The covalently closed circular DNA (cccdna) hepatitis

GASTROENTEROLOGY 2007;133:843 852 Impaired Intrahepatic Hepatitis B Virus Productivity Contributes to Low Viremia in Most HBeAg-Negative Patients TASSILO VOLZ,* MARC LUTGEHETMANN,* PAUL WACHTLER,* ANNA JACOB,* ALEXANDER QUAAS, JOHN M. MURRAY, MAURA DANDRI,* and JOERG PETERSEN* *Department of Medicine and Institute of Pathology, University Hospital Hamburg-Eppendorf, Hamburg, Germany; and School of Mathematics and Statistics, University of New South Wales, Sydney, Australia See editorial on page 1031. Background & Aims: Knowledge of factors regulating transcriptional activity of hepatitis B virus (HBV) covalently closed circular DNA (cccdna) may help in understanding mechanisms of viral decay and how these processes are thwarted in chronically HBV-infected patients. Methods: Liver biopsies from 119 treatment-naive chronically infected patients (42 HBeAg-positive and 77 HBeAgnegative) were determined for HBV transcriptional and replicative activity. Results: Significantly lower median serum HBV DNA ( 4 log), intrahepatic HBV DNA ( 2 log), and cccdna ( 1 log) amounts were measured in HBeAg-negative versus HBeAg-positive patients. Despite a good correlation found between intrahepatic amounts of progeny virions and serum HBV DNA in all patients, cccdna levels did not correlate with serum titers in HBeAg-negative individuals. Analysis of HBV RNA transcripts showed that impaired virion productivity in HBeAg-negative individuals was due to lower steady-state levels of pregenomic RNA produced per cccdna. Interestingly, pres/s RNA levels and serum HBsAg concentrations did not differ between HBeAg-positive and HBeAg-negative patients when normalized for cccdna contents, showing that subviral particle production was not impaired in HBeAg-negative patients and correlated with cccdna levels. Although the majority of HBeAgnegative individuals harbored cccdna with common precore and/or basal core promoter mutations, occurrence of these variants was not responsible for reduced viral replication. Instead, replacement of wild-type cccdna with core promoter mutants reestablished high virion productivity. Conclusions: Lower viremia in HBeAg-negative individuals is not only due to lower cccdna content but also to impaired virion productivity, which can arise without emergence of HBeAg variants and without affecting HBsAg production. The covalently closed circular DNA (cccdna) hepatitis B virus (HBV) molecule is responsible for failure of viral clearance and relapse after antiviral therapy in chronically infected individuals. cccdna is produced in the nucleus of infected hepatocytes by repair of relaxed circular replicative DNA (rcdna) contained in the nucleocapsids of infecting virions. Disguised as a stable mini-chromosome, the cccdna utilizes the cellular transcriptional machinery to produce all viral RNAs necessary for protein production and viral replication, which takes place in the cytoplasm after reverse transcription of the pregenomic RNA (pgrna). The major source of cccdna in infected hepatocytes comes from newly synthesized nucleocapsids, which are not enveloped and secreted into the blood but are transported into the nucleus to ensure accumulation, and later maintenance, of the cccdna pool. 1,2 Due to the narrow host range of HBV and limited animal models available, 3 factors that regulate the transcriptional activity of the cccdna are currently unknown. These factors need to be elucidated because they will affect the size and ultimately the stability of the cccdna pool and therefore will influence the clinical course of ongoing infection. Recent studies have shown that intrahepatic cccdna loads may differ in the natural course of chronic infection, with hepatitis B e antigen (HBeAg)-negative patients harboring lower levels of cccdna than HBeAg-positive patients. 4 6 However, it is still debated whether HBeAgnegative patients replicate HBV less efficiently. 6,7 Transcription of pgrna is under control of the HBV basal core promoter (BCP), and mutations in this region and in the precore (PC) region are common in HBeAg-negative patients and have been shown to affect viral replication in vitro. 8 10 Nevertheless, it is not known whether PC/ BCP mutations can alter HBV replicative activity in chronically infected individuals. Abbreviations used in this paper: BCP, basal core promoter; cccdna, covalently closed circular DNA; HBeAg, hepatitis Be antigen; HBsAg, hepatitis B surface antigen; PC, precore; pgrna, pregenomic RNA; rcdna, relaxed circular DNA. 2007 by the AGA Institute 0016-5085/07/$32.00 doi:10.1053/j.gastro.2007.06.057

