Mina John Institute for Immunology and Infectious Diseases Royal Perth Hospital & Murdoch University Perth, Australia AIDSvaccine conference, 14 th September 2011
IMGT HLA database July 2011 >5000 class I alleles
Heterozygote & rare allele advantage 1,2 HLA B locus as dominant selection 3 HLA B alleles associated with HIV disease progression or viral load Good:HLA B57:01/03, B58:01, B8 B27:05, B B51, Bad: HLA B35px, B58:02 CD8 T cell escape and HLA associated viral diversity at population level 1.M.Carrington et al. Science 1999, 283:1748-52, 2. SL O Connor et al. Sci Transl Med.2010, 2:22ra18. 3. P Kiepiela et al. 2004 Nature 432:769-75
Preferential targeting gof Gag vs other proteins 1 Strongest contribution to early/acute CD8 T cell response 2 B57 escape T242N in Gag TW10 has replicative cost reverts after transmission to HLA B57 ve hosts. Leads to G248A and loss of B57 recognition 3 Crystal structure of HLA-B57 with a HIVpeptide, HLA- Bw4/Bw6-motif in α1 domain NCBI PubMed,Molecular Graphics Program Cn3D Start point/stabilises Helix 6 in p24 capsid & interaction with cyclophilin A for HIV infectivity 4 T242N (+219, 228) associated with cyclosporine resistance 5 1. JAM Borghans et al. PLoS ONE 2007, 2(9), 2. M.Altfeld et al PLoS Med 2006.3:e403. 3. A. Leslie et al. Nature Med 2004,10(3):282-9, 4. J Martinez-Picado et al. J Virol 2006,3617-23,5.M Brockman et al. J Virol 2007 81(22):12608-18.
Compound p genotypes KIR 3DS1/HLA Bw4 80I and KIR3DL1*h/y Bw4 80I and NK cell activation 1,2 Intrinsic properties of peptide binding Thymic education, larger pre cursor pool of naïve B57 specific CD8 T cells and greater cross reactivity to variants 3 Crystal structure of HLA-B57 with a HIVpeptide, HLA- Bw4/Bw6-motif in α1 domain Binding preference for tryptophan in F pocket: highly constrained at level of codon usage rsal Genetic Code TAT TAC TAA TAG Y stop Positive charge Negative charge TGT TGC TGA TGG C stop W 1.MP Martin et al. Nature Genetics 2001; 31:429-34, 2. MP Martin et al. 2007 Nature Genetics 39:733-40. 3.A Kosmrlj et al. Nature 465:350-4, CAT CAC CAA CAG H Q CGT CGC CGA CGG R
HLA B57/58:01 Strong, early broad gag responses: high constraint Primary TW10 escape : T242N Compensatory G248A, others Attenuated virus with poor RC and infectivity 1 HLA B27:05 Epitopes with dibasic N terminus eg KK10 (Mamu B*08) Immunodominant in acute infection: high constraint Clustered mutations 173, 264, 268 Late KK10 escape Fit virus with high replicative capacity 2 1. JAM Borghans et al. PLoS ONE 2007, 2(9), 2. A.D Kelleher et al. J. Exp. Med. 193:375 386.
J Fellay et al. Science 2007, 317(5840):944-7
F. Pereyra et al. Science 2010, 330:1551
3 UTR 263 variant and 35C/T SNP 240 250 260 270........................... Cw*0702 ATGTCTCCATCTCTGTCTCAAATTCATGGTGCACTGAGCTGCAA Cw*0701... Cw*0303...C...G... Cw*0304...C...G... Cw*0401...C...G... Cw*0501...C..T.C.-..T... Cw*0202...C..T.C.-..T... Cw*0602...C..T.C.-..T... Cw*0802...C..T.C.-..T.....T... Cw*1203...C..T.C.-..T... Cw*1601...C..T.C.-..T... Cw*1502...C..T.C.-..T... Cw*0102...C...G... Cw*1402...C...G... hsa-mir-148a -35 - T T T T T C C C C C C 263-Del disrupts mir-148a binding site 263-Ins= inhibition; 263-Del= escape S.Kulkarni et al. Nature 2011,472:495-8
The HLA-C 3 UTR of low expression alleles suppresses luciferase expression compared with 3 UTR of high expression alleles Sv4 LU 263-0 C del Non-complementarity to mir-148a Sv4 LU 263-0 C ins Complementarity to mir- 148a 200 200 hange of RL LU 150 150 p=0.00020002 Fold c 100 100 C*06:02 C*08:02 C*12:03 C*15:02 C*03:033 C*04:01 C*07:01 C*07:02 263-del 263-ins Transfected B721.221 cell lines S.Kulkarni et al. Nature 2011,472:495-8
263 del is associated with lower viral load in multivariate i t model dl Genotype OR p del/del vs ins/ins 0.33 2 10-14 B*27:05 vs others 0.34 3 10-6 B*57:01 vs others 0.21 1 10-12 B*57:03 vs others 0.01 3 10-5 B*58:01 vs others 0.27 9 10-4 C*14:02 vs others 0.26 1 10-4 N = 1301 ; del/del = 475; ins/ins = 826; B*27:05 = 98; B*57:01 = 138; B*57:03 = 20; B*58:01 = 30; C*14:01 = 39 S.Kulkarni et al. Nature 2011,472:495-8
3 UTR variation and HLA C expression? may enhance presentation of viral peptides to CTL?provide more ligand for KIR2D or other NK receptors to enhance effector CTL or NK responses to infected targets.?provide more ligand for inhibitory KIR2D receptors to reduce immune activation. S.Kulkarni et al. Nature 2011,472:495-8
B57 B8 B7 B35 B57 B35 B44 B44 B8 B7 B8 B7 B35 B7 B27 B8 B15 B44 B8 B8 B44 B8 B44 B27 B15 B27 B44 B57 B15 "Bummer of a birthmark, Hal" Translation of host specific effects to vaccines for all? Effect size in vivo?
