Strain differentiation of Mycobacterium tuberculosis complex isolated from sputum of pulmonary tuberculosis patients

International Journal of Infectious Diseases (2009) 13, 236 242 http://intl.elsevierhealth.com/journals/ijid Strain differentiation of Mycobacterium tuberculosis complex isolated from sputum of pulmonary tuberculosis patients Said Abbadi a, *, G. El Hadidy a, N. Gomaa a, Robert Cooksey b a Microbiology and Immunology Department, Faculty of Medicine, Suez Canal University, Circuit Road, Ismailia 41111, Egypt b The Division of AIDS, STD, and TB Laboratory Research, Centers for Disease Control and Prevention, Atlanta, Georgia, USA Received 18 December 2007; received in revised form 2 June 2008; accepted 9 June 2008 Corresponding Editor: Sunit K. Singh, Hyderabad, India KEYWORDS Pulmonary tuberculosis; IS6110 RFLP; Spoligotyping Summary Objective: This study represents an early attempt to determine the diversity of Mycobacterium tuberculosis in Egypt, particularly of drug-resistant strains. Methods: We characterized 45 Mycobacterium tuberculosis complex isolates from sputum samples of Egyptian patients with pulmonary tuberculosis, in order to establish a database of strain types and antimicrobial susceptibility patterns. Results: One Mycobacterium bovis and 44 Mycobacterium tuberculosis (MTB) isolates were identified by PCR-restriction fragment length polymorphism (RFLP) analysis of the oxyr gene. Twenty-five (56.8%) of the 44 MTB isolates were susceptible in vitro to all anti-tuberculosis drugs tested; five (11.4%) were mono-resistant to isoniazid or streptomycin (four were resistant to streptomycin and only one was resistant to isoniazid) and 14 (31.8%) were resistant to more than one drug (multidrug-resistant, MDR). Among the 44 MTB isolates tested by RFLP analysis in this study, 40 different RFLP patterns were obtained. The number of IS6110 copies ranged from 5 to 16. Studying the IS6110 RFLP patterns indicated that the 44 isolates did not cluster together but were generally scattered. None of the 14 MDR isolates were clustered. Twenty-two different spoligotypes were identified among the 44 MTB isolates, of which 13 were unique. The remaining 31 isolates were grouped into nine clusters of strains sharing identical spoligotypes. Conclusions: We have demonstrated evidence of diversity among the drug-susceptible and resistant MTB strains. Continued surveillance for strains of MTB involved in pulmonary tuberculosis in Egypt, and especially for drug-resistant strains, is warranted. # 2008 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved. Introduction * Corresponding author. Tel.: +20 102416336. E-mail address: saidabbadi@hotmail.com (S. Abbadi). Epidemiologic studies of tuberculosis can be greatly facilitated by the use of strain-specific markers. Transposable 1201-9712/$36.00 # 2008 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.ijid.2008.06.020

Typing of M. tuberculosis isolates in Egypt 237 elements discovered in Mycobacterium tuberculosis (MTB) have been shown to be of great potential for use in strain identification. Transposable elements include insertion sequences (IS), which are small mobile genetic elements widely distributed in most bacterial genomes, carrying only the genetic information related to their transposition and regulation, and transposons, which are mobile genetic elements that also carry genes that encode phenotypic markers (e.g., antibiotic resistance). Key factors in the control of tuberculosis are rapid detection, adequate therapy, and contact tracing to halt further transmission. Recent developments in DNA technology and molecular biology have led to methods for the rapid detection of mycobacterial DNA by nucleic acid amplification. 1 These methods include: DNA fingerprinting, based on the polymorphism of the insertion sequence IS6110 among MTB complex strains, 2 ptbn12 fingerprinting based on the polymorphic GC-rich sequence (PGRS), 3 spoligotyping based on the analysis of polymorphisms in the DR (direct repeat) locus, 1 and variable-number tandem repeats (VNTR) typing. 4 Among these methods, IS6110 fingerprinting is the recommended standard primary genotyping method, 5 and this method has been used routinely worldwide. 