Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells [%] controls 15 1 5 Pten pc-/- n=4 n=3 n=3 n=3 n=4 n=4 n=3 n=3 n=3 n=5 n=4 n=3 n=3 n=3 n=4 n=4 n=3 n=3 n=3 n=2 controls T cells 3 months Tumor Pten pc-/- ** * *** * pc-/- n=6 n=3 n=4 n=5 n=4 T cells [%] 3 2 1 controls B cells [%] 2 15 1 5 Pten pc-/- controls B cells [%] B cells 3 months Tumor Pten pc-/- n=6 n=3 n=4 n=5 n=4 6 4 2 controls Pten pc-/- Macrophages [%] 4 3 2 1 4 2 controls Pten pc-/- SSC FSC FSC Gr-1 Macrophages [%] Macrophages 3 months Tumor controls Pten pc-/- n=4 n=3 n=5 n=5 n=4 FSC DAPI CD45.2 CD11b d CD11b CD11b CD11b 1 Nature Medicine: doi:1.138/nm.4463
Supplementary Figure 1. Infiltration of the immune cells in spleen and the prostate tissue of respective mouse models at 3 months of age. (a) Percentage of Gr- 1+/CD11b+ cells, T cells (CD3+), B cells (CD19+/B22+) and macrophages (CD11b+/F4/8+) in spleen of control mice and respective prostate tumor models at 3 months of age. (b) Percentage of T cells (CD3+), B cells (CD19+/B22+) and macrophages (CD11b+/F4/8+) in the tumor of control mice and respective prostate tumor models at 3 months of age. The number of mice analyzed for (a) and (b) is indicated in the figure. All data in (a) and (b) are represented as mean ± SEM. Values of p<.5 were considered statistically significant. *P<.5; **P<.1; ***P<.1 by twotailed unpaired Student s t-test. (c) Gating strategy used for our immune landscape analysis. (d) Gating strategy for Gr-1+/CD11b+ cells. Representative flow cytometry blots of Gr-1+/CD11b+ cells in the prostate, and mice at 3 months of age. 2 Nature Medicine: doi:1.138/nm.4463
F4/8 CD4 FoxP3 CD44 Bezzi et al., Supplementary Figure 2 a Gr1-CD11b 6 months Spleen T cells 6 months Spleen 5 35 55 B cells 6 months Spleen Macrophages 6 months Spleen CD11b+/Gr1+ cells [%] 4 3 2 1 T cells [%] 3 25 2 15 B cells [%] 5 45 4 35 3 Macrophages [%] 5 4 3 6 n=3 n=3 n=3 n=3 n=3 n=3 n=3 n=3 n=3 n=3 n=3 n=3 b CD11b+/Gr1+ cells [%] 4 3 2 1 Gr1-CD11b 6 months Tumor T-cells 6 months Tumor ** p =.22 * p =.488 * p =.386 25 * p =.228 T cells [%] 2 15 1 5 B cells [%] 8 6 4 2 B-cells 6 months Tumor Macrophages [%] 3 2 1 Macrophages 6 months Tumor * p =.434 * p =.264-2 n=4 n=5 n=3 n=4 n=5 n=3 n=4 n=3 n=3 n=4 n=4 n=3 c d e f DAPI negative, CD11b+ cells DAPI negative, CD3+ cells DAPI negative, CD45+ cells DAPI negative, CD8+ cells CD26 CD8 CD4 CD62L CD26+ of F4/8 cells (%) 1 8 6 4 2 Ptenpc-/-; Trp53pc-/- % of CD3 + cells 1 8 6 4 2 CD4+ CD3 cells CD8+ CD3 cells 3 FoxP3+ of CD45+ CD4+ cells (%) 1 8 6 4 2 Ptenpc-/-; Trp53pc-/- CD44+ CD62L - of CD8+ cells (%) 1 8 6 4 2 Ptenpc-/-; Trp53pc-/- Nature Medicine: doi:1.138/nm.4463