844 VOLZ ET AL GASTROENTEROLOGY Vol. 133, No. 3 The aims of this study were to investigate transcriptional and replicative activities of HBV in liver biopsy specimens from 119 treatment-naive patients in different phases of chronic infection (42 HBeAg-positive and 77 HBeAg-negative patients). We determined whether virion productivity significantly differed between HBeAg-positive and HBeAgnegative patients; secondly, we studied whether production of subgenomic viral RNAs, and hence of subviral particles, may be differently regulated; and thirdly, we analyzed the presence of PC/BCP mutations and correlated their presence with changes in viral replicative activity in patients. Materials and Methods Patient Characteristics A total of 119 adults (89 men and 30 women) with chronic HBV infection who were seen in the outpatient clinic at the University of Hamburg, Germany, were included in the study. Ten percent of the patients were of Asian origin (n 12), and 90% were white. The age of the patients ranged from 19 to 64 years (median, 37 years). All patients were hepatitis B surface antigen (HBsAg) positive; were negative for hepatitis C virus, human immunodeficiency virus, and hepatitis D virus serologic markers of infection; and were not receiving antiviral treatments. Forty-two individuals were HBeAg positive, and 77 were HBeAg negative and antibody to hepatitis B e antigen positive. General inclusion criteria for the study were the presence of HBsAg for at least 1 year and persistently elevated alanine aminotransferase (ALT) levels. All 119 patients underwent needle liver biopsy to determine grading and staging of liver disease, including the HBeAg-negative patients (n 38) with HBV DNA titers 10 4 and fluctuating ALT levels due to their long history of chronic HBV infection. Informed consent was obtained from all patients, and the protocol for the study was performed according to the principles of the Declaration of Helsinki and approved by the ethical committee of the city and state of Hamburg. Liver biopsy specimens were taken for histologic and molecular analysis. Biopsy specimens were stored at 80 o C until experimental analysis. Serologic and Histologic Analyses Blood samples were collected during the clinical visit, centrifuged, aliquoted, and stored frozen at 80 o C until evaluation. Serum aminotransferase levels were determined using a sequential multiple autoanalyzer. HBeAg and antibody to hepatitis B e antigen were tested using commercially available enzyme-linked immunosorbent assay kits (Sanofi Diagnostics Pasteur, Freiburg, Germany). The presence of HBsAg was determined using the AxSYM System (Abbott Diagnostics, Wiesbaden, Germany). Serum HBsAg were also quantified using a quantitative assay of electroimmunodiffusion (QIE, Laurell method). 5,11 The range of sensitivity is between 0.5 and 50 g/ml HBsAg. Serum samples with HBsAg levels 50 g/ml were diluted with phosphate-buffered saline for quantitative measurement. Serum HBV DNA levels were quantified as described earlier. 12 The assay detects HBV DNA using real-time fluorescent-probe polymerase chain reaction (TaqMan; Roche, Mannheim, Germany), with a lower limit of quantification of 100 HBV DNA genomes/ml. Histologic analysis was performed on the same needle liver specimens used for the molecular analysis. Inflammation and fibrosis in liver biopsy specimens were assessed using the Desmet score. 13 Immunohistologic staining for HBsAg and hepatitis B core antigen was performed on a Dako Auto-Stainer using the Dako Envision system (Dako, Hamburg, Germany) with rabbit polyclonal antibodies to hepatitis B core antigen (Dako) and monoclonal antibodies to HBsAg (Zymed, San Francisco, CA). 5 Extraction and Quantification of Intrahepatic HBV DNA and HBV RNA Forms A small piece of liver biopsy specimen that was not needed for histologic examination was used for nucleic acid extraction. To ensure that both RNA and DNA fractions contained the same cellular material, we used a combined volume-based and genomic DNA quantification procedure to normalize DNA and RNA contents. Cryopreserved specimens were first homogenized on ice using a Dounce homogenizer and RNeasy (Qiagen, Hilden, Germany) lysis buffer to ensure equal distribution of viral and cellular material, before the sample was divided into 2 equal parts and further processed for DNA and RNA purification. After ph adjustment and proteinase K digestion, DNA was isolated using the MasterPure DNA purification kit (Epicentre/Biozym, Oldendorf, Germany), and amplification was performed in the Light Cycler System (Roche Diagnostics, Mannheim, Germany) using HBV specific primers and fluorescence hybridization probes. After treatment with plasmid-safe deoxyribonuclease, cccdnaspecific primers were used for cccdna quantification. Serial dilutions of an HBV monomer plasmid (phbv- EcoR1) were used in duplicates as standard for HBV DNA and cccdna copy number determination. 4,5 HBV DNA standards, ranging from 2 10 1 to 2 10 7 genome equivalents, were run in parallel for each sample measurement. To normalize the number of viral copies present in a given sample, the number of cellular genomes was determined by using the -globin gene kit (Roche DNA Control Kit; Roche Diagnostics) 4 and the cell content was calculated by assuming that one human diploid cell contains approximately 6.6 pg of DNA. To estimate intrahepatic amounts of replicating virus (rcdna), total intracellular HBV DNA values were modified to exclude cccdna.

