Supplementary Material Original article in Gastric Cancer A novel splice variant of XIAP-associated factor 1 (XAF1) is expressed in peripheral blood containing gastric cancer-derived circulating tumor cells Keiichi Hatakeyama 1, Yushi Yamakawa 2,3, Yorikane Fukuda 1,4, Keiichi Ohshima 1, Kanako Wakabayashi-Nakao 1, Naoki Sakura 1, Yutaka Tanizawa 2, Yusuke Kinugasa 3, Ken Yamaguchi 5, Masanori Terashima 2* and Tohru Mochizuki 1 1 Medical Genetics Division, Shizuoka Cancer Center Research Institute. 2 Division of Gastric Surgery, Shizuoka Cancer Center Hospital. 3 Division of Colon and Rectal Surgery Shizuoka Cancer Center Hospital. 4 Present address: G&G Science. 5 Shizuoka Cancer Center Hospital and Research Institute Equal contributor. * Corresponding author. E-mail: m.terashima@scchr.jp. 1
Methods Cell cultures Cell lines used in this study are listed in Table S1 in the Supplementary Method. MKN45P cell lines [1] were kindly provided by Dr. Yutaka Yonemura and Dr. Yoshio Endo. These cell lines were cultured and maintained in RPMI 1640, DMEM/F12, or DMEM medium (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 5 to 10% foetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA), glutamine (0.3 mg/ml), penicillin (100 unit/ml), and streptomycin (0.1 mg/ml), in a humidified 5% CO 2 incubator. mrna analyses were performed using cells found to have 70 90% confluency and greater than 95% viability, as determined using trypan blue staining. RNA sample preparations Total RNA extraction of cell pellet and peripheral blood stabilized with Paxgene were performed using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) and PAXgene Blood RNA Kit (Qiagen), respectively. The extracted RNA concentration was determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA) and total RNA quality was then confirmed using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). The purified total RNA from cancer cell lines and peripheral blood were then reverse-transcribed using ThermoScript Reverse Transcriptase (Invitrogen) and oligo(dt) 20 primers in accordance with the manufacturer s instructions. 2
RT-PCR The PCR was designed to detect the splice variants and known XAF1 transcripts (XAF1A and XAF1C). The synthesized cdnas were amplified using Ex Taq polymerase (Takara Bio, Shiga, Japan) for 36 PCR cycles of 95 C for 60 s, 59 C for 30 s, and 68 C for 60 s. Primer sets listed in Table S2 in the Supplementary Method. DNA sequencing analysis For DNA sequencing analysis, the PCR products were analyzed on 1 2% agarose gels by electrophoresis following by gel staining with SYBR Safe (Invitrogen). The bands visualized under ultraviolet light were isolated and purified using the QIAquick Gel Extraction Kit (Qiagen). The purified samples were then cloned into a pcr 2.1-TOPO vector (Invitrogen) using the TOPO TA Cloning Kit for Sequencing (Invitrogen). Positive transformants were sequenced using the Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) and an ABI 3130xl Genetic Analyzer (Applied Biosystems). Quantitative real-time PCR The target fragment was amplified using specific primers (see Table S2) according to the following protocol: preheating at 95 C for 20 s, 40 cycles at 95 C for 1 s and 60 C for 30 s, and then a dissociation curve performed at 95 C for 15 s, 60 C for 15 s, and 95 C for 15 s. The threshold cycle (Ct) values were converted into transcript expression levels using a standard curve prepared using 3
purified PCR amplicons that were generated from plasmids containing the sequence of the target transcripts. Nonspecific amplification in qrt-pcr was evaluated using gel electrophoresis, which helped determine the amplicon size. NMD-related genes (ATF3, GADD45B, MAFF, and UPF1) were quantified using the 2 -ΔΔCt method. [2] The fold change was normalized by ACTB expression. 4