Supplementary Figure 2. Infiltration of the immune cells in spleen and the prostate tissue of respective mouse models at 6 months of age. (a) Percentage of Gr- 1+/CD11b+ cells, T cells (CD3+), B cells (CD19+/B22+) and macrophages (CD11b+/F4/8+) in spleen of prostate tumor models at 6 months of age. (b) Percentage of Gr-1+/CD11b+ cells, T cells (CD3+), B cells (CD19+/B22+) and macrophages (CD11b+/F4/8+) in the tumor of prostate cancer models at 6 months of age. The number of mice analyzed for (a) and (b) is indicated in the figure. (c,d,e,f) Representative flow cytometry blots (upper panel) and quantification of the indicated cell populations (lower panel) isolated from the prostate tumor of 6 months old Pten pc-/- ; mice (n=3). All data are represented as mean ± SEM. Values of p<.5 were considered statistically significant. *P<.5; **P<.1; ***P<.1 by two-tailed unpaired Student s t-test. Nature Medicine: doi:1.138/nm.4463 4
Bezzi et al., Supplementary Figure 3 Ptenpc-/-;Zbtb7apc-/- Ptenpc-/-;Trp53pc-/- Ptenpc-/-;Zbtb7apc-/- Ptenpc-/-;Trp53pc-/- IHC:Ly6G a IHC: CD3 IHC: CD45R (B22) b 5 Nature Medicine: doi:1.138/nm.4463
Supplementary Figure 3. Localization of immune cells in prostate tumor tissues. (a) IHC of the Ly6G epitope in and prostate tumors (anterior prostate lobes, at 3 month of age) shows that Ly6G+ cells are mainly localized in the lumen of prostate glands and are in close proximity to cancer cells (black arrows). Scale bars,.5 mm. (b) IHC of the CD45R (B22) and CD3 epitope in Pten pc-/- ; and prostate tumors at 3 months of age (anterior prostate lobes) shows that B cells and T cells are mainly localized in the stroma of prostate tumor tissue. Scale bars,.5 mm. Similar stainings have been observed in two mice for each genotype. Nature Medicine: doi:1.138/nm.4463 6
Bezzi et al., Supplementary Figure 4 a S1A8 b S1A9 IL1b S1A8 expression [AU] 1 8 6 4 2 expression [AU] 4 3 2 1 **p =.28 expression [AU] 8 6 4 2 *p =.458 expression [AU] 3 2 1 Peripheral Blood Intra-tumoral Pten pc-/- c S1A9 IL1b S1A8 6 *p =.347 8 ***p =.2 3 expression [AU] 4 2 expression [AU] 6 4 2 expression [AU] 2 1 CD11b+Gr1+ Tumor (CD45-/CD49f+) CD11b+Gr1+ Tumor (CD45-/CD49f+) CD11b+Gr1+ Tumor (CD45-/CD49f+) d 25K 25K 2K 2K SSC-A 15K FSC-A 15K 1K 53 1K 5K 5K SSC 5K 1K 15K 2K 25K FSC-A FSC FSC 9.5 1 2 1 3 1 4 1 5 <Pacific Blue-A> DAPI 25K 1 5 9.62 59.8 FSC-A 2K 15K 1K <PE-A> 1 4 1 3 FSC 3.6 5K CD11b 1 2 1 3 1 4 1 5 <PE-Cy7-A> Ly6C 1 2 18.5 12.1 Ly6G 1 2 1 3 1 4 1 5 <APC-Cy7-A> 7 Nature Medicine: doi:1.138/nm.4463