6 Clinical isolates of MTB obtained from patients infected by the same strain of bacillus usually exhibit identical or very similar (with one band variation) IS6110 fingerprint patterns, and the patients are more often found to be epidemiologically linked. 7 Although IS6110 fingerprinting is the gold standard method of typing, its major limitation is that genotype clustering is not synonymous with epidemiologically defined clustering (patient patient link); it also has a low discriminating power for isolates with fewer than six copies of IS6110. In the case where the IS6110 is not definitive, mycobacterial interspersed repetitive unit variable number tandem repeat analysis (MIRU/VNTR) or spoligotyping is usually needed as a secondary method of typing. 4 These secondary typing methods have the advantage of being less time consuming as they are PCR-based. 8 Disadvantages of these methods are that they are labor intensive and that the hybridization patterns generated are often too complex to be computerized for standardization and analysis. Also, their discriminatory power is lower than that of IS6110 typing in high copy number isolates. The increased application of DNA fingerprinting has advanced the understanding of the dynamics of tuberculosis epidemiology. 9 The incidence of tuberculosis in a community is a function of both the rate at which latent M. tuberculosis infections are reactivated and the number of case contacts who develop primary tuberculosis. 10 Molecular typing has provided an insight into the impact of reinfection on recurrent tuberculosis in comparison to reactivation. 11 Molecular typing of MTB isolates has also proven to be a useful tool in confirming laboratory cross-contamination 12 and investigating nosocomial and institutional transmission. 13 Directly observed therapy (DOT) has been shown to decrease the incidence of active tuberculosis in the community and to reduce rates of drug-resistant tuberculosis. 10 DOT decreases tuberculosis transmission by providing greater certainty that patients with active tuberculosis will become non-infectious soon after initiation of therapy and by reducing the rate of relapse. The rapid improvement of community tuberculosis rates following the implementation of DOT suggests that a significant proportion of disease cases in these populations is as a result of recently transmitted infection rather than reactivation of long-standing latent tuberculosis. Such analyses also predict that the effective implementation of DOT in a community will greatly reduce recently transmitted tuberculosis, but will not have a significant short-term impact on the rates of tuberculosis stemming from reactivation of old disease. This study represents an early attempt to determine the diversity of M. tuberculosis in Egypt, particularly the drugresistant strains, consistent with efforts made in low-incidence countries. In this study we characterize M. tuberculosis complex (MTC) isolates from the sputum of patients infected with MTB from Egypt, in order to establish a database of strain types and antimicrobial susceptibility patterns. We demonstrate evidence of diversity among multidrugresistant (MDR) MTB and drug-susceptible MTB strains. Materials and methods Bacterial isolates Forty-five clinical isolates (one isolate per patient) were included in this study. All specimens were isolated from sputum samples from patients with pulmonary tuberculosis in the Suez Canal region of Egypt. Isolation and preliminary identification of MTB strains After concentration/decontamination of sputum samples by the NALC method (N-acetyl-L-cysteine), sputum cultures were done on Lowenstein Jensen (LJ) medium. Isolation and identification of MTC were performed as previously described. 14 Antimicrobial susceptibility testing Isolates of MTC were tested by the modified method of proportion as described by Kent and Kubica 14 using Middlebrook 7H10 agar plates containing rifampin (RIF), isoniazid (INH), streptomycin (STR), ethambutol (EMB), and pyrazinamide (PZA). The following critical concentrations were used: RIF 1.0 mg/ml, INH 0.2, 1.0, and 5.0 mg/ml, STR 2.0 and 10.0 mg/ml, EMB 5.0 mg/ml, and PZA 25.0 mg/ml. Molecular identification of MTB isolates DNA of suspected MTB isolates was extracted by the miniglass bead agitation procedure as previously described. 15 PCR amplification of IS6110 (MTB complex-specific) and IS1245 (Mycobacterium avium-specific) 16 was performed in a multiplex PCR assay. The multiplex PCR assay was performed on the purified DNA as follows: In a final volume of 25 ml, 1 ml of DNA template, 0.6 ml (5 mm) of each of the four primers, and 12.5 ml HotStar Taq Master Mix (Taq DNA polymerase, 10 Taq buffer, 3 mm MgCl 2, and 400 mm dntps; Qiagen, CA, USA) were added to 9.1 ml distilled water. The primers used to amplify a 123-bp fragment of IS6110 were: KDE1 (5 0 -CCT GCG AGC GTA GGC GTC GG) and KDE2 (5 0 -CTC GTC CAG CGC CGC