September 2007 HBV PRODUCTIVITY AND LOW VIREMIA 845 For RNA isolation, -mercaptoethanol was added to the remaining half of the homogenate and RNA was isolated according to the manufacturer s protocol, which also included a column deoxyribonuclease digestion step (RNeasy Extraction Kit; Qiagen). The quality of RNA samples was checked by using an Agilent Bioanalyzer (RNA 6000 Pico LabChip Kit, Agilent Technologies, Waldbronn, Germany). Complementary DNA synthesis was performed using the Transcriptor Kit with the recommended conditions and control RNA reaction (Roche Applied Science, Mannheim, Germany). Primers specific for HBV pgrna (2440-2421 5=-agattgagatcttctgcgac-3=) and total HBV RNA (418-401 5=-cagcaggatgaagaggaa-3=) were used for reverse transcription. Transcript-specific LightCycler polymerase chain reaction primers (pgrna, 2267-2287 ggagtgtggattcgcactcct; pgrna, 2440-2421 agattgagatcttctgcgac) and hybridization probes (2361-2380 gaggcaggtcccctagaaga-fl and 2384-2402 LC Red640-actccctcgcctcgcagac) were used for specific measurements of pgrna transcripts. The same primers designed for total HBV DNA measurements were used to quantify total HBV RNA levels (HBsAg specific plus pgrna). To determine amounts of reverse-transcribed pgrna and total RNA, the same plasmid phbv-ecori was used as standard. HBsAg messenger RNA amounts were estimated by subtracting pgrna values from the more abundant total HBV RNA amounts, which were also determined from the same liver biopsy sample. To rule out the presence of HBV DNA contamination in RNA isolates, aliquots of samples that were not reverse transcribed were amplified in parallel. For RNA normalization, quantification of the single copy gene -globin permitted us to determine the number of genomes (or cell number) in the liver biopsy homogenate and hence also in the fraction used for RNA analysis. Determination of HBV Genotype and PC/BCP Mutants HBV genotypes and PC/BCP mutants were determined using a line probe assay (INNO-LiPA HBV Genotyping Assay and INNO-LiPA HBV PreCore Kit; Innogenetics NV, Ghent, Belgium). cccdna isolated from the same biopsy samples was used as template for nested polymerase chain reaction, and samples were analyzed following the manufacturer s instructions. Statistical Analysis Data were analyzed using SPSS version 11 software package (SPSS Inc, Chicago, IL). The Spearman rank correlation was used for nonparametric correlations, and the Mann Whitney test was used for comparison of continuously distributed variables between 2 independent groups, while the 2 test and Fisher exact test were used for comparison of categorical variables. P values.05 were considered significant. Multivariate analysis was performed. All statistical tests were 2 sided. Results Patient Characteristics and Serologic Data The study included 42 HBeAg-positive and 77 HBeAg-negative individuals. There was a similar high prevalence of men (75%) in both groups. Table 1 summarizes the comparison of patients with or without detectable HBeAg. The median age differed significantly between HBeAg-positive and HBeAg-negative patients (32.5 and 40 years old, respectively; P.0001). ALT levels were generally higher in the HBeAg-positive patients (median, 2.1-fold vs 1.5-fold the upper limit of normal) compared with HBeAg-negative individuals, although differences were not significant (P.06). Histologic analysis of liver biopsy samples revealed that inflammation and fibrosis status ranged from 0 to 4 (Desmet score) but did not differ significantly between HBeAgpositive and HBeAg-negative individuals (Table 1). Serum HBV DNA levels were significantly lower in HBeAg-negative patients (median, 7 10 3 HBV DNA copies/ml; range, 100 to 4 10 8 copies/ml; P.0001) compared with levels detected in HBeAg-positive patients (median, 4.5 10 7 HBV DNA copies/ml; range, 100 to 4 10 9 ). Serum HBsAg concentrations were Table 1. Comparison of Patients With or Without Detectable HBeAg HBeAg HBeAg P Male/Total 31/42 58/77 ns Age (years) 32.5 (19 64) 40 (20 63) P.0001 Serum HBV-DNA (copies/ml) 4.5 10 7 ( 10 2 4 10 9 ) 7 10 3 ( 10 2 4 10 8 ) P.0001 ALT (ULN) 2.1 (0.4 15.8) 1.5 (0.3 13) P.064 HBsAg ( g/ml) 41 ( 0.5 324) 7.6 ( 0.5 62) P.0001 Intrahepatic Total HBV-DNA (copies/cell) 95 (0.6 2 10 3 ) 0.72 (0.036 73) P.0001 cccdna (copies/cell) 1.8 (0.008 54) 0.09 (0.001 15) P.0001 cccdna/tot.hbv-dna 2% (0.09 44%) 10.4% (0.05 100%) P.0001 HBsAg staining (% of cells) 30% (0 95) 10% (0 80) P.001 HBcAg staining (% of cells) 5% (0 90) 0% (0 20) P.0001 Grading (Desmet) 2 (1 3) 1 (0 4) ns (0.91) Staging (Desmet) 1 (0 4) 1 (0 4) ns (0.35)

846 VOLZ ET AL GASTROENTEROLOGY Vol. 133, No. 3 5-fold lower in HBeAg-negative patients compared with HBeAg-positive individuals (7.6 vs 41 HBsAg g/ml serum, respectively; P.0001) (Table 1), with 36% of HBeAgnegative patients having HBsAg concentrations ranging between 0.5 ng/ml and 0.5 g/ml and therefore below the limit of quantification by the Laurell test. Altogether, HBeAg-negative patients had significantly lower amounts of circulating virions ( 4 log) and subviral particles ( 0.5 log), which are usually present in large excess over virions in the blood of HBV-infected patients. Correlation Between Serum HBV DNA and Intrahepatic Viral Loads As shown in Table 1, real-time polymerase chain reaction analyses on liver biopsy samples revealed that HBeAg-positive patients had significantly higher levels ( 2 log; P.0001) of intrahepatic total HBV DNA (median, 95 copies/cell; range, 0.6 2 10 3 copies/cell) compared with HBeAg-negative patients (median, 0.72 copies/ cell; range, 0.04 73 copies/cell). Intracellular cccdna levels were also significantly lower in HBeAg-negative patients ( 1 log; P.0001). Median cccdna was 1.8 copies/cell (range, 0.008 54 copies/cell) in HBeAg-positive patients, with 62% of them harboring 1 cccdna copy per cell. In contrast, a median 0.09 cccdna copies/ cell (range, 0.001 15 copies/cell) were detected in HBeAgnegative patients, with