An oxygen-regulated switch in the protein synthesis machinery

Similar documents
Aberrant Promoter CpG Methylation is a Mechanism for Lack of Hypoxic Induction of

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway

mrna cis Elements Located in Non-Protein-Coding Regions

supplementary information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Molecular Biology (BIOL 4320) Exam #2 April 22, 2002

Mechanisms of alternative splicing regulation

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.

The Changing Role of mtor Kinase in the Maintenance of Protein Synthesis during Human Cytomegalovirus Infection

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

SUPPLEMENTARY INFORMATION

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Regulation of Gene Expression in Eukaryotes

Bio 401 Sp2014. Multiple Choice (Circle the letter corresponding to the correct answer)

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

GW182 proteins cause PABP dissociation from silenced mirna targets in the absence of deadenylation

Professor Christopher Proud

MOLECULAR CELL BIOLOGY

Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment

Messenger RNA (mrna) is never alone

Molecular Biology (BIOL 4320) Exam #2 May 3, 2004

Ch. 18 Regulation of Gene Expression

Viral strategies to control cellular translation Rodney Colina Munioz

Computational Biology I LSM5191

Genetics. Instructor: Dr. Jihad Abdallah Transcription of DNA

Supplementary Figure 1

Nutrition & Metabolism Cell Signalling & Gene Regulation PhD & Honours Projects 2018

MicroRNA dysregulation in cancer. Systems Plant Microbiology Hyun-Hee Lee

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

Supplementary Figure 1

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

Cellular MicroRNA and P Bodies Modulate Host-HIV-1 Interactions. 指導教授 : 張麗冠博士 演講者 : 黃柄翰 Date: 2009/10/19

In vivo prediction of anti-tumor effect of 3- bromopyruvate in Hepatocellular Carcinoma using Tc-99m labeled annexin-v imaging

SUPPLEMENTARY INFORMATION

Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells

Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins.

SUPPLEMENTARY DATA. Supplementary Table 1. Characteristics of Subjects.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Lecture 4 Regulation of Initiation: mrna-binding

T H E J O U R N A L O F C E L L B I O L O G Y

Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system

PROTEIN SYNTHESIS. It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.

Translational Control of Viral Gene Expression in Eukaryotes

Pre-mRNA has introns The splicing complex recognizes semiconserved sequences

MicroRNA and Male Infertility: A Potential for Diagnosis

Doctor of Philosophy

Chapter 10 - Post-transcriptional Gene Control

Supplementary Material

Objectives: Prof.Dr. H.D.El-Yassin

mirna Dr. S Hosseini-Asl

2 The abbreviations used are: eif, eukaryotic initiation factor; ATF4, activating transcription

Circular RNAs (circrnas) act a stable mirna sponges

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

RNA (Ribonucleic acid)

Amino Acids: Regulation of Global and Specific mrna Translation. Dr. Scot R. Kimball

Supplemental Data Macrophage Migration Inhibitory Factor MIF Interferes with the Rb-E2F Pathway

Supplementary information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

Propagation of the Signal

Potential Role for the Bone Morphogenetic Antagonist Gremlin in Pulmonary Hypertension

Cross-talk between Epidermal Growth Factor Receptor and Hypoxia-inducible Factor-1

Analysis on the mechanism of reduced nephron number and the pathological progression of chronic renal failure in Astrin deficient rats

Antibodies for Unfolded Protein Response

Akt-dependent Skp2 mrna translation is required for exiting contact inhibition, oncogenesis, and adipogenesis

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1

Supplementary Materials for

Transcriptome-Wide Analysis Of Hypoxic Cancer Cells Identify Alternative Splicing As A Mechanism To Inhibit Translation

The Blueprint of Life: DNA to Protein. What is genetics? DNA Structure 4/27/2011. Chapter 7

The Blueprint of Life: DNA to Protein

Gene expression was analyzed by real time PCR (SYBR GREEN PCR Master. Mix, Roche Applied Science) using specific oligonucleotides.