M.John et al. J. Immunol. 2010;184;4368-4377
Pol Maximum likelihood tree Open & Blue circles US and Aust. Red circles Chinese Sm cohort Grey squares other B plasma donation associated Outbreak associated with plasma donation in rural China ~24 56% of polymorphism across Gag/Pol and Nef is HLA allele l specific T.Dong et al Blood. 2011,118(1):98-106
** AIDS vaccine conference P07.01. T Hertz at el. HLA Targeting Efficiency and Its Applications in Predictions of HIV Viral Load and HIV Disease Progression T.Hertz et al. J. Virol 2011;85(3):1310-21
Patr-B B 1701 1701 HLA-B*4202 Selective sweep of MHC alleles in chimps 1 Patr-B 2901 Patr-B 1401 Patr-B 0801 Patr-B 16011 Patr-B 1601 Patr-B 0401 -B*550201 HLA-B*550101 Pat atr-b 0802 Patr-B 1602 Patr-B 2402 Patr-B 2401 Patr-B 3001 HLA-B*27 270502 HLA-B B*5601 HLA- Patr-B 2202 Papa-B 02 HLA-B*2706 Patr-B 2201 Papa-B 03 Patr-B 2101 Patr-B 2303 In Exon 2 3 sequence phylogeny hl HLA B57/B58 alleles segregate with chimp MHC (B) alleles 2 Patr-B 1901 Patr-B 2302 Papa-B 01 Patr-B 2301 Papa-B 04 Patr-B 0501 Patr-B 0201 Patr-B 0502 Patr-B 1202 Patr-B 1301 Patr-B 2801 Patr-B 1101 Patr-B 1102 HLA-B*080101 Patr-B 0601 Patr-B 2701 HLA-B*390 *39010101 Patr-B 1702 Patr-B 1703 HLA-B*070201 HLA-B*8101 HLA-B*400201 HLA-B*570101 HLA-B*5702 HLA-B*180101 HLA-B*1503 HLA-B*5801 HLA-B*5802 HLA-B*370101 HLA B57/ B27 B27 and common chimp MHC bind conserved epitopes in SIVcpz/HIV 1 3 Patr-B 0701 HLA LA-B*5001 HLA-B*1512 Patr-B 25 Patr-B 2601 Patr-B 03 Patr-B 0302 Patr-B 2001 Patr-B 0101 Patr-B 1001 HLA-B*350201 1 2501 0301 Patr-B 0901 HLA-B*350801 HLA-B*530101 HLA-B*510101 1 HLA-B*52010 101 HLA-B*490 01 HLA-B*450 501 Patr-B 1801 HLA-B*4408 Mane e-b1 Mane-B4 Mane-B5 Mane-B7 Mane-B2 Mane-B6 Mane-B3 HLA-B*4102 HLA 0.02 1. N de Groot et al. PNAS 2002, 99(18):11748 53, 2.T.Hertz et al. J. Virol 2011;85(3):1310-21, 3. N de Groot, PNAS 2010, 107(34): 15175 80.
HLA B mediated protection in HIV derived from peptide binding characteristics, but may still have distinct effects on overall T cell responses HLA C locus protection from distinct mechanisms associated with post transcriptional transcriptional regulation HIV downregulation of HLA and sequence diversity reflects viral adaptation to these host factors in diverse HLA Targeting conserved elements across HIV SIV evolution in a vaccine may help immunogenicity for vaccinees with diverse HLA