65251A. Supplementary Figures.

Krishnamoorthy et al.,

Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

of whole cell cultures in U-bottomed wells of a 96-well plate are shown. 2

Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).

Supplementary Figures

Transcription:

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c + MHCII + : DC; CD11c - CD11b + : macrophage; CD8 + CD4 - CD62L high CD44 low : naïve CD8 T cell; CD4 + CD8 - CD62L high CD44 low : naïve CD4 T cell; CD19 + : B cell; and CD3 - NK1.1 + : NK cell. The mrna levels of chitinase and chitinase like proteins were analyzed by RT-PCR. Each gene expression level was normalized to β-actin. Data are mean ± SD of four independent experiments. **p < 0.01, ***p < 0.001, ****p < 0.0001 (two-tailed Student s t-test).

Supplementary Figure 2. Chi3l1 KO mice develops normal immune cell populations. The cells from indicated tissue of WT and Chi3l1 KO mice were isolated and stained with antibodies for flow cytometric analysis. (a) Percentages of CD4 + CD8 + cells, CD4 single-positive cells, CD8 single-positive cells in the thymus were analyzed. (b-e) Percentages of dendritic cells (CD11c + MHCII + ) and macrophages (CD11b + ), NK cells (NK1.1 + ), and B cells (CD19 + ) in the spleen was analyzed. (f) CD4 and CD8 T cells with activation marker of CD62L and CD44 in the spleen, inguinal lymph node, mesenteric lymph node was analyzed. (g) Foxp3 expressing regulatory T cells in the Thymus, spleen, inguinal lymph node, mesenteric lymph node was analyzed. Data are mean ± SD of 5 mice samples. n.s., not significant;

Supplementary Figure 3. Increase of tumor infiltrating effector T cells in the lung of CD4-Chi3l1 KO mice. The cells in the lung were isolated from non-tumor and tumor regions separately, then further analyzed by flow cytometry. (a, b) Percentage of CD45 + cells, proportion of CD4 and CD8 in CD45 + cells in non-tumor region (Non-TIL) and tumor region (TIL). (c-f) IFNγ and TNFα expressing CD4 +, CD8 +, CD4 - CD8 - cells were analyzed in Non-TIL and TIL. (g, h) mrna expression of genes related to cytotoxicity and Th1 effector functions was analyzed by quantitative RT-PCR. Each gene expression level was normalized to β-actin. Data are mean ± SD of two sets of independent experiments (n=8). (I) CD4 + Foxp3 + cells in TIL. (j) % of CD4 + Foxp3 + cells and ratio of CTL/Treg cell in TIL. Data are mean ± SD of two sets of independent experiments and each dot in graphs represent an individual mouse. n.s., not significant; *p < 0.05, **p < 0.01 (two-tailed Student s t-test).

Supplementary Figure 4. Peripheral cytokine expressing immune cells in both CD4-Chi3l1 KO mice and dnp2-sichi3l1 treated mice. (a-d) IFNγ and TNFα expressing lymphocytes in the spleen and inguinal lymph node of WT and CD4-specific Chi3l1 KO mice following intravenous B16F10 melanoma injection were analyzed by flow cytometry. (e-h) IFNγ and TNFα expressing lymphocytes in the spleen and inguinal lymph node of dnp2-siegfp or dnp2-sichi3l1 treated mice following intravenous B16F10 melanoma injection were analyzed. Data are mean ± SD of three sets of independent experiments and each dot in graphs represent an individual mouse. n.s., not significant;

Supplementary Figure 5. Adoptive transfer of Chi3l1 KO Th1/CTL cells in RAG KO mice inhibits pulmonary metastasis. FACS-sorted WT and Chi3l1 KO naïve CD4 and CD8 T cells were differentiated into Th1 and CTL for 3 days. (a) RAG KO mice were injected with 5 x 10 5 B16F10 melanoma cells intravenously at day 0 with following transfer of WT or Chi3l1 KO Th1 (2 x 10 5 ) and CTL (3 x 10 5 ) at day 5. At day 14, the mice were sacrificed and analyzed. (b) Representative lung image. Scale bar, 2mm. (c) Number of pleural colonies on lungs. Data are mean ± SEM of 5 mice samples. (d, e) Proportion of CD4 and CD8 T cells in CD45 gating. (f, g) Flow cytometric analysis of IFNγ and TNFα expressing CD4 and CD8 T cells in the lung. (h) mrna expression of genes related to cytotoxicity and Th1 effector functions was analyzed by quantitative RT-PCR. Each gene expression level was normalized to β-actin. Data are mean ± SD of 5 mice samples. n.s., not significant; *p < 0.05, **p < 0.01, ***p < 0.001 (two-tailed Student s t-test).