Supplementary Figure 4. Gr-1+/CD11b+ cells show a differential tumor promotive activity in and tumors. (a) Expression analysis of sorted Gr-1+/CD11b+ cells from Pten pc-/- (n=2), (n=2) and Pten pc-/- ; (n=2) tumors shows a specific upregulation of S1A8 in granulocytes from tumors. Data are represented as mean ± SEM. (b) Expression analysis of sorted Gr-1+/CD11b+ cells from peripheral blood (blood) (n=4) or Pten pc-/- ; tumors shows increase in expression of S1a9 (n=3), S1a8 (n=3) and Il1b (n=4) in granulocytes from the primary tumor site. (c) Expression analysis of sorted CD11b+/Gr1+ cells and tumor cells (CD45-/CD49f+) from tumors (n=3) shows specific expressions of S1a9, Il1b and S1a8 in Gr-1+/CD11b+ cells. All data are represented as mean ± SEM. Values of p<.5 were considered statistically significant. *P<.5; **P<.1; ***P<.1 by two-tailed unpaired Student s t-test. (d) Gating strategy for positivity of the Ly6G and Ly6C epitopes. Nature Medicine: doi:1.138/nm.4463 8
Bezzi et al., Supplementary Figure 5 a 1 8 log FC 6 4 2 6 Cxcl1 Cxcl2 Cxcl5 Cxcl1 Cxcl13 Cxcl14 Cxcl15 Cxcl16 Cxcl17 Pten pc-/- log FC 4 2 b Ccl2 Ccl6 Ccl12 Ccl7 Ccl8 Ccl9 Ccl2 Ccl28 Pten pc-/- Gene Symbol LogFC 1 Spink3 6.1 2 Reg3b 5.48 3 Reg1 4.77 4 Reg3b 4.47 5 Mia1 4.34 6 Muc2 4.33 7 Clca3 4.33 8 H19 4.25 9 Onecut2 4.9 1 Cxcl5 4.7 11 Onecut2 4. 12 Krt2 3.95 13 Car9 3.87 14 Onecut2 3.84 15 221415F13Rik 3.75 9 d c CXCL5 mrna expression expression [AU] 4 3 2 1 1.5 1..5.1.5. CXCL5 **p =.22 Gr-1+/CD11b+ tumor cells (CD45-/CD49f+) ***p =.4 *p =.1 control Nature Medicine: doi:1.138/nm.4463
Supplementary Figure 5. CXCL5 expression is upregulated in tumors. (a) Expression analysis of chemokines from the CXC and CC family using microarray data obtained from prostate tumors (anterior lobes) from 3 months old Pten pc- /- and mice. (b) Gene rank list of upregulated genes in Pten pc-/- ; vs Pten pc-/- mice at 3 months measured by microarray. (c) Expression analysis of sorted intratumoral CD11b+/Gr1+ cells (n=2) and tumor cells (CD45- /CD49f+) (n=3) from tumors shows specific expressions of CXCL5 in tumor cells. (d) Expression analysis of CXCL5 in the prostate tissues of control (n=3), (n=3) mice and in prostate tumor tissue (anterior lobes) from Zbtb7a pc- /- (n=3) mice at 3 months of age by qrt-pcr. All data in (c) and (d) are represented as mean ± SEM. Values of p<.5 were considered statistically significant. *P<.5; **P<.1; ***P<.1 by two-tailed unpaired Student s t-test. Nature Medicine: doi:1.138/nm.4463 1