238 S. Abbadi et al. TTC GG). The primers used to amplify a 378-bp fragment of IS1245 were: MA1 (5 0 -CTT GCT GGA GGT GCT CGA CG) and MA2 (5 0 -GGA GGT GCC GTG CAG GTA GG). MTB strain H37Rv and M. avium ATCC 871031 were used as PCR controls. Thermocycling was done in a Gene-Amp PCR system 9700 Thermocycler (Perkin-Elmer Inc., CA, USA). PCR conditions were as follows: Initial denaturation at 96 8C for 15 min, then 35 cycles of denaturation at 96 8C for 30 s, annealing at 64 8C for 30 s, and extension at 72 8C for 30 s. A final extension at 72 8C for 7 min was done at the end of these cycles. PCR amplicons were electrophoresed through 2% agarose gel supplemented with 50 mg ethidium bromide, at 100 V for 1 h. DNA bands were visualized by UV transilluminator and compared to control strains. PCR-restriction fragment length polymorphism (RFLP) analysis of the oxyr gene Isolates were further characterized by PCR-RFLP analysis of the oxyr gene to differentiate between Mycobacterium bovis and M. tuberculosis within the MTB complex. A 548-bp segment of the oxyr gene was amplified as previously described, 17 using the following oligonucleotide primers: forward primer, 5 0 -GGT GAT ATA TCA CAC CATA-3 0 ; reverse primer, 5 0 -CTA TGC GAT CAG GCG TAC TTG-3 0. The following cyclic conditions were used for amplification of the oxyr gene: Denaturation at 96 8C for 5 min, 35 cycles of 30 s at 96 8C, 30 s at 57 8C, and 45 s at 72 8C, and a final extension for 6 min at 72 8C. DNA gel electrophoresis was done to test the amplification using 2% agarose gel under 100 V for 1 h. The PCR product (10 ml) was digested with 4 U of AluI (New England Biolabs, Beverly, MA, USA). The reaction mix included 12 ml water, 2.5 ml enzyme buffer, and 10 ml PCR product. A 100-bp marker was used as a ladder. Novex precast acrylamide gel (4 20%) was used for the gel electrophoresis for 3 h, at 100 V, using Tris-borate-EDTA (TBE) buffer cooled to 6 8C. Strain typing (IS6110 RFLP) Isolates of MTB were typed by the standard IS6110-RFLP method as described by van Embden et al. 5 Briefly, a 2 3- week-old subculture isolate in 7H9 broth was incubated overnight with cycloserine (1 mg/ml) at 37 8C. The sedimented cells were harvested into a 1.5 ml microcentrifuge tube and incubated for 20 min at 80 8C. Chromosomal DNA was isolated by disruption of the cells with siliconized glass beads as previously described. 15 Approximately 0.75 1.25 mg of genomic DNA was digested for 2 h with 10 U of pvuii (BRL Life Technologies Inc., Gaithersburg, MD, USA) and electrophoresed on 1.0% agarose gel overnight. The restriction fragments were transferred by vacuum blotting to a Hybond-N+ nylon membrane (Amersham Corp., Arlington Heights, IL, USA). Hybridization was carried out under stringent conditions with 247-bp IS6110 PCR fragment, using the Amersham ECL direct labeling and detection kit. Banding patterns on resulting autoradiographs were scanned and analyzed using molecular analysis software (Bio Image, Ann Arbor, MI, USA). 15 Spoligotyping Spoligotyping was performed as previously described by Kamerbeek et al. 18 The direct repeat (DR) region was amplified by PCR using primers derived from the DR sequence. The primers used were DRa (GGTTTTGGGTCTGACGAC) and DRb (CCGAGAGGGGACGGAAAC). Fifty microliters of the following reaction mixture were used for the PCR: 10 ng of DNA, 20 pmol each of primers DRa and DRb, each deoxynucleoside triphosphate at 200 mm, PCR buffer, and 0.5 U of Taq polymerase. The mixture was heated for 3 min at 96 8C and subjected to 20 cycles of 1 min at 96 8C, 1 min at 55 8C, and 30 s at 72 8C. The amplified DNA was hybridized to a set of 43 immobilized oligonucleotides, each corresponding to one of the unique spacer DNA sequences within the DR locus. The sequences of the oligonucleotides used are given in Table 1. These oligonucleotides were covalently bound to a hybridization membrane. The membrane (Biodyne C) was obtained from Pall Biosupport, Portsmouth, UK, and was activated as previously described. 