Molecular Advances in MDS Alexey Aleshin MD, MBA Medical Oncology Fellow Stanford University
Learning Objectives Next Generation Sequencing MDS Genomics Hereditary MDS Future Directions
Genes, Genomes, Mutations Normal: ATCCCGACTTGCCTGTAAAATCCAAA Mutation: ATCCCGACTTGCCCGTAAAATCCAAA
Sequencing: Disruptive Technology Main Frame Mini Computer Personal Computer Gel Based Sequencing Sanger Sequencing Next Generation Sequencing
Sequencing Costs Have Plummeted Forbes, 2010
An Explosion in Genetic Knowledge Massive Genomics Research Thousands of genomic associations, many with clinical implications
Learning Objectives Next Generation Sequencing MDS Genomics Hereditary MDS Future Directions
Hematology / Oncology: An Imperfect Art 100% 75% 50% 25% 0% Response Rate (%) Trial-and-Error Oncology ý Treatment A Given limited ability to predict responders, doctors today practice trial-and-error medicine ý þ Treatment B Treatment C Adapted from: Spear et al. TRENDS in Molecular Medicine Vol.7 No.5 May 2001; PMC Nov 2006
The Solution: Personalized Medicine Personalized medicine refers to the tailoring of medical treatment to the individual characteristics of each patient [by the] ability to classify individuals into subpopulations that differ in their susceptibility to a particular disease or their response to a specific treatment. MDS-RARS MDS-EB1 tr- MDS Traditional Classification Genomic Classification Adapted from: Aleshin A et al. Neoplasia. 2010
Two Sides of Mutations
Two Sides of Mutations
MDS is Genetically Not One Disease
Mutations Cluster with MDS Subtype Adapted from: Cazzola et al, Blood 2013
How Do We Identify These Mutations? Panels vs Single Gene Panel 1. Test for Known Mutations Mutations discovered through GWAS, exome, WGS studies 2. Fast turn around time
Molecular Diagnostics in MDS Possible Uses Support / Refine Diagnosis MDS with ring sideroblasts when number of ring sideroblasts < 15% Risk Stratification Better refine risk for progression to AML or higher risk MDS Identify Potential Therapeutic Targets IDH2 mutations -> enasidenib (Idhifa) Monitor Disease over Time Identify evidence of clonal evolution Detect emergence of high risk clones
Support / Refine Diagnosis Adapted from: Kwok et al, Blood 2015
Risk Stratification (Different from Treatment Selection) Many mutations are PROGNOSTIC SF3B1 Mutated? Yes No GOOD PRONOSIS Neutral PROGNOSIS So far ONLY FEW are PREDICTIVE of treatment response del5q Present? Yes No Revlimid Will Likely Work Revlimid Less Likely to Work Adapted from: Malcovati et al, Blood 2015. Reagan et al, Blood 2016
Risk Stratification SF3B1 Mutation and Favorable Prognosis Blood. 2011 Dec 8; 118(24): 6239 6246.
Risk Stratification ASXL1 Mutation and Worse Prognosis Thol et al, JCO 2011
Disease Monitoring Adapted from: Da Silva-Coelho et al, Nature Communications. 2017
Treatment Selection Splicesome mutation -> H3B-8800 splicesome inhibitor SF3B1 -> trial of luspatercept del 5q - > lenalidomide Adapted from: Coombs et al, Nat Rev Clin Oncol. 2016
Learning Objectives Next Generation Sequencing MDS Genomics Hereditary MDS Future Directions
Two Sides of Genetics Hereditary
All Cancer is Genetic But only 10% is inherited
Hereditary Syndromes w/ Predisposition to MDS Familial MDS/AML syndromes Inherited Bone Marrow Failure Syndromes Familial cancer predisposition syndromes with increased risk for MDS/AML (BRCA1/2, TP53, etc) Disorders rare, but increasingly being recognized and tested for in clinic Adapted from: NCCN, V 1.2018
Benefits of Testing Modify cancer surveillance options and age of initial screening Suggest specific risk-reduction measures (e.g. considering early bone marrow transplant) Clarify and stratify familial cancer risks, based on gene-specific cancer associations, such as risk for colon cancer and sarcomas in Li-Fraumeni syndrome associated with TP53 mutations Offer treatment guidance (e.g. avoidance of radiation-based treatment methods for individuals with atp53 mutation) Identify other at-risk family members Provide guidance with new gene-specific treatment options and risk reduction measures as they emerge Ambry Genetics
Red Flags: If you or family member have one of these Pulmonary alveolar proteinosis Congenital deafness Hereditary lymphedema Skin and nail changes Sensorineural deafness Pulmonary fibrosis Neurofibromatosis Predisposition to opportunistic infections Multiple family members with MDS or AML Premature hair graying Thumb hypoplasia
Learning Objectives Next Generation Sequencing MDS Genomics Hereditary MDS Future Directions
From Bench to Bedside: New Clinical Workflow Patient Presents Tests Interpretation Treatment & Clinical Trial Options Personalized Treatment & Monitoring Plans OR OR Genetic testing fits seamlessly into current clinical workflow