Ly6C Ly6C Bezzi et al., Supplementary Figure 6 a 6 Bone Marrow (BM) Cells Control % of live cells 4 2 GM-CSF + IL6 GM-CSF + IL6 +CXCL5 GM-CSF + IL6 +CXCL17 Ly6G + Ly6C + Ly6G - Ly6C + b Bone Marrow (BM) Cells Gr1+ cells isolated from BM Relative Expression level (qpcr) 2.5 2. 1.5 1..5. Arg1 inos S1A8 S1A9 GM-CSF + IL6 GM-CSF + IL6 +CXCL5 GM-CSF + IL6 +CXCL17 IL1b IL1 CD4 Relative Expression level (qpcr) 4 3 2 1 Arg1 inos S1A8 S1A9 GM-CSF + IL6 GM-CSF + IL6 +CXCL5 GM-CSF + IL6 +CXCL17 IL1b IL1 CD4 c Gr1+ cells isoleated from BM DAPI neg, CD11b+ gating Monocytes isolated from BM DAPI neg, CD11b+ gating Ly6G Ly6G 11 Nature Medicine: doi:1.138/nm.4463
Supplementary Figure 6. CXCL5 and CXCL17 are not major determinants of immature myeloid cell phenotype. (a) Ly6G+/Ly6C+ and Ly6G-/Ly6C+ flow analysis of BM cells culture for 4 days in GM-CSF, IL-6 supplemented medium plus either recombinant CXCL5 or recombinant CXCL17 (n=2 cell culture replicates). (b) qrt-pcr gene expression analysis of BM and Gr1+ cells from experiment in Supp. Fig. 6a and Fig.4a. Data are represented as mean of 3 cell culture replicates ± SEM. Values of p<.5 were considered statistically significant. *P<.5; **P<.1; ***P<.1 by twotailed unpaired Student s t-test. (c) Representative flow cytometry blots of Gr1+ cells and monocytes isolated from the bone marrow of healthy mice. Nature Medicine: doi:1.138/nm.4463 12
Bezzi et al., Supplementary Figure 7 a IgG Pten pc-/-; 1A8 (3 ug) H&E b CXCR2i Vehicle Pten pc-/-; Pten pc-/-; Vehicle c Foxp3+ cells (%) **p =.47 1 5 Vehicle CXCR2i 13 Nature Medicine: doi:1.138/nm.4463 CXCR2i
Supplementary Figure 7. Depletion of Gr-1+/CD11b+ cells decreases tumor burden in and mice. (a) mice (4 months of age) were treated with Ly6G-depletion antibody or control IgG antibody every other day for 1 days by intraperitoneal injection (3 ug/mouse) and tumor tissue was subjected to histological analysis. Black arrows show regions of reduced tumor burden. Scale bars,.2 mm. (b) Histological Analysis of and Trp53 pc- /- tumors (anterior prostate lobes) treated with Vehicle or SB2252 (CXCR2i) shows reduced tumor burden after CXCR2 inhibition (black arrows). Scale bars,.2 mm. (c) Flow cytometry analysis of prostate tumors after treatment with SB2252 (CXCR2i) (n=5) and vehicle (n=4) every day for 1 days by intraperitoneal injection. Data are represented as mean ± SEM. Values of p<.5 were considered statistically significant. *P<.5; **P<.1; ***P<.1 by two-tailed unpaired Student s t- test. Nature Medicine: doi:1.138/nm.4463 14
Bezzi et al., Supplementary Figure 8 a b pirak4 IKBalpha 3 *p=.392 **p=.96 1.5 *p =.15 ***p =.2 c normalized value [AU] 2 1.8 Pten pc-/- IKBalpha normalized value [AU] d Pten pc-/- CXCL5 *p =.111 *p=.298 1..5. normalized value [AU].6.4.2 expression [AU] 1..5. Vehicle CXCR2i. vehicle CXCR2i 15 Nature Medicine: doi:1.138/nm.4463