Results Validation of XAF1F expression levels The novel splice variant XAF1F was detected in 20 cancer cell lines. To properly estimate the expression level of this transcript, we performed a qrt-pcr assay. The specificity of the qrt-pcr was first verified by gel electrophoresis and a dissociation curve analysis (Fig. S1A and S1B in Supplementary Material). As shown in Fig. 2, the XAF1F transcript appeared to be highly expressed in MKN45P (gastric), KP-3L (pancreatic), LS123 (colorectal), and Hs578T (breast) cancer cells. The specificity of qrt-pcr was thus validated using these cells. Amplicons were observed in a single band in electrophoresis, and the size of the bands was identical to the expected size of 116 bp. The firstderivative curves of fluorescence decay showed a single peak of MKN45P in the in qrt-pcr assays. In the other three cells, a single peak was also observed at the same temperature (data not shown). These results indicated that nonspecific PCR products were not amplified in qrt-pcr. Standard curves were next generated from 10-fold serial dilutions of template DNA amplified from plasmids containing the sequences of the target transcripts (Fig. S1C in Supplementary Material). The amplification efficiency (AE) of all transcripts was 1.00 ± 0.05 (R 2 = 0.988, p = 1.88 10-33 ). These results indicate that the target-specific primers and the constructed template DNA provided accurate amplification in our qrt- PCR assay. We finally quantified the XAF1F transcripts by using this validated assay (Fig. S1D in Supplementary Material). As shown in Fig. 2, MKN45, LoVo, PANC-1, and MDA-MB-175-VII cells expressed XAF1A/C but barely expressed XAF1F. qrt-pcr analysis was performed using these cell lines and the four XAF1F-expressing cell lines indicated in Fig. S1A. The mrna expression levels of 5
XAF1F determined by qrt-pcr were fairly consistent with the electrophoresis results of the RT-PCR amplicons, indicating that XAF1F in cancer cells was amplified by qrt-pcr without artifacts from the other XAF1 transcripts. Therefore, we conclude that quantification of XAF1F transcript was successfully achieved using our qrt-pcr analysis. 6
Table S1 Human cancer cell lines used in this study Tissue Cell line Histology Supplier Catalogue No. Note about metastasis Gstric MKN45 carcinoma JCRB 1) JCRB0254 - MKN45P subcloned from MKN45* - - Highly metastatic cell derived from xenograft of MKN45 MKN1 adenosquamous carcinoma JCRB JCRB0252 - MKN74 adenocarcinoma JCRB JCRB0255 Stomach cancer metastasized to liver KATOIII signet ring cell carcinoma JCRB JCRB0611 Stomach cancer, signet ring cell carcinoma SNU-1 carcinoma ATCC 2) CRL-5971 Stomach; derived from metastatic site: ascites SNU-16 carcinoma ATCC CRL-5974 Stomach; derived from metastatic site: ascites AGS adenocarcinoma ECACC 3) EC89090402 - Hs746T carcinoma ATCC HTB-135 - NCI-N87 carcinoma ATCC CRL-5822 Stomach; derived from metastatic site: liver. The tumor was passaged as a xenograft in athymic nude mice for three passages before the cell line was established. HGC-27 carcinoma ECACC EC94042256 - Pancreatic ACBRI 515 normal pancreatic CEL 4) RI-515 - KP-3 adenosquamous carcinoma JCRB JCRB0178.0 - KP-3L adenosquamous carcinoma JCRB JCRB0178.1 Cells were established from the resulting tumor nodules in the liver of mouse, into the spleen where KP-3 cells had been injected. AsPC-1 adenocarcinoma ATCC CRL-1682 Pancreas; derived from metastatic site: ascites BxPC-3 adenocarcinoma ATCC CRL-1687 - Capan-1 adenocarcinoma ATCC HTB-79 Pancreas; derived from metastatic site: liver Capan-2 adenocarcinoma ATCC HTB-80 - CFPAC-1 ductal adenocarcinoma ATCC CRL-1918 Pancreas; derived from metastatic site: liver HPAF-II adenocarcinoma ATCC CRL-1997 HPAF-II is a human pancreatic adenocarcinoma cell line derived from peritoneal ascitic fluid of a 44 year old Caucasian male with primary pancreatic adenocarcinoma and metastases to the liver, diaphragm and lymph nodes. KP-2 adenocarcinoma JCRB JCRB0181 - KP-4 pancreatic duct carcinoma RCB 5) RCB1005 - MIAPaca-2 carcinoma ATCC CRL-1420 - PANC-1 epithelioid carcinoma ATCC CRL-1469-7