only 4 of 77 patients (5%) harboring 1 cccdna copy per cell. Considering that hepatocytes constitute 50% 70% of the cells found in the liver, median cccdna copy number would be approximately 3 copies per hepatocyte in HBeAg-positive and 1 copy every 5 7 hepatocytes in the liver of HBeAg-negative patients. We found a strong correlation between intrahepatic amounts of replicating virions (rcdna/cell) and viral titers measured in the serum of the same individuals (r 0.78; P.0001) (Figure 1A). This correlation remained significant also when the 2 HBeAg groups were analyzed separately (P.001 for both groups), suggesting that export rates were similar. Of note, a moderately good and highly significant correlation was also found between intrahepatic amounts of cccdna and viral titers measured in HBeAg-positive patients (r 0.64; P.0001). However, viral titers did not correlate with cccdna amounts when the same analysis was performed in HBeAg-negative patients (r 0.23; P.05) (Figure 1B). cccdna levels per cell were also negatively correlated with age for HBeAg-positive patients (r 0.46; P.002) but not for HBeAg-negative individuals (r 0.18; P.11). Virion Productivity Is Significantly Reduced in Most HBeAg-Negative Patients We estimated that each cccdna gave rise to 10 intrahepatic replicating HBV DNA molecules (median, 9 rcdna copies/cccdna) in HBeAg-negative individuals Figure 1. Relationship between viral titers and intrahepatic viral loads in HBeAg-positive and HBeAg-negative patients. Correlation between HBV DNA in serum and amounts of (A) intrahepatic rcdna per cell or (B) intrahepatic cccdna per cell. Dots represent single patient measurements. Open dots represent HBeAg-negative (n 77) and closed dots represent HBeAg-positive patients (n 42). Linear regression lines were determined by Pearson correlations. In B, correlations are displayed separately (solid line for HBeAg positive and dashed line for HBeAg-negative patients). r (Spearman rank) and P values are indicated. (n 77), presuming that all cccdna molecules were transcriptionally active, while more than 5-fold higher amounts of replicating virus (median, 49 rcdna copies/ cccdna; P.0001) were produced per cccdna in HBeAg-positive individuals (n 42) (Figure 2A). The ratios of cccdna to intracellular total HBV DNA also showed a significantly higher proportion (P.0001) of intracellular HBV DNA in the form of cccdna among HBeAg-negative patients (median, 10.4%; range, 0.05% 100%) compared with HBeAg-positive patients (median, 2%; range, 0.09% 44%) (Table 1). To determine whether virion productivity correlated with steady-state levels of pgrna, simultaneous extraction of DNA and RNA was performed on 60 of 119

September 2007 HBV PRODUCTIVITY AND LOW VIREMIA 847 Figure 2. HBeAg-negative patients have significantly lower viral productivity. (A) Intrahepatic levels of rcdna per cccdna in the liver of HBeAg-positive (n 42) and HBeAg-negative patients (n 77). (B) Ratios of pgrna to cccdna measured in random liver biopsy specimens from 17 of 42 HBeAg-positive and 43 of 77 HBeAg-negative patients. Median levels are indicated by bars and were 49 versus 9 rcdna/cccdna and 214 versus 38 pgrna/cccdna in HBeAg-positive and HBeAg-negative patients, respectively. Dots represent single patient measurements. (C) Relationship between intrahepatic amounts of pgrna and rcdna measured in each liver biopsy sample. Linear regression lines were determined by Pearson correlations. r and P values are indicated. random liver biopsy samples from 17 HBeAg-positive and 43 HBeAg-negative patients. As shown in Figure 2B, ratios of pgrna to cccdna molecules showed that significantly lower levels of pgrna were measured in the liver of HBeAg-negative individuals (median, 38 vs 214 pgrna/cccdna; P.008). We also found a good and highly significant correlation (r 0.77; P.0001) between steady-state amounts of viral pgrna and HBV DNA copy number (rcdna) synthesized in the same liver biopsy specimen (Figure 2C), providing further evidence that the lower amounts of pgrna detected per cccdna accounted for the reduced virion productivity determined in HBeAg-negative individuals. Immunohistologic staining showed that a significantly lower proportion of hepatocytes stained positive for HBsAg (median, 10%; range, 0 80%) in liver sections from HBeAg-negative patients compared with HBeAgpositive individuals (median, 30%; range, 0 95%) (Table 1). In general, the proportion of HBsAg-positive stained cells tended to increase with cccdna load (P.003). However, because 23 of 119 patients stained negative for HBsAg despite detectable rcdna in the liver, histologic staining appeared to be less effective in detecting low levels of HBV replication. Hepatitis B core antigen positive staining was detected in 74% of HBeAg-positive (median, 5%; range, 0 90%) but only in 3 HBeAg-negative patients (median, 0%; range, 0 20%). Relationship Between Levels of pres/s RNAs and Serum HBsAg To investigate whether the production of serum HBsAg is impaired in HBeAg-negative patients, we first calculated ratios of HBsAg concentrations in serum to cccdna in the liver. Interestingly, we found no statistically significant difference between concentrations of serum HBsAg produced per cccdna molecule in HBeAg-positive and HBeAg-negative patients (median, 25 vs 70 g/ml, respectively; P.09) (Figure 3A). To determine steady-state levels of subgenomic pres/s Figure 3. Production and secretion of subviral particles is not impaired in HBeAg-negative patients. (A) Serum HBsAg concentrations normalized for cccdna contents measured in the liver of corresponding patients. Median values (bars) were 25 and 70 g/ml serum in HBeAg-positive and HBeAg-negative individuals, respectively. Each dot represents a single patient measurement. (B) Intrahepatic levels of subgenomic pres/s RNA per cccdna molecules determined in the same biopsy samples. Median values are 357 (HBeAg positive) versus 768 (HBeAg negative) pres/s RNA copies/cccdna.