18 For hybridization, 20 ml of the amplified PCR product were diluted in 150 ml of 2 saline-sodium phosphate-edta (SSPE) supplemented with 0.1% sodium dodecyl sulfate, and heat denatured. The diluted samples (130 ml) were pipetted into the parallel channels in such a way that the channels of the miniblotter apparatus were perpendicular to the rows of oligonucleotides deposited previously. Hybridization was done for 60 min at 60 8C. After hybridization, the membrane was washed as previouslydescribed. 18 Detectionof hybridizing DNA was done using a chemiluminescent ECL (Amersham) detection kit. The 43-digit binary result was converted into a 15-digit octal designation as previously described. 19 Results MTC was cultured from sputum samples of 45 patients with a presumptive diagnosis of pulmonary tuberculosis from the Suez Canal region. All isolates contained IS6110 based upon PCR amplification of a 123-bp region of the insertion element. Among the 45 human isolates, one was determined to be M. bovis and 44 were M. tuberculosis based on amplification of a 270-bp region of oxyr. Antimicrobial susceptibility testing Twenty-five (56.8%) of the 44 MTB isolates were susceptible in vitro to all anti-tuberculosis drugs tested; five (11.4%) were mono-resistant to INH or STR (four were resistant to STR and only one was resistant to INH) and 14 (31.8%) were resistant to more than one drug (MDR). The 14 MDR strains included six strains resistant to four drugs, three resistant to INH and RIF, three resistant to INH and STR, one resistant to INH, RIF, and EMB, and one resistant to INH, RIF, and STR (Table 2). Strain types (IS6110 RFLP) Among the 44 MTB isolates tested for RFLP analysis in this study, 40 different RFLP patterns were obtained (Table 3). The number of IS6110 copies ranged from 5 to 16 (Figure 1). Studying the IS6110 RFLP patterns indicated that the 44 isolates did not cluster together but were generally scattered. Eight isolates were clustered together in four patterns, two isolates each. These two pairs of isolates had more than 90% similarity but still had one difference in IS6110- hybridization band within each pair. All eight isolates were susceptible to all anti-tuberculosis drugs tested in this study,

Typing of M. tuberculosis isolates in Egypt 239 Table 1 Sequences of the oligonucleotides used in the study Space No. Oligonucleotide sequence Space No. Oligonucleotide sequence 1 ATAGAGGGTCGCCGGTTCTGGATCA 23 AGCATCGCTGATGCGTCCAGCTCG 2 CCTCATAATTGGGCGACAGCTTTTG 24 CCGCCTGCTGGGTGAGACGTGCTCG 3 CCGTGCTTCCAGTGATCGCCTTCTA 25 GATCAGCGACCACCGCACCCTGTCA 4 ACGTCATACGCCGACCAATCATCAG 26 CTTCAGCACCACCATCATCCGGCGC 5 TTTTCTGACCACTTGTGCGGGATTA 27 GGATTCGTGATCTCTTCCCGCGGAT 6 CGTCGTCATTTCCGGCTTCAATTTC 28 TGCCCCGGCGTTTAGCGATCACAAC 7 GAGGAGAGCGAGTACTCGGGGCTGC 29 AAATACAGCTCCACGACACGACCA 8 CGTGAAACCGCCCCCAGCCTCGCCG 30 GGTTGCCCCGCGCCCTTTTCCAGCC 9 ACTCGGAATCCCATGTGCTGACAGC 31 TCAGACAGGTTCGCGTCGATCAAGT 10 TCGACACCCGCTCTAGTTGACTTCC 32 GACCAAATAGGTATCGGCGTGTTCA 11 GTGAGCAACGGCGGCGGCAACCTGG 33 GACATGACGGCGGTGCCGCACTTGA 12 ATATCTGCTGCCCGCCCGGGGAGAT 34 AAGTCACCTCGCCCACACCGTCGAA 13 GACCATCATTGCCATTCCCTCTCCC 35 TCCGTACGCTCGAAACGCTTCCAAC 14 GGTGTGATGCGGATGGTCGGCTCGG 36 CGAAATCCAGCACCACATCCGCAGC 15 CTTGAATAACGCGCAGTGAATTTCG 37 CGCGAACTCGTCCACAGTCCCCCTT 16 CGAGTTCCCGTCAGCGTCGTAAATC 38 CGTGGATGGCGGATGCGTTGTGCGC 17 GCGCCGGCCCGCGCGGATGACTCCG 39 GACGATGGCCAGTAAATCGGCGTGG 18 CATGGACCCGGGCGAGCTGCAGATG 40 CGCCATCTGTGCCTCATACAGGTCC 19 TAACTGGCTTGGCGCTGATCCTGGT 41 GGAGCTTTCCGGCTTCTATCAGGTA 20 TTGACCTCGCCAGGAGAGAAGATCA 42 ATGGTGGGACATGGACGAGCGCGAC 21 TCGATGTCGATGTCCCAATCGTCGA 43 CGCAGAATCGCACCGGGTGCGGGAG 22 ACCGCAGACGGCACGATTGAGACAA and no transmission link was found among the eight patients whose isolates had clustered in four clusters. All MDR-TB isolates showed unique RFLP patterns. The 40 RFLP patterns were compared with those in a database containing more than 6000 distinct patterns at the Centers for Disease Control and Prevention, and no similarity was found with our isolates. Interestingly, when these 40 patterns were compared with 53 patterns previously isolated from the cerebrospinal fluid of patients with meningitis in Egypt, 20 only one pattern (pattern 6) was found to be very similar (this isolate was found to be MDR). None of the RFLP patterns found among the 25 isolates from pulmonary tuberculosis at Assiut University Hospital, Egypt, matched those found in our isolates. 