Supplementary Figure 8. NFkB pathway is markedly activated through Gr- 1+/CD11b+ cells in tumors. (a) Gene Set Enrichment Analysis for NFkB targets using microarray data obtained from tumors derived from 3 month old Pten pc-/- and mice. (b) Protein level of pirak4 (normalized with total IRAK4) and IkBa (normalized with b-actin) in the prostate tumors of 3 month old Pten pc-/-,, and mice (n=3 for each genotype). (c) Protein level of IkBa (normalized with b-actin) in the prostate tumors treated with vehicle (n=2) or SB2252 (CXCR2i) (n=3) in mice. Full scans of the blots for (b) and (c) are in Supp. Figure 1a-d. (d) Expression of CXCL5 in the prostate tumors treated with vehicle (n=3) or SB2252 (CXCR2i) (n=4) in mice. All data in (b), (c) and (d) are represented as mean ± SEM. Values of p<.5 were considered statistically significant. *P<.5; **P<.1; ***P<.1 by two-tailed unpaired Student s t- test. Nature Medicine: doi:1.138/nm.4463 16
Bezzi et al., Supplementary Figure 9 a phospho ERK B-catenin Pten pc-/- b Early stage Later stage 17 Nature Medicine: doi:1.138/nm.4463
Supplementary Figure 9. Upregulation of phosho-erk and B-Catenin in Pten pc-/- ; mice. (a) Representative IHC of phospho-erk and b-catenin in Pten pc-/- (n=3) and (n=3) prostate tumors at 3 months of age (anterior prostate lobes). Scale bars,.1 mm. (b) Schematic representation of the three different immune landscapes observed in the, and mice. 18 Nature Medicine: doi:1.138/nm.4463
Bezzi et al., Supplementary Figure 1 a e b f c g h d 19 Nature Medicine: doi:1.138/nm.4463
Supplementary Figure 1. Full scans of all the blots. (a) Actin western blot for Figure 3b and Supp. Figure 8b and c. Protein lysates of prostate tumors were loaded in the following order: n=3, n=3, n=3 Pten pc-/- mice. For Figure 3b, the cropped image was horizontally flipped. (b) Upper blot: pirak4 western blot for Supp. Figure 8b. Lower blot: CXCL5 western blot for Figure 3b. Protein lysates of prostate tumors were loaded as in (a). For Figure 3b, the cropped image was horizontally flipped. (c) Left blot: IKBalpha western blot for Supp. Figure 8b. Right blot: IRAK4 western blot for Supp. Figure 8b. Protein lysates of prostate tumors were loaded as in (a). (d) Actin and IKBalpha western blot for Supp. Figure 8c. Protein lysates of prostate tumors were loaded in the following order: n=2 treated with vehicle, n=3 treated with SB2252 (CXCR2i). (e) Upper blot: HSP9 western blot for Figure 4d. Lower blot: ZBTB7a western blot for Figure 4d. Protein lysates of prostate organoids were loaded in the following order: wild type,, and. (f) Trp53 western blot for Figure 4d. Protein lysates of prostate organoids were loaded as in (d). (g) p21 western blot for Figure 4d. Protein lysates of prostate organoids were loaded as in (d). (h) PTEN western blot for Figure 4d. Protein lysates of prostate organoids were loaded as in (d). Nature Medicine: doi:1.138/nm.4463 2