848 VOLZ ET AL GASTROENTEROLOGY Vol. 133, No. 3 Figure 4. Relationship between HBsAg concentrations in serum and intrahepatic levels of cccdna. Box plots represent 3 groups of patients with different HBsAg concentrations as indicated. Shown are the 25th, 50th, and 75th percentiles of patients with log HBV cccdna copies/cell. Median cccdna levels were 0.07, 0.3, and 1.8 cccdna copies/cell in groups 1, 2, and 3, respectively. By applying the Mann Whitney test, we found that differences between groups were highly significant (group 1 vs 2, P.004; group 2 vs 3, P.0001). RNAs, we measured levels of total HBV RNA (pgrna pres/s RNA) and estimated pres/s RNA copy number by excluding pgrna amounts detected in the same liver biopsy specimen. As shown in Figure 3B, ratios of pres/s RNA to cccdna failed to reveal significant differences in steady-state levels of viral RNAs coding for the surface proteins (357 vs 768 pres/s RNA/ cccdna in HBeAg-positive vs HBeAg-negative patients, respectively; P.4), showing that the synthesis of envelope proteins, and hence of subviral particles, was not specifically diminished in HBeAg-negative patients. To determine whether serum HBsAg concentrations directly correlated with intrahepatic amounts of cccdna, HBsAg serum values determined by the Laurell test were grouped as follows: 0.5 to 15 (group 1; n 60), 15 to 35 (group 2; n 29), and 35 (group 3; n 26) g/ml of serum. The box plots in Figure 4 show the relationship between HBsAg concentrations in serum and cccdna amounts (log cccdna/cell) measured in liver biopsy samples of the corresponding patients. Median values were 0.07, 0.3, and 1.8 cccdna copies/cell in HBsAg groups 1, 2, and 3, respectively. By applying the Mann Whitney test, we found that differences between groups were highly significant (group 1 vs 2, P.004; group 2 vs 3, P.0001). Intrahepatic Analysis of HBV Genotypes and Distribution of PC/BCP Mutations To estimate the impact of different HBV genotypes and common mutations in the PC and BCP regions on efficiency of viral replication, cccdna molecules extracted from liver biopsy specimens were analyzed using INNO-LiPa assays. HBV genotypes were distributed as follows: 46% of patients had genotype D, 14% had genotype A, 3% had genotype B, 7% had genotype C, 3% had genotype E, and 1% had genotype G. Mixed genotypes, mainly A D, were also detected in 26% of patients. Concerning genotype distribution, we found that mixed genotypes were more likely to occur in HBeAg-negative patients (P.0003). Intrahepatic analysis of PC mutations revealed that 73% of HBeAg-negative patients and 34% of HBeAg-positive patients harbored cccdna molecules with the precore mutation PC G1896A (P.001). Similarly, single and double BCP mutations at the 1762/64 nucleotide positions were found in 69% of HBeAg-negative and 39% of HBeAg-positive patients (P.002). In general, HBeAgnegative individuals were more likely to exhibit mixed PC/BCP populations (P.005). Although we could not quantitatively determine the proportion of cccdna molecules harboring wild-type sequences both in the PC and BCP regions, wild-type cccdna populations were still detectable in 95% of patients, being below limit of detection ( 5% by INNO-LiPa assay) in only 6 biopsy samples from HBeAg-negative individuals. These 6 patients all had HBV with genotype D. In agreement with previous studies, 14,15 occurrence of PC mutations was less frequently observed in patients harboring exclusively cccdna with genotype A (P.001). Accumulation of BCP Mutations Leads to Reestablishment of High Viral Productivity To address the question whether replicative activity was affected by the presence of HBeAg variants, we compared virion productivity (rcdna/cccdna) between HBeAg-positive and HBeAg-negative patients harboring the same pattern of PC/BCP mutations (Figure 5A). In 18 HBeAg-positive patients (47%) and 12 HBeAg-negative patients (17%), only cccdna with wild-type sequences in the PC/BCP regions was detected. As shown in box plots, comparison of patients without emergence of these HBeAg variants (group 1) revealed that replicative activity was significantly lower (P.0001) in HBeAg-negative individuals, showing that viral production is impaired in HBeAg-negative patients without detectable BCP mutations and in general that these PC/BCP mutations are not responsible for reducing viral production. Similarly, median virion productivity in HBeAg-negative patients harboring mixed cccdna populations (groups 2, 3, and 4) was significantly lower (P.004) compared with HBeAg-positive patients displaying the same pattern of mutations. Of note, the 6 HBeAg-negative individuals

September 2007 HBV PRODUCTIVITY AND LOW VIREMIA 849 Figure 5. Accumulation of BCP mutations restores high viral productivity and increases viremia in HBeAg-negative patients. (A) Comparison of virion productivity (rcdna/cccdna) between HBeAg-positive and HBeAg-negative patients harboring the same pattern of PC/BCP mutations. Box plots show comparison of HBeAg-positive (white boxes) and HBeAg-negative (gray boxes) patients without emergence of HBeAg variants (group 1; P.0001), harboring cccdna pools with both wild-type and PC mutations (group 2) or with BCP variants (group 3) or with PC BCP mutants (group 4). Median virion productivity in HBeAg-negative patients in groups 2, 3, and 4 was significantly lower (P.004) compared with HBeAg-positive patients within the same groups. Among HBeAg-negative patients, significantly higher ratios (P.002) of rcdna to cccdna levels were found in 6 patients without detectable wild-type cccdna sequences in the PC and BCP regions (group 5). Shown are the 25th, 50th, and 75th percentiles of patients with log rcdna/cccdna. The