Chapt 15: Molecular Genetics of Cell Cycle and Cancer

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts

Tatyana V. Pestova, 1,2 Ivan N. Shatsky, 2 Simon P. Fletcher, 3 Richard J. Jackson, 3 and Christopher U.T. Hellen 1,4

The unfolded protein response is shaped by the NMD pathway

micrornas (mirna) and Biomarkers

Signaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research

Biol403 MAP kinase signalling

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

The role of 5 -leader length, secondary structure and PABP concentration on cap and poly(a) tail function during translation in Xenopus oocytes

General Biology 1004 Chapter 11 Lecture Handout, Summer 2005 Dr. Frisby

Phospho-AKT Sampler Kit

SUPPLEMENTARY INFORMATION

Over-Activation of Hypoxia-Inducible Transcription Factor 1 alpha (HIF)-1α by Chronic Hypoxia Mediates Chronic Ischemic Renal Injury

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

SUPPLEMENTAL DATA RESULTS

Intrinsically Disordered Proteins. Alex Cioffi June 22 nd 2013

Plasma membranes. Plasmodesmata between plant cells. Gap junctions between animal cells Cell junctions. Cell-cell recognition

TRANSLATION REGULATION DURING HCMV INFECTION. Benjamin Ziehr

THE MAMMARY GLAND develops in distinct

Intrinsic cellular defenses against virus infection

Translational control of aberrant stress responses as a hallmark of cancer

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Fish models for environmental and biomedical research

Lecture 15. Signal Transduction Pathways - Introduction

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

DISCOVERY AND CHARACTERIZATION OF THE INTERPHASE FUNCTION OF MITOTIC MOTORS IN PROTEIN SYNTHESIS. Kristen Marie Bartoli. B.S., Temple University, 2004

Protein Synthesis

Transcription:

An oxygen-regulated switch in the protein synthesis machinery

1 Inhibition of translation during acute hypoxia is mediated by eif2α phosphorilation mouse embryo fibroblasts (MEFs)

1 Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

Prolonged Hypoxia inhibits mrna translation

Berg et al., BIOCHIMICA 6/E, Zanichelli editore S.p.A. Copyright 2007

The initial step of protein synthesis is the binding of the eukaryotic translation initiation factor 4E (eif4e) to the 7- methylguanosine (m7-gpppg) 5 cap of messenger RNAs.

2 Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

2 Low oxygen tension (hypoxia) represses cap-mediated translation by sequestering eif4e..

eif4e relocalizes during hypoxia eif4e 4E-T DAPI Merge Control Hypoxia 16 h The shuttling protein 4E-T is a known regulator of eif4e localization and is capable of binding and transporting it to the cell nucleus Correlation with the gradual dephosphorylation of 4E-T

0 1 4 8 16 hrs 4E-BP1 Actin 4E-BP1 an inactive complex shows induction after hypoxia

effects of hypoxia on mrna translation ACTIVATION

effects of hypoxia on mrna translation Acute hypoxia causes transient eif2a phosphorylation due to PERK activation as a part of the UPR. This results in inhibition of the rate of translation initiation. Following prolonged hypoxic conditions, activation of 4E-BP and 4E-T causes disruption of eif4f, which inhibits the recruitment of mrna to polysomes.

effects of hypoxia on mrna translation 1 2 Acute hypoxia causes transient eif2a phosphorylation due to PERK activation as a part of the UPR. This results in inhibition of the rate of translation initiation. Following prolonged hypoxic conditions, activation of 4E-BP and 4E-T causes disruption of eif4f, which inhibits the recruitment of mrna to polysomes. Both molecular mechanisms affect specific mrnas to varying degrees, resulting in differential gene expression.

A fundamental question in biology is as to how proteins are synthesized in periods of oxygen scarcity and eif4e inhibition

EGFR levels increase!! in hypoxic cells human renal proximal tubular epithelial cells

An oxygen-regulated switch from eif4e- to eif4e2- dependent protein synthesis.

eif4e and eif4e2 polysome association in normoxia and hypoxia

hypoxia stimulates the switch from the cap-bindingeif4e to to eif4e2 homologue dependent from the oxygen-regulated hypoxia-inducible factor 2a (HIF-2alpha)