Continued Colonrectal LoVo colorectal carcinoma ATCC CCL-229 Colon; derived from metastatic site: left supraclavicular region. DLD-1 adenocarcinoma ECACC EC90102540 - Colo-205 colorectal carcinoma ATCC CCL-222 Colon; derived from metastatic site: ascites SW948 adenocarcinoma ATCC CCL-237 - SK-CO-1 adenocarcinoma ATCC HTB-39 Colon; derived from metastatic site: ascites HCC-56 5) adenocarcinoma JCRB JCRB1037 - LS123 adenocarcinoma ECACC EC94120801 - C170 carcinoma ECACC EC97071507 - Colo741 carcinoma ECACC EC93052621 Derived from a pelvic wall metastasis of a 69 year old female with colon carcinoma SNU-C1 adenocarcinoma ATCC CRL-5972 Colon; derived from metastatic site: peritoneum SW480 adenocarcinoma ECACC EC87092801 - SW620 adenocarcinoma ATCC CCL-227 Colon; derived from metastatic site: lymph node Breast MDA-MB-175-VII epithelial ductal carcinoma ATCC HTB-25 Mammary gland; breast/duct; derived from metastatic site: pleural effusion MDA-MB-361 adenocarcinoma ATCC HTB-27 Mammary gland/breast; derived from metastatic site:brain HCC38 primary ductal carcinoma ATCC CRL-2314 HCC38 was initiated from a 50-year-old white female with a prior history of leiomyosarcoma; her mother died of breast cancer. T-47D ductal carcinoma ATCC HTB-133 Mammary gland; derived from metastatic site: pleural effusion Hs 578T carcinoma ECACC EC86082104 Tumorigenic in immunosuppressed mice and form colonies in semisolid medium MFM 223 carcinoma ECACC EC98050130 - HCC70 primary ductal carcinoma ATCC CRL-2315 - UACC-812 ductal carcinoma ATCC CRL-1897 - UACC-893 primary ductal carcinoma ATCC CRL-1902-1) Japanese Collection of Research Bioresources 2) American Type Culture Collection 3) European Collection of Cell Cultures 4) Cell Systems Corporation 5) Riken Bioresource Center Cell Bank 6) The individual-specific DNA profile of HCC-56 is identical to that of other cell line, HSC-57 * Iinuma H, et al: Intracellular targeting therapy of cisplatin-encapsulated transferrin-polyethylene glycol liposome on peritoneal dissemination of gastric cancer. Int. J. Cancer 2002, 99(1):130-137. 8
Table S2 DNA sequences of RT-PCR and quantitative RT-PCR primers Assay Gene Primer name Sequence (5 to 3 ) Orientation RT-PCR and qrt-pcr XAF1 qfs TGGACCCACATCTGGTGTGT Sense qfas GGCACTCATTGGCCTTATGAA Antisense RT-PCR XAF1 S5* AGTGTGAGGAGCCTGTCC Sense AS* CAGAAGTCCTCGCTGGAGTTTC Sense AAS* TTCAGGAGCTGAAATTCTTTCC Antisense CAS* TTATGGCCACAGATGTGCACT Antisense DAS* AGTCTGGACAACATTTACCCTTTC Antisense ACTB AT1 ATTCCTATGTGGGCGACGAGGC Sense AT2 TGGATAGCAACGTACATGGCTGG Antisense qrt-pcr ATF3 ATF-S GATGTCCTCTGCGCTGGAAT Sense ATF-A CTCGTCGCCTCTTTTTCCTTT Antisense GADD45B GAD-S GCCAGGATCGCCTCACAGT Sense GAD-A GATTTGCAGGGCGATGTCAT Antisense MAFF MAF-S GAGGGCACCTTCTGCAAACA Sense MAF-A CGCAGATGCCGGTTCAG Antisense UPF1 UPF-S AGATCACGGCACAGCAGAT Sense UPF-A TGGCAGAAGGGTTTTCCTT Antisense BIRC5 qsv1 TCAAGGACCACCGCATCTCT Sense qsv2 GCCAAGTCTGGCTCGTTCTC Antisense ACTB qat1 TGGCACCCAGCACAATGA Sense qat2 CCGATCCACACGGAGTACTTG Antisense * These primers were designed based on previous report [3] 9
Table S3 Relationship between age and expression of transcripts Gene symbol Spearman's rank correlation coefficient (p value 1) ) Healthy volunteer Patient whole samples 2) BIRC5 0.21 (0.352) -0.18 (0.402) 0.18 (0.204) XAF1F 0.22 (0.318) -0.09 (0.696) 0.07 (0.399) XAF1A 0.14 (0.528) -0.02 (0.943) 0.14 (0.129) XAF1C 0.08 (0.731) -0.07 (0.770) 0.11 (0.249) 1) Using the t distribution. 2) Healthy volunteer + Patient 10
Figure S1 (A) (B) Derivative 0.15 0.13 0.11 0.09 0.07 0.05 0.03 0.01 MKN45P KP-3L LS123 MKN45P Hs578T 116 bp 60 65 70 75 80 85 90 95 Temperature ( C) (C) Ct value (-) 40 36 32 28 24 20 16 R 2 = 0.988 p = 1.88 x 10-33 AE = 1.00 ± 0.05 12 0 1 2 3 4 5 6 7 8 Input of XAF1F log 10 (n) (D) XAF1F expression level 2500 2000 1500 1000 500 MKN45 MKN45P PANC-1 KP-3L 0 gastric pancreatic LoVo colorectal LS123 MDA-MB-175-VII breast Hs578T Figure S1. Validation of qrt-pcr assay for XAF1F transcript. (A) Specificity verification of qrt- PCR primers using agarose gel electrophoresis of amplicons. The amplicon size of XAF1F obtained by qrt-pcr using primers qfs and qfas was 116 bp. (B) Dissociation curve analysis of qrt-pcr amplicons obtained from MKN45P cells. First-derivative curves of the fluorescence decay derived from dissociation of the intercalator and DNA were plotted versus temperature. (C) Standard curve constructed from 10-fold serial dilutions of purified PCR amplicons that were generated from plasmids containing the sequences of the target transcripts. Amplification efficiency (AE) was calculated from the slope of the regression line according to the equation AE = 10-1/slope -1 and is represented as the mean value ± SD obtained from pentaplicate experiments. (D) Quantification of XAF1F levels in cancer cell lines. For demonstration of qrt-pcr, XAF1F-expressing cells and XAF1A-expressing cells without XAF1F expression were selected from the experiment depicted in Fig. 2. 11