21 Table 2 RFLP types according to the antimicrobial susceptibility patterns of the 44 tested Mycobacterium tuberculosis isolates from sputum samples of pulmonary tuberculosis patients in Egypt Resistance pattern No. of isolates RFLP patterns INH 1 32 STR 4 22, 30, 5, 16 RIF + INH 3 6, 15, 38 INH + STR 3 2, 5, 17 INH + RIF + STR 1 3 INH + RIF + EMB 1 39 INH + RIF + STR + EMB 6 7, 9, 10, 20, 21, 40 None 25 Multiple * Total 44 RFLP, restriction fragment length polymorphism; INH, isoniazid; STR, streptomycin; RIF, rifampin; EMB, ethambutol. * 21 RFLP patterns. Spoligotyping Twenty-two different spoligotypes were identified among the 44 MTB isolates (Figure 2), of which 13 were unique (Table 3). The remaining 31 isolates were grouped into nine clusters of strains sharing identical spoligotypes. The most common patterns, A and H, were found among 12 and four isolates, respectively. The spoligotype pattern G was observed in three isolates, while spoligotypes C, E, I, K, M, and S were observed for two isolates. RFLP clusters were not further subdivided by spoligotyping. Isolates from three of the RFLP clusters (RFLP patterns 21, 26, and 28) that contained two isolates were present in spoligotype pattern A (Table 3). A different spoligotype was found for the remaining RFLP cluster that contained two isolates. Nine RFLP patterns were found among isolates with the most common spoligotype (pattern A), and four RFLP patterns were found among the four isolates with spoligotype pattern H. Spoligotype patterns A and H were also found to be the most common patterns among 67 isolates from meningitis patients at six fever hospitals in Egypt. 20 Spoligotype patterns A, F, I, and J were also found in a collection of 25 isolates from pulmonary tuberculosis patients at Assiut University Hospital, Egypt. 21 Five spoligotypes (patterns A, F, H, I, and J) were present in the Rijksinstituut voor Volksgesondheit en Milieuhygiene international database (National Institute of Public Health and Environment, Bilthoven, the Netherlands). 6 These patterns were reported from one to 16 countries (but not from Egypt), and spoligotype patterns A and H were reported from the most countries (16 and 13 countries, respectively). Spoligotype patterns H and J were reported in the Rijksinstituut voor Volksgesondheit en Milieuhygiene database from three African countries, and patterns A and H were also reported from Iran. 6

240 S. Abbadi et al. Table 3 Spoligotypes of 44 Mycobacterium tuberculosis isolates from sputum of patients with pulmonary tuberculosis in Egypt Spoligotype Number of isolates Spoligotype a RFLP type(s) A b 12 777777777760771 1, 21 c, 25, 26 c, 27, 28 c, 38, 39, 40 B 1 777777367720771 2 C 2 777777377760771 9, 3 D 1 777777777740171 4 E 2 477677577760771 6, 19 F b 1 377777607760771 5 G 3 437777777760771 20, 7, 10 H b 4 777777607760771 8, 12, 32, 33 I b 2 703777740003171 31, 11 J b 1 776377777760771 13 K 2 777777607760751 14 L 1 037637767760771 15 M 2 770000777760771 16, 17 N 1 703777740003771 22 O 1 703777600003171 29 P 1 776367777760771 30 Q 1 777777601760771 24 R 1 777777347760471 35 S 2 777777777620771 23, 34 T 1 677777777413731 37 U 1 776377740000031 36 V 1 777737607760771 18 Total 44 40 RFLP, restriction fragment length polymorphism. a 15-digit octal code. b Types were found among Egyptian isolates isolated in previous studies. c Each RFLP pattern contained two isolates. Spoligotype pattern G included three isolates with three different RFLP patterns (Table 2); all of the three isolates were resistant to four anti-tuberculosis drugs (MDR). Discussion Figure 1 IS6110 RFLP patterns of 18 Mycobacterium tuberculosis isolates. (S, size standard.) Patients in this study were all from Suez Canal chest hospitals, which serve patients from all regions of the Suez Canal area. This makes our data a likely representation of the genetic makeup of strains throughout this region of Egypt. All of the 45 isolates in our study were