Supplementary Table 1. Tumor volumes (mm 3 ) of all the experiments in Figure 5. Genotype Treatment Age at baseline MRI (weeks) Baseline Volume Volume 2 weeks treatment Volume 4 weeks treatment Pten-Zbtb7a IgG 16 89.4 154.6 195.1 Pten-Zbtb7a IgG 16 125.3 186.2 188.5 Pten-Zbtb7a IgG 16 133.9 168.9 22.7 Pten-Zbtb7a IgG 18 138.7 239.4 285.1 Pten-Zbtb7a IgG 16 17.3 148.1 15.5 Pten-Zbtb7a IgG 12 47.1 129.5 123.6 Pten-Zbtb7a IgG 12 47.4 77.6 12.4 Pten-Zbtb7a Anti-CXCL5 18 147.4 169.2 167.1 Pten-Zbtb7a Anti-CXCL5 13 88.7 99.4 12.7 Pten-Zbtb7a Anti-CXCL5 12 65.1 132.3 13.8 Pten-Zbtb7a Anti-CXCL5 12 48.3 84 88.8 Pten-Zbtb7a Anti-CXCL5 16 18.7 154.7 139.7 Pten-Zbtb7a Anti-CXCL5 16 118.3 122.9 137.7 Pten-Zbtb7a Anti-CXCL5 16 129.7 164 176.3 Pten-Zbtb7a Anti-CXCL5 16 159 181.1 219.1 Pten-Zbtb7a Anti-CXCL5 16 172.4 176 174.9 Genotype Treatment Age at baseline MRI (weeks) Baseline Volume Volume 3 weeks treatment Pten-Trp53 IgG 16 185.5 549.9 Pten-Trp53 IgG 16 213.5 439.8 Pten-Trp53 IgG 12 93.8 168.8 Pten-Trp53 IgG 12 113.6 285.1 Pten-Trp53 Anti-Gr1 12 164 215.9 Pten-Trp53 Anti-Gr1 16 296.6 444 Pten-Trp53 Anti-Gr1 12 12.1 216.9 Pten-Trp53 Anti-Gr1 16 288.3 358 21 Nature Medicine: doi:1.138/nm.4463
Genotype Treatment Age at baseline MRI (weeks) Baseline Volume Volume 3 weeks treatment Pten-Zbtb7a Vehicle 12 61.2 164.3 Pten-Zbtb7a Vehicle 12 59.8 137.5 Pten-Zbtb7a Vehicle 18 232.6 42.2 Pten-Zbtb7a Vehicle 16 154.5 279.8 Pten-Zbtb7a CXCR2i 12 76.9 83.5 Pten-Zbtb7a CXCR2i 12 74.8 117.3 Pten-Zbtb7a CXCR2i 16 22.3 257 Pten-Zbtb7a CXCR2i 18 271.4 345.1 Pten-Zbtb7a CXCR2i 18 218.8 287.2 Pten-Zbtb7a CXCR2i 12 66.7 1.2 Genotype Treatment Age at baseline MRI (weeks) Baseline Volume Volume 2 weeks treatment Pten-Pml Vehicle 22 39.4 369.9 Pten-Pml Vehicle 16 135 194.2 Pten-Pml Vehicle 16 91.6 13.5 Pten-Pml CXCR2i 16 112.4 169 Pten-Pml CXCR2i 16 128.8 156.8 Pten-Pml CXCR2i 22 35 386.4 Genotype Treatment Age at baseline MRI (weeks) Baseline Volume Volume 2 weeks treatment Pten-Trp53 Vehicle 16 124 214.9 Pten-Trp53 Vehicle 16 143.9 327.6 Pten-Trp53 Vehicle 16 124.8 194.7 Pten-Trp53 Vehicle 12 64.4 19.2 Pten-Trp53 Vehicle 12 98 31.9 Pten-Trp53 CXCR2i 14 12.1 128.7 Pten-Trp53 CXCR2i 12 127.9 148 Pten-Trp53 CXCR2i 12 15.1 138.6 Pten-Trp53 CXCR2i 15 166.2 271.8 Pten-Trp53 CXCR2i 16 219.8 223.4 Pten-Trp53 CXCR2i 14 12.4 117.4 Pten-Trp53 CXCR2i 16 19.1 214.3 22 Nature Medicine: doi:1.138/nm.4463