number of patients in each group is indicated. (B) Comparison of log rcdna levels produced per cccdna among patients displaying similar viremia. Three groups of viremia ranges are indicated. Median rcdna/cccdna levels were 64 and 5.7 in group 1 (P NS), 59 and 10.6 in group 2 (P.014), and 36 and 70.6 in group 3 (P NS) by comparing HBeAg-positive (white boxes) and HBeAg-negative patients (light gray boxes), respectively. HBeAg-negative patients without detectable wild-type cccdna sequences in the PC and BCP regions are shown in groups 1 (n 1) and 2 (n 5, dark gray box) and had a median of 176 rcdna/cccdna. with no detectable wild-type PC/BCP populations (group 5) had significantly higher viral productivity than HBeAg-negative individuals containing only wild-type populations (P.001; median, 176 vs 6 rcdna/ cccdna), supporting in vitro data showing an increased production of progeny virions in BCP mutants. 9,16 Moreover, virion productivity in HBeAg-negative individuals harboring only PC/BCP variants was comparable to levels found in HBeAg-positive patients with wild-type sequences in PC/BCP regions (P.13; median, 49 rcdna/ cccdna in group 1), indicating that replacement of wildtype cccdna with populations of BCP mutations in HBeAg-negative individuals led to reestablishment of high virion productivity. Furthermore, we reasoned that patients with similar viremia but lower cccdna levels might display higher replicative activity to account for different cccdna contents. Therefore, we compared virion productivity (rcdna/cccdna) between HBeAg-positive and HBeAgnegative patients displaying similar viremia, also taking into account the impact of BCP mutations on viral productivity and viremia. As shown in Figure 5B, patients with similar viremia ranges were grouped as follows: 5 10 4 (group 1, low viremia), 5 10 4 to 5 10 7 (group 2, intermediate viremia), and 5 10 7 HBV DNA/mL (group 3, high viremia). Lower rcdna/cccdna levels were found in both HBeAg-negative patients with intermediate viremia (group 2; P.014) and with low viremia (group 1), although in the latter case statistical significance was not achieved due to uneven group distribution (see Figure 5B). As expected, the 6 HBeAgnegative individuals harboring exclusively BCP variants (n 1 in group 1, n 5 in group 2, dark gray box, Figure 5B) displayed significantly higher viral productivity (P.03; Figure 5B) compared with HBeAg-negative patients within the same viremia groups (1 and 2). Only 4 HBeAgnegative patients displayed high viremia levels (group 3) and reached levels of virion productivity comparable to HBeAg-positive patients. Although all 4 patients harbored BCP mutations, whether BCP variants were the predominant cccdna form in these few high viremic HBeAg-negative patients could not be investigated. Interestingly, replicative activity of HBeAg-positive patients was comparable (P.7) in all viremia groups, and an increase in cccdna contents accounted for the increase in viremia (P.001) (see also Figure 1B). Among HBeAgnegative patients, both a slight but significant increase in cccdna contents (P.02) and selection of BCP variants seem to contribute to enhancement of viremia. Multivariate analysis was performed to determine the dominant predictors of viral productivity log 10 (rcdna/ cccdna) in comparison with age, sex, mixed or single genotype, log 10 (HBV DNA/mL), presence of PC mutations with wild type or not, BCP mutations containing wild type or not, HBeAg status, and all interacting terms. The best model with an adjusted R 2 of 0.28 only contained log 10 HBV DNA/mL (B.06; P.08), BCP containing wild type or not (B 0.89; P.001), and the interaction term between HBeAg status and BCP wild type or not (B 0.44; P.03). Hence, multivariate analysis confirmed that viral

850 VOLZ ET AL GASTROENTEROLOGY Vol. 133, No. 3 productivity is higher for populations that are HBeAg positive. While maintaining some wild-type cccdna populations for the BCP, viral productivity decreases as viral titers decrease, but this is then offset by the BCP converting to a purely mutated population. This pattern reflects the trends observed in Figure 5. Discussion The development of sensitive molecular assays to monitor serologic and intrahepatic levels of HBV DNA has provided new tools to investigate the effectiveness of antiviral therapy, 4,5,17,18 viral kinetics, 19,20 and replicative activity in infected patients. 6,7 In agreement with other studies, 4 7 we confirmed on a larger number of patients (N 119) that lower viremia in HBeAg-negative patients is due to lower intrahepatic viral loads ( 2 log rcdna) and cccdna content ( 1 log) compared with HBeAgpositive patients. Moreover, we found a significantly higher proportion of intrahepatic viral DNA in the form of cccdna in HBeAg-negative individuals (10.4% vs 2% in HBeAg-positive patients), because median virion productivity (rcdna/cccdna) was more than 5-fold lower in HBeAg-negative individuals when normalized for cccdna contents. Analysis of independent variables such as age, sex, grading, staging, ALT levels, and ethnology of patients (Asian vs white), which may imply a different time of infection in life, ensured that differences in cccdna patterns and HBV replicative activity were not due to other patient characteristics but were mostly determined by the HBeAg status. Regardless of the HBeAg status, there was a good and highly significant correlation between steady-state amounts of virions produced in the liver (rcdna/cell) and levels of circulating virions in the same patients at the time of biopsy, as it may be expected if export is not impaired. Furthermore, correlations between cccdna levels and viral titers in HBeAg-positive patients