Supplementary Figure 6. Targeted knockdown of Chi3l1 by dnp2-sichi3l1 complex in dose dependent manner. (a) Chi3l1 mrna level in the lung was analyzed by RT-PCR. Chi3l1 mrna expression level was normalized to β-actin, and represented as relative expression of Chi3l1 mrna to day 0. (b) Chi3l1 protein level in the lung was analyzed by Western blotting. Data are from one time experiment. (c) Chi3l1 mrna expression in the lung was analyzed on day 2 following free sirna or free peptide treatment. Chi3l1 mrna expression level was normalized to β-actin. Data are mean ± SD of 3 mice samples. n.s., not significant;

Supplementary Figure 7. dnp2 is required for Chi3l1 knockdown by sichi3l1 in T cells. MACSsorted WT naive CD4 T cells differentiated into Th1 cells with the indicated concentrations of sichi3l1 or dnp2-sichi3l1 complex. (a) Intracellular level of IFNγ and TNFα expression level was analyzed by flow cytometry. (b) % of TNFα + IFNγ + cells were represented as bar graph. Data are mean ± SD of 3 mice samples. n.s., not significant; **p < 0.01 (two-tailed Student s t-test).

Supplementary Figure 8. NK cells and non-lymphocytic cells were not affected by dnp2-sichi3l1 treatment in mice. (a) IFNγ and Granzyme B expression level was analyzed by flow cytometry in NK cells (NK1.1 + CD4 - CD8 - ) and the non-lymphocytic population (NK1.1 - CD4 - CD8 - ) from dnp2-siegfp or dnp2-sichi3l1-treated mice. (b, c) Percentage of IFNγ and mean fluorescence intensity (MFI) of Granzyme B expressing cells were analyzed. Data are mean ± SD of 5 mice samples. n.s., not significant;

Supplementary Figure 9. Free sichi3l1 itself treatment does not inhibit pulmonary metastasis. (a) Representative lung image from intranasal PBS or free sichi3l1-treated mice with intravenous B16F10 melanoma injection. Scale bar, 2mm. (b) Number of pleural colonies in the lung of PBS or free sichi3l1-treated mice. Data are mean ± SEM and each dot in graphs represent an individual mouse. (c) Flow cytometric analysis of IFNγ and/or TNFα expressing CD4 and CD8 T cells, and NK cells. (d) Scattered graph of representative results. Data are mean ± SD and each dot in graphs represent an individual mouse. n.s., not significant;

Supplementary Figure 10. Therapeutic effect of dnp2-sichi3l1 complex treatment inhibits pulmonary metastasis. (a) Experimental therapeutic treatment scheme of dnp2-sichi3l1 complex in pulmonary melanoma metastasis model. (b) Representative lung image from dnp2-siegfp- or dnp2- sichi3l1-treated mice with intravenous B16F10 melanoma injection. Scale bar, 2mm. (c) Number of pleural colonies in the lung. Data are mean ± SEM of three sets of independent experiments and each dot in graphs represent an individual mouse. (d-g) Flow cytometric analysis of IFNγ and TNFα expressing CD4 and CD8 T cells or NK cells and non-lymphocytic cells (NK1.1 - CD4 - CD8 - ). Data are mean ± SD of three sets of independent experiments and each dot in graphs represent an individual mouse. n.s., not significant; *p < 0.05, ***p < 0.001 (two-tailed Student s t-test).

Supplementary Figure 11. Exogenous Chi3l1 protein treatment does not effect on Th1 differentiation. MACS-sorted WT and Chi3l1 KO naïve CD4 T cells were differentiated into Th1, Th2, and Th17 cells under lineage-specific cytokine conditions with the indicated concentration of recombinant mouse Chi3l1 (rmchi3l1) protein. (a, b) Lineage-specific cytokine expression was analyzed by flow cytometry. (c) Peritoneal macrophages from WT and Chi3l1 KO mice were isolated and stimulated with LPS for 12 hours in vitro. IL-6 and IL-12 level in culture supernatant was analyzed by ELISA. Data are mean ± SD of three sets of independent experiments. n.s., not significant; *p < 0.05, **p < 0.01, ***p < 0.001 (two-tailed Student s t-test).

Supplementary Figure 12. Th1 or CTL function-related gene expressions in NK cells. (a) Twist1 mrna expression in FACS-sorted naïve CD4, CD8, and NK cells. (b) mrna levels of Twist1, T-bet, IFNγ, Perforin, and Granzyme B in activated WT and Chi3l1 KO NK cells. Each gene expression level was normalized to β-actin. Data are mean ± SD of three sets of independent experiments. n.s., not significant; *p < 0.05 (two-tailed Student s t-test).

Supplementary Figure 13. dnp2-sichi3l1 complex does not directly inhibit B16F10 melanoma cell growth. 4 x 10 4 B16F10 melanoma cells were seeded into 96-well plates with 100 or 250 ng dnp2- siegfp or dnp2-sichi3l1. Based on CCK-8 staining result, % of cell proliferation was calculated as increased live cell percentage relative to the value at day 0. Data are mean ± SD of three sets of independent experiments.

