A microrna signature associated with chondrogenic lineage commitment

Supplementary data: A microrna signature associated with chondrogenic lineage commitment Behnaz Bakhshandeh, Masoud Soleimani, Seyed Hassan Paylakhi and Nasser Ghaemi J. Genet. 91, xx xx Cell culture Briefly, 5 ml of cord blood, with informed consent of the mothers, was laid over 1.077 g/ml Ficoll-Hypaque (Pharmacia Biotech, Piscataway, USA) gradient and centrifuged at 400 g for 25 min. Mononuclear cells were then separated and cultured in low glucose Dulbecco s modified Eagle s medium (DMEM, GIBCO-BRL, Grand Island, USA) supplemented with 30% foetal bovine serum (FBS, Gibco), dexamethasone (100 nm; Sigma), L-glutamine (2 mm; Gibco), penicillin (100 U/mL; Gibco), and streptomycin (0.1 mg/ml; Gibco) under humidified atmosphere of 95% air with 5% CO 2 at 37 C. The colonies of USSCs appeared after almost two weeks. When cells reached 80% confluency, they were detached with 0.25% trypsin-edta (Gibco) and replated 1:3. Cells were diluted to 1 million cells per vial and frozen in FBS (Gibco) plus 10% dimethyl sulphoxide at a controlled rate to 70 C by using a cell freezer box. Cell stocks were transferred to liquid nitrogen storage after 24 h. In chondrogenic differentiation process, tube caps were loose for air circulation. Half of the differentiation medium was changed every 2 3 days for 21 days. mirna transfection procedure 1. We spotted 0.5 μl mirna mimic or inhibitor in 2 μl of RNAase-free water into a single well of a 96-well plate (this will give a final mirna mimic concentration of 5 nm or a final mirna inhibitor concentration of 50 nm after addition of cells to complexes in step 4). 2. Then we added 0.75 μl of transfection reagent to 24.25 μl of culture medium without serum. In continuation, we included the diluted transfection reagent to the prespotted mirna mimic/inhibitor. 3. Incubation for 5 10 min at room temperature (15 25 C) to allow formation of transfection complexes was done. 4. After that 2 10 4 cells in 175 μl ofgrowthmedium (containing serum and antibiotics) were seeded into the well, on top of the mirna mimic/inhibitor reagent transfection complexes and incubated under mild shaking for 6 h. Finally we changed the medium with fresh growth medium till 72 h. PCR details Standard procedure for PCR: denaturation at 94 C for 15 s, annealing at 53 61 C for 30 s according to the primers, and extension at 72 C for 45 s. The number of cycles varied between 30 and 40, depending on the abundance of particular mrna. Reaction mixtures for PCR included 2.5 μl cdna, 1 PCR buffer (AMS TM, Cinnagen, Iran), 200 μm dntps, 0.5 μm of each of forward and reverse primers and 1U Taq DNA polymerase (Fermentas, USA). Amplified DNA fragments were electrophoresed on 2% agarose gel. The gels were stained with ethidium bromide (10 μg/ml) and photographed on a UV trans-illuminator (uvidoc). Journal of Genetics, Vol. xx, No. x, Month 2012 1

Primers used for RT-PCR and mirna qpcr. Primer sequences Gene Sense, top; antisense, bottom T m ( C) HPRT CCT GGC GTC GTG ATT AGT G 58 TCA GTC CTG TCC ATA ATT AGT CC ACAN AAG ACG GCT TCC ACC AGT G 54.6 AAA GAC CTC ACC CTC CAT CTC COL2A1 GCC TGG TGA TGA TGG TGA AG 54.8 GCC TGG ATA ACC TCT GTG AC SOX9 GCA GGA GGA GAA GAG AAG G 52 GAG GCG AAT TGG AGA GGA G BMP6 CTC GGG GTT CAT AAG GTG AA 53.7 ACA GCA TAA CAT GGG GCT TC TFGbR GCA ATG GGC TTA GTA TTC TG 58 CAT TAC TCT CAA GGC TTC ACA G NLK CCT CAT AAA CAG CCA TCT CTT C 59 ATA TCG TAG TCG CCC TTC ATC mir-1268 CGGGCGTGGTGGT 55.7 mir-630 AGTATTCTGTACCAGGGAAGGT 54.9 mir-376a ATCATAGAGGAAAATCCACGT 51.2 mir-624 GCACAAGGTATTGGTATTACCT 52.4 Fold change calculation For additional information