suggested that HBV DNA is produced in proportion to the amount of cccdna present in the liver. Interestingly, no significant correlation was found between HBV DNA serum titers and cccdna amounts detected in the liver of HBeAg-negative patients, strongly indicating that viral productivity is impaired in the HBeAg-negative phase of chronic HBV infection. Quantitative measurements of HBV RNA transcripts obtained from the same liver biopsy specimens demonstrated that lower steady-state levels of pgrna found in HBeAgnegative patients accounted for the reduced virion productivity observed at the DNA level. Furthermore, the good correlation observed in all patients between pgrna and rcdna copy number showed that impairment of replicative activity in HBeAg-negative patients was not due to differences in reverse transcription efficiency. The lack of correlation found between HBV DNA serum titers and cccdna loads in the liver of HBeAgnegative patients supports the notion that measurement of viral titers in HBeAg-negative patients is not a good predictive marker of infection in the liver. Immunohistologic staining of HBsAg also appeared to be a weak marker of viral infection and activity, because HBsAg staining was negative in one third of HBeAg-negative liver biopsy samples, despite clear evidence of viral replication in most of those patients (73/77). Due to the huge excess of subviral particles over virions, detection of HBsAg in serum is a very sensitive indirect marker of ongoing infection. Although a relative wide range of HBsAg concentrations was determined per cccdna in individual patients, our analysis showed that HBsAg levels were significantly lower in the serum of HBeAg-negative patients and provided further evidence that lower intrahepatic cccdna levels correlated with lower HBsAg concentrations in serum. 5 Of note, pres/s RNA levels and HBsAg concentrations per cccdna molecule did not differ significantly between the 2 HBeAg groups, implying that the production of subviral particles was not impaired in the liver of HBeAg-negative patients. Sampling variations in HBsAg concentrations found in patients with similar cccdna contents measured in needle liver biopsy specimens could be due to both natural fluctuations in serum HBsAg concentrations and to possible uneven distribution of the cccdna in different parts of the liver. Furthermore, acquisition of viral DNA integrations in human livers during early stages of chronic infection has been reported, 21 and we cannot exclude that some hepatocytes containing HBV DNA integrants with an intact open reading frame of the viral surface proteins may contribute, to a certain extent, to the production of HBsAg. However, it is unlikely that this particular source of HBsAg production, in the absence of precancerous lesions favoring clonal expansion of such integrants, could account for the relatively high levels of subviral particles generally found in HBeAgnegative patients with reduced replicative activity. To investigate whether specific viral factors may account for the lower virion productivity observed in HBeAg-negative patients, HBV genotype distribution and presence of common PC/BCP mutations were determined at the cccdna level using the INNO-LiPA assays, which are more sensitive in detecting mixed DNA populations than direct sequencing. HBV genotype distribution differed significantly with HBeAg status, exhibiting more mixed genotypes in the HBeAg-negative group. However, because the great majority of patients (85%) analyzed harbored cccdna populations of genotype A, D, or A D, we cannot exclude that HBV productivity in HBeAg-negative patients harboring other HBV genotypes may be differently affected. 6 During the immune-competent HBeAg-positive phase, the host immune system may favor the selection of precore and core promoter variants with reduced or absent HBeAg productivity. 7,9,15,22 In agreement with previous studies, 23 our analysis revealed that most HBeAg-negative patients displayed mixed cccdna populations harboring

September 2007 HBV PRODUCTIVITY AND LOW VIREMIA 851 both wild-type and HBeAg variants. However, cccdna populations containing PC and/or BCP variants were found also in 53% of HBeAg-positive patients, indicating that variants with down-regulated or absent production of HBeAg are strongly selected in the immune-competent HBeAg-positive phase. Surprisingly, impairment in virion productivity was not linked to the presence of common PC/BCP variants, because HBV replicative activity was mostly reduced in HBeAg-negative patients without PC/ BCP mutations. Of note, the loss of cccdna molecules wild-type for the PC/BCP regions was achieved in only 6 HBeAg-negative patients and was significantly associated with higher replication levels, higher ALT levels, and grading. Although functional consequences of these mutations remain unclear, these findings support previous observations indicating that BCP mutations are associated with worsening of clinical manifestations and development of hepatocellular carcinoma. 24 Experiments with HBV-replicating transgenic mice and chimpanzees have shown that inflammatory cytokines can suppress viral replication through noncytolytic mechanisms. 