obtained from cases under DOT. This and other treatment practices that could influence antimicrobial resistance do not differ from other regions in Egypt. Among the 45 MTC isolates from sputum samples obtained from the Suez Canal chest hospitals in Egypt, 44 were identified as MTB and one as M. bovis by PCR-RFLP analysis of oxyr. This finding suggests that M. bovis plays a minor role compared to MTB in the etiology of pulmonary tuberculosis in Egypt. We found 40 IS6110 RFLP patterns among the 44 MTB isolates tested. None of these patterns may be considered low-copy number (<5 bands). Nonetheless, eight isolates (18.2%) were in four RFLP clusters, two isolates each.incontrasttofindingsexpectedinthecommondiagnosis of pulmonary tuberculosis, no transmission links among clustered isolates obtained were found. One possible explanation for the absence of transmission links is that clustered isolates may have resulted from remote transmission of

Typing of M. tuberculosis isolates in Egypt 241 Figure 2 Spoligotypes from amplified mycobacterial DNA of purified Mycobacterium tuberculosis DNA from strain H37Rv (lane 1), purified Mycobacterium bovis from strain BCG (lane 2), and Mycobacterium tuberculosis DNA strains cultured from clinical specimens (lanes 4 40). strains endemic in the region throughout many years. Another factor that might support the idea of remote transmission is the implementation of DOT in this region; it is predicted that the effective implementation of DOT in a community will greatly reduce recently transmitted tuberculosis but will not have a significant short term impact on the rates of tuberculosis stemming from reactivation of old disease. 10 This low level of strain relatedness is consistent with rates reported by Cooksey et al., 20 who examined 67 MTB isolates from meningitis patients in Egypt. Among the 67 M. tuberculosis isolates, 53 unique strain types (with three to 16 copies of IS6110) were found by RFLP analysis. Nine clusters (eight with two isolates each and one with six isolates) were also found. Also, Abbadi et al. 21 studied 25 MTB isolates from Assiut, Egypt. They found 21 different RFLP patterns. However, our results contrast rather sharply withthehighdegreeofclusteringpreviouslyreportedintwo other regions of Africa. In Ethiopia and Tunisia, 52% and 62% of M. tuberculosis isolates studied, respectively, were found to belong to three or four genotypic families. 22 A high prevalence of clustering was also found in population-based studies from Botswana (42%) 23 and South Africa (45%). 24 Recent reports have described a cluster of extensively drug-resistant tuberculosis (XDR-TB) cases in the KwaZulu Natal province of South Africa. 25 In KwaZulu Natal, two distinct strains of XDR-TB were described among the 53 cases,bothofwhichareknowntobeendemictothearea. This indicates that multiple instances of de novo XDR development and transmission of resistant strains between individuals were occurring simultaneously. The explanation of this difference in genetic distance found in the KwaZulu Natalstudyandourstudyisthatmostoftheircases(44outof 53) were HIV-positive and severely immunocompromised, with a median CD4 count of 63 (range 9 283), while in our study, all cases were HIV-negative, and also our resistant strains were MDR not XDR. Strain identification by spoligotyping was less definitive than RFLP typing, since 31 of 44 isolates (70%) were in spoligotype clusters: three clusters with 12 isolates, four, and three isolates, respectively, and six clusters each with two isolates. However, these results agree with the results of Cooksey et al., 20 who found that 36 spoligotypes were observed among 67 MTB isolates from Egyptian meningitis patients. Five spoligotypes (A, F, H, I, and J) have already been reported in Egyptian isolates, 20 two of these spoligotypes represent the main two clusters found: type A (12 isolates) and type H (four isolates). Five out of the 14 (35.7%) MDR-TB isolates have been reported before in Egypt. 20 Four of these five isolates (80%) were clustered in type A spoligotype, which was reported previously as the most common type in Egypt. 20 This result may indicate that this is a virulent strain. The spoligotyping procedure, however, may be more easily implemented than RFLP in laboratories where no M.