about the chip, please see: http://www.chem.agilent.com/en-us/store/_layouts/agilent/ Commerce/ProductDetail.aspx?productID=G4470B&cat= mirna&pcat=dnamicroarrayssub&rcat=dnamicroarrays. Briefly, 500 ng of total RNA from each sample were chemically labelled by dephosphorylating using calf intestinal alkaline phosphatase (CIP) and ligating cyanine3-pcp by a T4-RNA ligase using Agilent mirna Complete Labelling and Hyb kit (p/n5190 0456). Labelled samples were dried and resuspended in 18 μl of nuclease-free water and cohybridized with in situ hybridization buffer (Agilent) for 20 h at 55 C and washed at room temperature for 5 min in Gene Expression Wash Buffer 1 (Agilent) and 5 min at 37 C in Gene Expression Wash Buffer 2 (Agilent). We calculated the fold change in the following way: FC = sign (LR) 2 LR, where LR, log 2 ratio = log 2 (condition2/condition1): condition1 or 2 corresponding to the mean of the replicates for their respective conditions; sign (LR), sign of the log 2 ratio;, multiplies;, exponent (power); LR, absolute value of the log 2 ratio. DIANA-mirPath web-based computational tool performs an enrichment analysis of multiple mirna target genes (predicted by different algorithms, i.e. DIANA-microT 3.0, PicTar, TargetScan5) comparing each set of mirna targets to all known KEGG pathways (http://diana.cslab. ece.ntua.gr/). To acquire specific pathways particularly controlled by highest altered mirnas, in silico analysis between the eight top modulated mirnas (mir-143, mir-145, mir-188 5p, mir- 221, mir-376a, mir-376c, mir-630 and mir-377) targets and the most common signalling pathways by using DIANAmir- Path was performed. Figure 2 shows the number of genes targeted by each mirna, the union bar indicates the sum of all genes belonging to a specific pathway predicted to be targeted by the eight considered mirnas. As revealed, genes putatively interacting with these mirnas were found to be mostly involved in some specific signalling pathways including TGF-beta, Wnt, MAPK, ErbB, mtor, p53, GnRH, Notch, Insulin, and other pathways such as adipocytokine, melanogenesis, axon guidance, dorsa-ventral axis formation, cell adhesion molecules, adherens junction, tight junction, focal adhesion, regulation of actin cytoskeleton, ubiquitin mediated proteolysis and cell cycle. 2 Journal of Genetics, Vol. xx, No. x, Month 2012

Figure 1. Journal of Genetics, Vol. xx, No. x, Month 2012 3

Figure 2. Gene ontology The last in silico analysis to illuminate the molecular and cellular mechanisms of chondrogenesis was gene ontology (GO). Based on our findings, 32 GOs were classified on the basis of targets of the 60 top modulated mirnas. Shown in this figure, more than half of target genes of these mirnas were involved in protein binding, transferase activity, metal ion binding, hydrolase activity and nucleotide binding. All cellular mechanisms in GO annotation are divided into three major groups: cellular component, molecular function and biological process. Most of the annotated GOs involved in chondrogenesis belonged to binding or activity subgroups of molecular function group. This finding is in congruence with the nature of differentiation process, which is mostly the consequence of alterations in molecular functions of the cell. Figure 3. Gene ontology based on chondrogenesis related micror- NAs. 4 Journal of Genetics, Vol. xx, No. x, Month 2012