Figure S2 350 10 Relative expression level 300 60 40 20 XAF1A XAF1C XAF1F Relative expression level 8 6 4 2 XAF1A XAF1C XAF1F 0 MKN45 MKN45P 0 KP-3 KP-3L gastric pancreatic Figure S2. Expression analysis of XAF1 transcripts in pairs of cell lines used as a metastatic model. The pairs of gastric cells (MKN45 vs. MKN45P) and pancreatic cells (KP-3 vs. KP-3L) are shown in the left and right panels, respectively. Expression level of XAF1F was evaluated using qrt-pcr, and that of other XAF1 transcripts was estimated by densitometric scaning of RT-PCR amplicons based on previous report. [3] The expression levels of XAF1 transcripts in each parental cell (MKN45 or KP-3) are shown as 1.0. 12
Figure S3 colorectal breast Colo205 LS123 Hs578T Figure S3. Expression levels of XAF1 transcripts in NMD-inhibited cancer cells. NMD was inhibited by caffeine and actd treatment (+caffeine). Treatment with actd alone (-caffeine) was used to observe RNA stability after blockade of transcription. Cancer cells that were not treated with reagents are presented as the control. For verification of upregulation of XAF1F through NMD inhibition, XAF1F-expressing cells were selected from the experiment depicted in Fig. 2. 13
Figure S4 (A) MKN45P patient 1 patient 2 patient 3 124 bp (B) 0.17 0.15 MKN45P (C) 40 36 R 2 = 0.992 p = 3.14 x 10-36 0.13 32 AE = 0.93 ± 0.04 Derivative 0.11 0.09 0.07 Ct value (-) 28 24 0.05 0.03 0.01 60 65 70 75 80 85 90 95 Temperature ( C) 20 16 12 0 1 2 3 4 5 6 7 8 Input of XAF1F log 10 (n) Figure S4. Validation of quntitative real-time (qrt)-pcr assay for BIRC5 transcript. (A) Specificity verification of qrt-pcr primers using agarose gel electrophoresis of amplicons. The amplicon size of BIRC5 obtained by qrt-pcr using primers qsv1 and qsv2 (detailed in Table S2) was 124 bp. (B) Dissociation curve analysis of qrt-pcr amplicons obtained from MKN45P cells. First-derivative curves of the fluorescence decay derived from dissociation of the intercalator and DNA were plotted versus temperature. (C) Standard curve constructed from 10-fold serial dilutions of purified PCR amplicons that were generated from plasmids containing the sequences of BIRC5 transcript. Amplification efficiency (AE) was calculated from the slope of the regression line according to the equation AE = 10-1/slope -1 and is represented as the mean values ± S.D. obtained from pentaplicate experiments. 14
Figure S5 100 XAF1C 100 XAF1F Sensitivity (%) 80 60 40 Cut-off: 1.562 sensitivity: 51.04% specificity: 86.36% Sensitivity (%) 80 60 40 Cut-off: 476.1 sensitivity: 58.33% specificity: 72.73% 20 AUC, 0.6927 (95%CI, 0.5852-0.7936) 0 100 80 60 40 20 0 Specificity (%) 20 0 AUC, 0.6761 (95%CI, 0.5630-0.7822) 100 80 60 40 20 0 Specificity (%) Figure S5. ROC curve of XAF1C and XAF1F expressions in peripheral blood. The black solid line indicates the curve of XAF1C or XAF1F in all peripheral blood samples (n = 118). The optimal threshold is represented by the black arrow. 15
References 1. Iinuma H, Maruyama K, Okinaga K, et al. Intracellular targeting therapy of cisplatin-encapsulated transferrinpolyethylene glycol liposome on peritoneal dissemination of gastric cancer. Int J Cancer. 2002;99(1):130-7. 2. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(- Delta Delta C(T)) Method. Methods. 2001;25(4):402-8. 3. Chung SK, Lee MG, Ryu BK, et al. Frequent alteration of XAF1 in human colorectal cancers: implication for tumor cell resistance to apoptotic stresses. Gastroenterology. 2007;132(7):2459-77. 16