Supplementary Figure 14. Increased tumor infiltrating IFNγ-producing T cells in subcutaneous solid tumor of CD4-Chi3l1 KO mice. (a) WT and Chi3l1 KO mice were implanted with 1 x 10 5 B16F10 melanoma cells by subcutaneous injection. Tumor size was measured every 48 hours with a caliper until Day 18. (b) Representative image of isolated tumor tissues from WT and CD4-Chi3l1 KO mice on day 18. Scale bar, 10mm. (c) Tumor size measurement with a caliper. Data are mean ± SEM of three mice samples. (d, e) Flow cytometric analysis of tumor infiltrating IFNγ and/or TNFα producing CD4 and CD8 T cells. Data are mean ± SD of 3 mice samples. *p < 0.05 (two-tailed Student s t-test).

Supplementary Figure 15. dnp2-sichi3l1 treatment in macrophages enhances IL-12 and IL-6. Mouse peritoneal macrophages were isolated and stimulated with LPS for 12 hours with or without 250 ng of dnp2-siegfp or dnp2-sichi3l1 treatment. IL-12 and IL-6 production in culture supernatant was measured by ELISA. Data are mean ± SD of at three sets of independent experiments. n.s., not significant; *p < 0.05, ***p < 0.001 (two-tailed Student s t-test).

Supplementary Figure 16. Raw western blotting images used in figures. (a-e) The full western blot images of Figure 2g (a), Figure 3 e (b), Figure 3h (c), Figure 7g (d), and Supplementary Fig. 7 (e).

Forward 5 to 3 Reverse 3 to 5 Actb TGTCCCTGTATGCCTCTGGT CACGCACGATTTCCCTCTC Chi3l1 GTACAAGCTGGTCTGCTACTTC ATGTGCTAAGCATGTTGTCGC Tbx21 AGCAAGGACGGCGAATGTT GGGTGGACATATAAGCGGTTC Runx3 GACTCCTTCCCCAACTATACACC GTGCTCGGGTCTCGTATGAA Ifng ATGAACGCTACACACTGCATC CCATCCTTTTGCCAGTTCCTC Gata3 GAAGGCATCCAGACCCGAAAC ACCCATGGCGGTGACCATGC Il4 GGTCTCAACCCCCAGCTAGT GCCGATGATCTCTCTCAAGTGAT Il13 CAGCCTCCCCGATACCAAAAT GCGAAACAGTTGCTTTGTGTAG Il5 CTCTGTTGACAAGCAATGAGACG TCTTCAGTATGTCTAGCCCCTG Il10 GCTCTTACTGACTGGCATGAG CGCAGCTCTAGGAGCATGTG Junb TCACGACGACTCTTACGCAG CCTTGAGACCCCGATAGGGA Rorgt GACCCACACCTCACAAATTGA AGTAGGCCACATTACACTGCT Il17 TTTAACTCCCTTGGCGCAAAA CTTTCCCTCCGCATTGACAC Il21 GGACCCTTGTCTGTCTGGTAG TGTGGAGCTGATAGAAGTTCAGG Gmcsf GGCCTTGGAAGCATGTAGAGG GGAGAACTCGTTAGAGACGACTT Batf GTTCTGTTTCTCCAGGTCC GAAGAATCGCATCGCTGC Socs1 CTGCGGCTTCTATTGGGGAC AAAAGGCAGTCGAAGGTCTCG Socs3 ATGGTCACCCACAGCAAGTTT TCCAGTAGAATCCGCTCTCCT Socs5 GAGGGAGGAAGCCGTAATGAG CGGCACAGTTTTGGTTCCG Perforin GAGAAGACCTATCAGGACCA AGCCTGTGGTAAGCATG Gzmb CCTCCTGCTACTGCTGAC GTCAGCACAAAGTCCTCTC Il13ra2 ACCGAAATGTTGATAGCGACAG ACAATGCTCTGACAAATGCGTA Chit1 TGGGCAGGTGTGATGACTCT CCCTGGGAAAGAACCGAACTG Amcase CTGCGTCAGTATGGGTTTGAT TGGGCCTGTTGCTCTCAATAG Ym-1 ACCTGCCCCGTTCAGTGCCAT CCTTGGAATGTCTTTCTCCACAG Foxp3 CCCATCCCCAGGAGTCTTG ACCATGACTAGGGGCACTGTA Eomes TCATCGCTGTGACGGCCTACCA GGGGAATCCGTGGGAGATGGAGT Tnfsf10 ATGGTGATTTGCATAGTGCTCC GCAAGCAGGGTCTGTTCAAGA Ccr5 TTTTCAAGGGTCAGTTCCGAC GGAAGACCATCATGTTACCCAC Cxcr3 TACCTTGAGGTTAGTGAACGTCA CGCTCTCGTTTTCCCCATAATC Cxcr2 ATGCCCTCTATTCTGCCAGAT GTGCTCCGGTTGTATAAGATGAC Ctse GACATCAGTCCCTTCGGAAGA AGGGGTTCATTGACACTCGAATA Twist1 GGACAAGCTGAGCAAGATTCA CGGAGAAGGCGTAGCTGAG Supplementary Table 1. List of primers