Table 1. List of 60 mirnas and their FCs are in the selected area (FC>3orFC< 3). Standard mirna Average FC deviation hsa-mir-100 3.02696 0.037265 hsa-mir-103 3.35768 hsa-mir-10b 3.07584 0.222548 hsa-mir-1185 3.59495 hsa-mir-1207-5p 4.128908 0.405995 hsa-mir-1225-3p 3.561872 0.217463 hsa-mir-1225-5p 4.805859 0.22927 hsa-mir-1228 3.258105 hsa-mir-1246 4.441199 0.40673 hsa-mir-1265 50.35625 hsa-mir-1268 20.84915 0.276272 hsa-mir-127-3p 3.00775 0.31791 hsa-mir-1274a 3.2 hsa-mir-1275 3.46149 0.205122 hsa-mir-1287 3.795 0.291645 hsa-mir-1290 6.388892 0.286554 hsa-mir-1306 3.25 0.365301 hsa-mir-130a 3.44979 0.226885 hsa-mir-139-3p 7.81545 hsa-mir-143 4.05566 0.435916 hsa-mir-145 3.74297 0.311982 hsa-mir-146a 3.49434 0.158473 hsa-mir-149 3.545871 hsa-mir-152 3.45 hsa-mir-155 3.00046 hsa-mir-16 3.01525 0.131476 hsa-mir-181a 3.371605 0.101744 hsa-mir-181b 3.050069 hsa-mir-181d 3.4 0.329126 hsa-mir-188-5p 8.595992 0.419512 hsa-mir-1915 7.303356 0.427945 hsa-mir-210 3.579726 0.243003 hsa-mir-221 4.51474 0.378457 hsa-mir-29b 3.10593 0.053065 hsa-mir-337-5p 3.0689 hsa-mir-365 3.39544 hsa-mir-374a 3.72961 hsa-mir-376a 4.89135 0.639909 hsa-mir-376a 3.00547 hsa-mir-376c 4.57688 0.63815 hsa-mir-377 4.50125 0.672487 hsa-mir-379 3.77914 0.237569 hsa-mir-490-5p 3.08144 0.137099 hsa-mir-515-5p 3.821597 hsa-mir-516a-5p 3.2494 hsa-mir-570 8.857679 hsa-mir-595 3.086211 0.204763 hsa-mir-613 7.568021 hsa-mir-623 3.5 0.335718 hsa-mir-624 76.52025 hsa-mir-630 15.76529 1.356392 hsa-mir-637 3.361374 hsa-mir-638 3.233647 0.140096 hsa-mir-654-3p 3.45632 hsa-mir-744 5.99377 hsa-mir-887 11.78641 hsa-mir-940 3.004555 hsa-mir-99b 3.171858 Journal of Genetics, Vol. xx, No. x, Month 2012 5

Table 2. Complete information about putative targets. Supplementary data, J. Genet. 91, xx xx Gene Putative target genes Pathway hsa-let7f FZD4 frizzled homologue 4 WNT signalling GALC galactosylceramidase GAG synthesis B3GNT1 UDP-GlcNAc:betaGal beta-1,3-n-acetylglucosaminyltransferase 1 GAG synthesis ACTR10 actin-related protein 10 homolog Actin cytoskeleton FARP1 FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 WNT signalling (chondrocyte-derived) PDGFB platelet-derived growth factor beta polypeptide MAPK signalling CALM1 calmodulin 1 (phosphorylase kinase, delta) Adherens Junction TGFBR1 transforming growth factor, beta receptor 1 TGF-beta signalling hsa-mir-130a BMPR2 bone morphogenetic protein receptor, type II TGF-beta signalling SMAD5 SMAD family member 5 TGF-beta signalling BMP3 bone morphogenetic protein 3 TGF-beta signalling TGFBR1 transforming growth factor, beta receptor I TGF-beta signalling WNT10A wingless-type MMTV integration site family, member 10A WNT signalling PDGFRA platelet-derived growth factor receptor, alpha polypeptide MAPK signalling SMAD4 SMAD family member 4 TGF-beta signalling SOX5 SRY-box 5 Cartilage formation PPARG peroxisome proliferator-activated receptor gamma PPAR signalling hsa-mir-143 MAP3K7 mitogen-activated protein kinase kinase kinase 7 MAPK signalling CHST10 carbohydrate sulfotransferase 10 Sulfation of chondroitin MAPK7 mitogen-activated protein kinase 7 MAPK signalling COL1A1 collagen, type I, alpha 1 Cartilage formation MAPK1 mitogen-activated protein kinase 1 MAPK signalling COL5A1 collagen, type V, alpha 1 Cartilage formation PDGFRA platelet-derived growth factor receptor, alpha polypeptide MAPK signalling SMAD3 SMAD family member 3 TGF-beta signalling CTNND1 catenin (cadherin-associated protein), delta 1 Adherens Junction COL5A2 collagen, type V, alpha 2 Cartilage formation ERBB3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 ERBB signalling hsa-mir-145 SOX9 SRY-box 9 Cartilage formation SOX11 SRY-box 11 Cartilage formation SMAD3 SMAD family member 3 TGF-beta signalling SMAD5 SMAD family member 5 TGF-beta signalling TGFBR2 transforming growth factor, beta receptor II TGF-beta signalling SMAD4 SMAD family member 4 TGF-beta signalling MAP4K4 mitogen-activated protein kinase kinase