Supplementary Table 2. Gene signatures used for the analysis in Figure 6. PMN- Signature Mo-MDSC/M2 Macrophages-signature T Cell Signature CXCR4 CD14 CD8A CXCR2 CD124 CCL2 ITGAM CD45 CCL3 ITGAX CD11B CCL4 ANPEP CD33 CXCL9 CD14 ARG1 CXCL1 FUT4 IL1 ICOS CD33 CD4 GZMK CD34 CD32 IRF1 CD38 CD163 HLA-DMA ENTPD1 CD23 HLA-DMB PTPRC CD2R HLADOA CEACAM8 PD-L2 HLA-DOB CD8 CD68 CSF1R CD115 IL4R HLA-DR CSF3 CD25 CSF2 CCR2 CXCL8 CCL2 TNF FOXP3 CXCL12 CSF1R S1A8 S1A9 STAT1 STAT3 STAT5A ARG1 NOS2 CD274 TLR3 TLR4 TGFB1 IL1 IDO1 PDCD1 Nature Medicine: doi:1.138/nm.4463 23
Supplementary Table 3. SNP analysis of 3 mice for each genotype analyzed. Nature Medicine: doi:1.138/nm.4463 24
Supplementary Table 4. Primer sequences targeting mouse genes used for qrt- PCR. Gene Forward Reverse Actin CGTCGACAACGGCTCCGGCA TGGGCCTCGTCACCCACATAGG CCL1 CAGGATGTTGACAGCAAGAG CATCTTTCTGTAACACTGG CCL2 GGCCTGCTGTTCACAGTTG CTGCTGGTGATCCTCTTGTAG CCL3 CTGCAACCAAGTCTTCTCAG GCCGGTTTCTCTTAGTCAGG CCL4 CTTCTGTGCTCCAGGGTTCTC CTGTCTGCCTCTTTTGGTCAG CCL5 GCTGCTTTGCCTACCTCTCC TCGAGTGACAAACACGACTGC CCL7 GCTTTCAGCATCCAAGTGTG GACTACTGGTGATCCTTCTG CCL2 GCCTCTCGTACATACAGACGC CCAGTTCTGCTTTGGATCAGC CCL28 GTGTGTGGCTTTTCAAACCTCA TGCATGAACTCACTCTTTCCAG CXCL1 ACTGCACCCAAACCGAAGTC TGGGGACACCTTTTAGCATCTT CXCL2 CCAACCACCAGGCTACAGG GCGTCACACTCAAGCTCTG CXCL3 GATTTTGAGACCATCCAGAGC CTCTTCAGTATCTTCTTGATG CXCL5 TGCATTCCGCTTAGCTTTCT CAGAAGGAGGTCTGTCTGGA CXCL7 CACTTCATAACCTCCAGATC CACAGTGAACTCCTGGCCTGTAC CXCL9 GGAGTTCGAGGAACCCTAGTG GGGATTTGTAGTGGATCGTGC CXCL1 CCAAGTGCTGCCGTCATTTTC GGCTCGCAGGGATGATTTCAA CXCL12 GTAAACCAGTCAGCCTGAG GCTTTCTCCAGGTACTCTTG CXCL14 GGAAATGAAGCCAAAGTACC GATGAAGCGTTTGGTGCTCTG CXCL15 CAAGGCTGGTCCATGCTCC TGCTATCACTTCCTTTCTGTTGC CXCL16 GGACTGCTTTGAGCGCAAAG CTGAGTGCTCTGACTATGTG CXCL17 AGGTGGCTCTTGGAAGGTG GGTGACATCGTTTGAGAAATTGC IL1beta GAAATGCCACCTTTTGACAGTG TGGATGCTCTCATCAGGACAG S1A9 GCACAGTTGGCAACCTTTATG TGATTGTCCTGGTTTGTGTCC S1A8 AAATCACCATGCCCTCTACAAG CCCACTTTTATCACCATCGCAA Arg1 TTTTTCCAGCAGACCAGCTT AGAGATTATCGGAGCGCCTT inos TTCTGTGCTGTCCCAGTGAG TGAAGAAAACCCCTTGTGCT IL1 ATCGATTTCTCCCCTGTGAA TGTCAAATTCATTCATGGCCT CD4 GTCGGCTTCTTCTCCAATCAG CATCACGACAGGAATGACCAG Nature Medicine: doi:1.138/nm.4463 25
Supplementary Table 5. Primer sequences targeting human genes used for qrt-pcr. Gene name Forward Reverse Actin TGGCACCCAGCACAATGAA CTAAGTCATAGTCCGCCTAGA CXCL5 CTGTTGGTGCTGCTGCTGCTG CGAACACTTGCAGATTACTG CXCL17 TGCTGCCACTAATGCTGATGT CTCAGGAACCAATCTTTGCACT p21 GACCTGTCACTGTCTTGTAC CTTCCTCTTGGAGAAGATCAG Nature Medicine: doi:1.138/nm.4463 26