EGFR levels in hypoxic cells do not increase when HIF-2 alpha is inhibited human renal proximal tubular epithelial cells

effects of hypoxia on mrna translation 1 2 3 switch to eif4e2 Acute hypoxia causes transient eif2a phosphorylation due to PERK activation as a part of the UPR. This results in inhibition of the rate of translation initiation. Following prolonged hypoxic conditions, activation of 4E-BP and 4E-T causes disruption of eif4f, which inhibits the recruitment of mrna to polysomes. hypoxia stimulates the switch from the cap-bindingeif4e to to eif4e2 homologue dependent from the oxygen-regulated hypoxia-inducible factor 2a (HIF-2alpha) 3

Meccanismo molecolare di HIF 2 alpha nella sintesi proteica an oxygen-regulated translation initiation complex that mediates selective capdependent protein synthesis

RNA-binding protein RBM4 recruits HIF-2alpha in hypoxia Co-immunoprecipitation of HIF-2a 21% O2 1%O2 Co-immunoprecipitation of HIF-2a with RBM4 in hypoxia (right) WCL, whole cell lysate RNA-binding protein RBM4 oxygen-regulated hypoxia-inducible factor 2a (HIF-2a)

HIF-2a RBM4 recruits the m7-gtp cap by means of an interaction with eif4e2 Capture assays using m7-gtp beads in hypoxic cell lysates depleted in eif4e2 GTP, proteins dislodged from the beads by GTP; m7gtp, proteins bound to m7- GTP beads after GTP wash hypoxia stimulates the formation of a complex that includes the oxygen-regulated hypoxia-inducible factor 2a (HIF-2a), the RNA-binding protein RBM4 and the capbinding eif4e2

Determinanti per la selezione di specifici messaggeri tradotti nella ipossia

RBM4 recruits HIF-2alpha to specific regions of 3 UTR for hypoxic translation 3 UTR RNA immunoprecipitation of HIF-2a and RBM4 IN, input; nt, nucleotides; RN, RNase-treated

RBM4 recruits HIF-2alpha to specific regions of 3 UTR for hypoxic translation. RNA immunoprecipitation of HIF-2a and RBM4 IN, input; nt, nucleotides; RN, RNase-treated

Identification of sequences defining an RNA hypoxia response element (rhre) in the 3 UTR RNA hypoxia response element (rhre) Expression of a luciferase reporter containing CGG AAA mutations near the RBM4 binding site, or in a control upstream region (ucgg).

Complesso Quaternario: mrna (rhre), Fattore alternativo che riconosce il Cap (eif4e2), Fattore secondo che risponde all ipossia (hif2alpha) e proteina che lega RNA RBM4 7MG eif4e2 RBM4 Hif2alpha rhre (3 UTR) AAAAA

effects of hypoxia on mrna translation eif4e2 Translation of mrna containing The RNA hypoxia response element (rhre)

Polysomal distribution of specific mrna in hypoxic cells the HIF-2a RBM4 eif4e2 complex captures the 5 cap and targets mrnas to polysomes for active translation

Silencing of eif4e2 in hypoxic cells the HIF-2a RBM4 eif4e2 complex DOES NOT targets mrnas to polysomes for active translation

An RNA hypoxia response element (rhre) t recruits the complex that includes the oxygen-regulated hypoxiainducible factor 2a (HIF-2a), the RNA-binding protein RBM4 and the cap-binding eif4e2 to several mrnas, including that encoding the epidermal growth factor receptor EGFR Once assembled at the rhre, the HIF-2a RBM4 eif4e2 complex captures the 5 cap and targets mrnas to polysomes for active translation, thereby evading hypoxia-induced repression of protein synthesis cells have evolved a program by which oxygen tension switches the basic translation initiation machinery

EGFR

Polysome distribution of EGFR mrna in normoxic and hypoxic cells

HIF-2α associates with a region of the EGFR mrna 3 UTR RNA immunoprecipitation of endogenous HIF-1α and HIF-2α followed by RT-PCR using primers within the 5 UTR and 3 UTR of EGFR mrna. IN, input; RN, RNase-treated. Experiments performed in MDA- MB-231 breast carcinoma

EGFR levels in hypoxic cells

Complesso Quaternario: mrna (rhre di EGFR), Fattore alternativo che riconosce il Cap (eif4e2), Fattore secondo che risponde all ipossia (hif2alpha) e proteina che lega RNA RBM4 7MG eif4e2 RBM4 Hif2alpha rhre AAAAA