kinase kinase 4 MAPK signalling MAP2K4 mitogen-activated protein kinase kinase 4 MAPK signalling PDGFD platelet derived growth factor D MAPK signalling CDH2 cadherin 2, type 1 Adherens Junction CTNND1 catenin (cadherin-associated protein), delta 1 Adherens Junction P4HA1 procollagen-proline, 2-oxoglutarate 4-dioxygenase alpha Cartilage formation MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 MAPK signalling MAP3K3 mitogen-activated protein kinase kinase kinase 3 MAPK signalling MAP3K11 mitogen-activated protein kinase kinase kinase 11 MAPK signalling ERBB4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 ERBB signalling hsa-mir-181a TGFBRAP1 transforming growth factor, beta receptor associated protein 1 TGF-beta signalling TGFBR1 transforming growth factor, beta receptor I TGF-beta signalling TNFRSF11B osteoprotegerin MAPK signalling PCDHAC1 protocadherin alpha subfamily C, 1 Adherens Junction PCDHAC2 protocadherin alpha subfamily C, 2 Adherens Junction PCDHA1 protocadherin alpha 1 Adherens Junction PCDHA10 protocadherin alpha 10 Adherens Junction PCDHA11 protocadherin alpha 11 Adherens Junction PCDHA12 protocadherin alpha 12 Adherens Junction PCDHA13 protocadherin alpha 13 Adherens Junction PCDHA2 protocadherin alpha 2 Adherens Junction PCDHA3 protocadherin alpha 3 Adherens Junction PCDHA4 protocadherin alpha 4 Adherens Junction PCDHA5 protocadherin alpha 5 Adherens Junction PCDHA6 protocadherin alpha 6 Adherens Junction 6 Journal of Genetics, Vol. xx, No. x, Month 2012

Table 2 (contd).. (contd.). Gene Putative target genes Pathway PCDHA7 protocadherin alpha 7 Adherens Junction PCDHA8 protocadherin alpha 8 Adherens Junction PDGFRA platelet-derived growth factor receptor, alpha polypeptide MAPK signalling BMP3 bone morphogenetic protein 3 TGF-beta signalling SOX5 SRY-box 5 Cartilage formation MAP3K3 mitogen-activated protein kinase kinase kinase 3 MAPK signalling MAP3K7IP3 MAP kinase kinase kinase 7 interacting protein 3 MAPK signalling PDAP1 PDGFA associated protein 1 MAPK signalling NOTCH2 Notch homolog 2 Notch signalling MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1-like MAPK signalling BMPR2 bone morphogenetic protein receptor, type II TGF-beta signalling SMAD2 SMAD family member 2 TGF-beta signalling MADD MAP-kinase activating death domain MAPK signalling CDH13 cadherin 13 Adherens Junction ACAN aggrecan Cartilage Formation MAP3K10 mitogen-activated protein kinase kinase kinase 10 MAPK signalling PCDHB6 protocadherin beta 6 Adherens Junction MAP4K4 mitogen-activated protein kinase kinase kinase kinase 4 MAPK signalling hsa-mir-188 5p PCDH9 protocadherin 9 Adherens Junction MAP3K7IP3 MAP kinase kinase kinase 7 interacting protein 3 MAPK signalling MAP3K3 mitogen-activated protein kinase kinase kinase 3 MAPK signalling MAP2K4 mitogen-activated protein kinase kinase 4 MAPK signalling SMAD2 SMAD family member 2 TGF-beta signalling P4HB procollagen-proline, 2-oxoglutarate 4-dioxygenase beta Cartilage Formation MAP3K9 mitogen-activated protein kinase kinase kinase 9 MAPK signalling hsa-mir-376a BMPR2 bone morphogenetic protein receptor, type II TGF-beta signalling TGFBR1 transforming growth factor, beta receptor I TGF-beta signalling PCDH17 protocadherin 17 MAPK signalling hsa-mir-376c SOX11 SRY (sex determining region Y)-box 11 Cartilage formation CDH11 cadherin 11, type 2 Adherens Junction MAP3K7IP2 mitogen-activated protein kinase kinase kinase 7 interacting protein 2 MAPK signalling SOX4 SRY-box 4 Cartilage formation MADD MAP-kinase activating death domain MAPK signalling PCOLCE2 procollagen C-endopeptidase enhancer 2 Cartilage Formation PCDH11X protocadherin 11 X-linked Adherens Junction