242 S. Abbadi et al. tuberculosis typing capabilities are currently present. However, spoligotyping could produce clusters most similar to RFLP types when used in conjunction with MIRU-VNTR. 4 No clustering of resistant strains by RFLP analysis was observed among the isolates. Overall antimicrobial susceptibilities were similar to those reported among 857 MTC isolates at Abbasia Hospital from 1976 to 1996. 26 Less single drug resistance to RIF and INH was found among our isolates, compared to 150 isolates tested in the previous study. Fourteen out of 44 (31.8%) of our isolates were resistant to more than one drug, but none was related by RFLP analysis. The overall prevalence of resistance among these isolates was lower than that previously reported in 1996 by the National Tuberculosis Program (NTP) for pulmonary isolates. 27 Among 250 isolates tested in the NTP study, 55.2% were resistant, compared to 43.2% of our isolates. However, resistance to INH was more common among our isolates (15/44 (34.2%)) than among the NTP isolates (6.4%). Continued surveillance for strains of M. tuberculosis involved in pulmonary tuberculosis in Egypt, and especially for drug-resistant strains, is warranted. Conflict of interest: No conflict of interest to declare. References 1. Yule A. Amplification-based diagnostics target TB. Biotechnology (N Y) 1994;12:1335 7. 2. Cave MD, Eisenach KD, McDermott PF, Bates JH, Crawford JT. IS6110: conservation of sequence in the M. tuberculosis complex and its utilization in DNA fingerprinting. Mol Cell Probes 1994;5:73 80. 3. Chaves F, Yang Z, el Hajj H, Alonso M, Burman WJ, Eisenach KD, et al. Usefulness of the secondary probe ptbn12 in DNA fingerprinting of Mycobacterium tuberculosis. J Clin Microbiol 1996;34:1118 23. 4. Kwara A, Schiro R, Cowan LS, Wiser M, Kissinger P, Diem L, et al. Evaluation of the epidemiologic utilities of secondary typing methods for identification of M. tuberculosis isolates. J Clin Microbiol 2003;41:2683 5. 5. van Embden JD, Cave MD, Crawford JT, Dale JW, Eisenach KD, Gicquel B, et al. Strain identification of M. tuberculosis by DNA fingerprinting: recommendations for a standardized methodology. J Clin Microbiol 1993;31:406 9. 6. van Soolingen D, Borgdorff MW, de Haas PE, Sebek MM, Veen J, Dessens M, et al. Molecular epidemiology of tuberculosis in the Netherlands: a nationwide study from 1993 through 1997. J Infect Dis 1999;180:726 36. 7. Yang ZH, de Haas PE, van Soolingen D, van Embden JD, Andersen AB. Restriction fragment length polymorphism of M. tuberculosis strains isolated from Greenland during 1992: evidence of tuberculosis transmission between Greenland and Denmark. J Clin Microbiol 1994;32:3018 25. 8. Jasmer RM, Hahn JA, Small PM, Daley CL, Behr MA, Moss AR, et al. A molecular epidemiologic analysis of tuberculosis trends in San Francisco, 1991 1997. Ann Intern Med 1999;130:971 8. 9. Bifani PJ, Plikaytis BB, Kapur V, Stockbauer K, Pan X, Lutfey ML, et al. Origin and interstate spread of a New York City multidrugresistant Mycobacterium tuberculosis clone family. JAMA 1996;275:452 7. 10. Bishai WR, Graham N, Harrington S, Pope DS, Hooper N, Astembroski J, et al. Molecular and geographic patterns of tuberculosis transmission after 15 years of directly observed therapy. JAMA 1998;280:1679 84. 11. van Rie A, Warren R, Richardson M, Victor TC, Gie RP, Enarson DA, et al. Exogenous reinfection as a cause of recurrent tuberculosis after curative treatment. N Engl J Med 1999;341:1174 9. 