25,26 Whether the lower steady-state levels of pgrna are due to immune-mediated noncytolytic mechanisms or to reduced transcriptional activity of the cccdna remains to be elucidated. Epigenetic factors 27 may also be responsible for the reduced viral production observed in the HBeAg-negative phase. In summary, this study showed for the first time that significantly lower virion productivity observed in most HBeAg-negative patients was not accompanied by a similar impairment in HBsAg production, indicating that production of viral and subviral particles may be differently regulated in the course of chronic HBV infection. Understanding of factors affecting replicative activity in HBeAg-negative patients may help disclose mechanisms of viral clearance and hence assist in the design of new therapeutic strategies aimed at silencing and eventually depleting the cccdna reservoir. References 1. Wu TT, Coates L, Aldrich CE, et al. In hepatocytes infected with duck hepatitis B virus, the template for viral RNA synthesis is amplified by an intracellular pathway. Virology 1990;175:255 261. 2. Zoulim F. New insight on hepatitis B virus persistence from the study of intrahepatic viral cccdna. J Hepatol 2005;42:302 308. 3. Dandri M, Lutgehetmann M, Volz T, et al. Small animal model systems for studying hepatitis B virus replication and pathogenesis. Semin Liver Dis 2006;26:181 191. 4. Werle-Lapostolle B, Bowden S, Locarnini S, et al. Persistence of cccdna during the natural history of chronic hepatitis B and decline during adefovir dipivoxil therapy. Gastroenterology 2004; 126:1750 1758. 5. Wursthorn K, Lutgehetmann M, Dandri M, et al. Peginterferon alpha-2b plus adefovir induce strong cccdna decline and HBsAg reduction in patients with chronic hepatitis B. Hepatology 2006; 44:675 684. 6. Wong DK, Yuen MF, Yuan H, et al. Quantitation of covalently closed circular hepatitis B virus DNA in chronic hepatitis B patients. Hepatology 2004;40:727 737. 7. Laras A, Koskinas J, Dimou E, et al. Intrahepatic levels and replicative activity of covalently closed circular hepatitis B virus DNA in chronically infected patients. Hepatology 2006;44: 694 702. 8. Gunther S, Piwon N, Will H. Wild-type levels of pregenomic RNA and replication but reduced pre-c RNA and e-antigen synthesis of hepatitis B virus with C(1653) T, A(1762) T and G(1764) A mutations in the core promoter. J Gen Virol 1998;79:375 380. 9. Tacke F, Gehrke C, Luedde T, et al. Basal core promoter and precore mutations in the hepatitis B virus genome enhance replication efficacy of Lamivudine-resistant mutants. J Virol 2004; 78:8524 8535. 10. Tong S, Kim KH, Chante C, et al. Hepatitis B virus e antigen variants. Int J Med Sci 2005;2:2 7. 11. Gerlich WH, Wend U, Glebe D. Quantitative assay of hepatitis B surface antigen in serum or plasma using Laurell electrophoresis. Methods Mol Med 2004;95:57 63. 12. Loeb KR, Jerome KR, Goddard J, et al. High-throughput quantitative analysis of hepatitis B virus DNA in serum using the TaqMan fluorogenic detection system. Hepatology 2000;32:626 629. 13. Desmet VJ, Gerber M, Hoofnagle JH, et al. Classification of chronic hepatitis: diagnosis, grading and staging. Hepatology 1994;19:1513 1520. 14. Rodriguez-Frias F, Buti M, Jardi R, et al. Hepatitis B virus infection: precore mutants and its relation to viral genotypes and core mutations. Hepatology 1995;22:1641 1647. 15. Chu CJ, Keeffe EB, Han SH, et al. Prevalence of HBV precore/ core promoter variants in the United States. Hepatology 2003; 38:619 628. 16. Buckwold VE, Xu Z, Chen M, et al. Effects of a naturally occurring mutation in the hepatitis B virus basal core promoter on precore gene expression and viral replication. J Virol 1996;70:5845 5851. 17. Sung JJ, Wong ML, Bowden S, et al. Intrahepatic hepatitis B virus covalently closed circular DNA can be a predictor of sustained response to therapy. Gastroenterology 2005;128:1890 1897. 18. Wursthorn K, Buggisch P, Lutgehetmann M, et al. Temporary HBV resolution in an HIV-coinfected patient during HBV-directed combination therapy followed by relapse of HBV. Antiviral Ther 2006; 11:647 652. 19. Whalley SA, Murray JM, Brown D, et al. Kinetics of acute hepatitis B virus infection in humans. J Exp Med 2001;193:847 854. 20. Murray JM, Wieland SF, Purcell RH, et al. Dynamics of hepatitis B virus clearance in chimpanzees. Proc Natl Acad Sci U S A 2005; 102:17780 17785. 21. Brechot C. Pathogenesis of hepatitis B virus-related hepatocellular carcinoma: old and new paradigms. Gastroenterology 2004; 127:S56 S61. 22. Pawlotsky JM. The concept of hepatitis B virus mutant escape. J Clin Virol 2005;34(Suppl 1):S125 S129. 23. Hussain M, Chu CJ, Sablon E, et al. Rapid and sensitive assays for determination of hepatitis B virus (HBV) genotypes and detection of HBV precore and core promoter variants. J Clin Microbiol 2003;41:3699 3705. 24. Liu CJ, Chen BF, Chen PJ, et al. Role of hepatitis B viral load and basal core promoter mutation in hepatocellular carcinoma in hepatitis B carriers. J Infect Dis 2006;193:1258 1265. 25. Wieland SF, Spangenberg HC, Thimme R, et al. Expansion and contraction of the hepatitis B virus transcriptional template in infected chimpanzees. Proc Natl Acad Sci USA2004;101: 2129 2134. 26. Chisari FV. Rous-Whipple Award Lecture. Viruses, immunity, and cancer: lessons from hepatitis B. Am J Pathol 2000;156:1117 1132.

852 VOLZ ET AL GASTROENTEROLOGY Vol. 133, No. 3 27. Pollicino T, Belloni L, Raffa G, et al. Hepatitis B virus replication is regulated by the acetylation status of hepatitis B virus cccdnabound H3 and H4 histones. Gastroenterology 2006;130:823 837. Received March 21, 2007. Accepted June 11, 2007. Address requests for reprints to: Joerg Petersen, MD, 1. Medizinische Klinik und Poliklinik, Zentrum für Innere Medizin,Universitätsklinikum Hamburg-Eppendorf, Martinistr. 52, D - 20246 Hamburg, Germany. e-mail: joepeter@uke.uni-hamburg.de; fax: (49) 40-42803-8065. J.P. was supported by the Deutsche Forschungsgemeinschaft (Pe/ 608 2-5) and the European Union 6 th framework program (Virgil network of excellence). T.V. and M.L. contributed equally to this work, as did M.D. and J.P. The authors thank Prof H. Will for fruitful discussions of the data.