PCDH11Y protocadherin 11 Y-linked Adherens Junction MAP3K7 mitogen-activated protein kinase kinase kinase 7 MAPK signalling PCDH10 protocadherin 10 Adherens Junction SOX11 SRY-box 11 Cartilage formation hsa-mir-624 SMAD2 SMAD family member 2 TGF-beta signalling WNT5A wingless-type MMTV integration site family, member 5A WNT signalling PCDH19 protocadherin 19 Adherens Junction CTNNB1 catenin (cadherin-associated protein), beta 1 Adherens Junction hsa-mir-630 TOB2 transducer of ERBB2, 2 ERBB signalling GJC1 gap junction protein, gamma 1, 45kDa Gap junction PDGFRA platelet-derived growth factor receptor, alpha polypeptide MAPK signalling TGFBR2 transforming growth factor, beta receptor II TGF-beta signalling hsa-mir-1268 SOX12 SRY-box 12 Cartilage formation CAMK2G calcium/calmodulin-dependent protein kinase II Adherens Junction hsa-mir-29b COL3A1 collagen, type III, alpha 1 Cartilage formation COL4A5 collagen, type IV, alpha 5 Cartilage formation COL4A1 collagen, type IV, alpha 1 Cartilage formation COL7A1 collagen, type VII, alpha 1 Cartilage formation COL15A1 collagen, type XV, alpha 1 Cartilage formation COL2A1 collagen, type II, alpha 1 Cartilage formation COL4A6 collagen, type IV, alpha 6 Cartilage formation CSGALNACT2 chondroitin sulfate N-acetylgalactosaminyltransferase 2 Cartilage formation SOX12 SRY-box 12 Cartilage formation MAP2K6 mitogen-activated protein kinase kinase 6 MAPK signalling Journal of Genetics, Vol. xx, No. x, Month 2012 7

Table 2 (contd).. (contd.). Gene Putative target genes Pathway TGIF2 TGFB-induced factor homeobox 2 TGF-beta signalling SERPINH1 serpin peptidase inhibitor (collagen binding protein 1) Cartilage Formation NOTCH2 Notch homolog 2 Notch signalling PPARD peroxisome proliferator-activated receptor delta PPAR signalling hsa-mir-221 CHSY1 chondroitin sulfate synthase 1 Sulfation of chondroitin CAMKK1 calcium/calmodulin-dependent protein kinase kinase 1, alpha Adherens Junction ERBB4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 ERBB signalling SOX11 SRY -box 11 Cartilage formation ACVR2B activin A receptor, type IIB TGF-beta signalling MAPK10 mitogen-activated protein kinase 10 MAPK signalling PCDHAC1 protocadherin alpha subfamily C, 1 Adherens Junction PCDHAC2 protocadherin alpha subfamily C, 2 Adherens Junction PCDHA1 protocadherin alpha 1 Adherens Junction PCDHA10 protocadherin alpha 10 Adherens Junction PCDHA11 protocadherin alpha 11 Adherens Junction PCDHA12 protocadherin alpha 12 Adherens Junction PCDHA13 protocadherin alpha 13 Adherens Junction PCDHA2 protocadherin alpha 2 Adherens Junction PCDHA3 protocadherin alpha 3 Adherens Junction PCDHA4 protocadherin alpha 4 Adherens Junction PCDHA5 protocadherin alpha 5 Adherens Junction PCDHA6 protocadherin alpha 6 Adherens Junction PCDHA7 protocadherin alpha 7 Adherens Junction PCDHA8 protocadherin alpha 8 Adherens Junction PCDHAC1 protocadherin alpha subfamily C, 1 Adherens Junction PCDHAC2 protocadherin alpha subfamily C, 2 Adherens Junction PCDHA1 protocadherin alpha 1 Adherens Junction PCDHA10 protocadherin alpha 10 Adherens Junction PCDHA11 protocadherin alpha 11 Adherens Junction PCDHA12 protocadherin alpha 12 Adherens Junction PCDHA13 protocadherin alpha 13 Adherens Junction PCDHA2 protocadherin alpha 2 Adherens Junction PCDHA3 protocadherin alpha 3 Adherens Junction PCDHA4 protocadherin alpha 4 Adherens Junction PCDHA5 protocadherin alpha 5 Adherens Junction PCDHA6 protocadherin alpha 6 Adherens Junction PCDHA7 protocadherin alpha 7 Adherens Junction PCDHA8 protocadherin alpha 8 Adherens Junction PDGFA platelet-derived growth factor alpha polypeptide MAPK signalling 8 Journal of Genetics, Vol. xx, No. x, Month 2012