12. Small PM, McClenny NB, Singh SP, Schoolnik GK, Tompkins LS, Mickelsen PA. Molecular strain typing of Mycobacterium tuberculosis to confirm cross-contamination in the mycobacteriology laboratory and modification of procedures to minimize occurrence of false-positive cultures. J Clin Microbiol 1993;31: 1677 82. 13. Dooley SW, Villarino ME, Lawrence M, Salinas L, Amil S, Rullan JV, et al. Nosocomial transmission of tuberculosis in a hospital unit for HIV-infected patients. JAMA 1992;267:2632 5. 14. Kent PT, Kubica JP. Public health mycobacteriology: a guide for the level III laboratory. US Department of Health and Human Services Publication No. 86-8230. Washington DC: US Department of Health and Human Services; 1985, p. 159 84. 15. McAdam RA, Hermans PW, van Soolingen D, Zainuddin ZF, Catty D, van Embden JD, et al. Characterization of a Mycobacterium tuberculosis insertion sequence belonging to the IS3 family. Mol Microbiol 1990;4:1607 13. 16. Kremer K, van Soolingen D, Frothingham R, Haas WH, Hermans PW, Martín C, et al. Comparison of methods based on different molecular epidemiological markers for typing of Mycobacterium tuberculosis complex strains: interlaboratory study of discriminatory power and reproducibility. J Clin Microbiol 1999;37: 2607 18. 17. Abbadi SH. Use of PCR-RFLP analysis of oxyr gene to differentiate between Mycobacterium tuberculosis and Mycobacterium bovis. Egypt J Med Microbiol 2001;10:809 13. 18. Kamerbeek J, Schouls L, Kolk A, van Agterveld M, van Soolingen D, Kuijper S, et al. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol 1997;35:907 14. 19. Dale JW, Brittain D, Cataldi AA, Cousins D, Crawford JT, Driscoll J, et al. Spacer oligonucleotide typing of bacteria of the Mycobacterium tuberculosis complex: recommendations for standardised nomenclature. Int J Tuberc Lung Dis 2001;5:216 9. 20. Cooksey RC, Abbadi SH, Woodley CL, Sikes D, Wasfy M, Crawford JT, et al. Characterization of Mycobacterium tuberculosis complex isolates from the cerebrospinal fluid of meningitis patients at six fever hospitals in Egypt. J Clin Microbiol 2002;40:1651 5. 21. Abbadi S, Rashed HG, Morlock GP, Woodley CL, El Shanawy O, Cooksey RC. Characterization of IS6110 restriction fragment length polymorphism patterns and mechanisms of antimicrobial resistance for multidrug-resistant isolates of Mycobacterium tuberculosis from a major reference hospital in Assiut, Egypt. J Clin Microbiol 2001;39:2330 4. 22. Hermans PW, Messadi F, Guebrexabher H, van Soolingen D, de Haas PE, Heersma H, et al. Analysis of the population structure of Mycobacterium tuberculosis in Ethiopia, Tunisia, and The Netherlands: usefulness of DNA typing for global tuberculosis epidemiology. J Infect Dis 1995;171:1504 13. 23. Lockman S, Sheppard JD, Braden CR, Mwasekaga MJ, Woodley CL, Kenyon TA, et al. Molecular and conventional epidemiology of Mycobacterium tuberculosis in Botswana: a population-based prospective study of 301 pulmonary tuberculosis patients. J Clin Microbiol 2001;39:1042 7. 24. World Health Organization. Global tuberculosis control. WHO Report WHO/CDS/TB/2001.287. Geneva, Switzerland: World Health Organization; 2001. 25. Gandhi NR, Moll A, Sturm AW, Pawinski R, Govender T, Lalloo U, et al. Extensively drug-resistant tuberculosis as a cause of death in patients co-infected with tuberculosis and HIV in a rural area of South Africa. Lancet 2006;368:1575 80. 26. Girgis NI, Sultan Y, Farid Z, Mansour MM, Erian MW, Hanna LS, et al. Tuberculosis meningitis, Abbassia Fever Hospital-Naval Medical Research Unit No. 3-Cairo, Egypt, from 1976 to 1996. Am J Trop Med Hyg 1998;58:28 34. 27. Moghazy E. National tuberculosis program report Epidemiological review and action plan. Cairo, Egypt: Egyptian Ministry of Health; 1997.