Lab 13 A Simulation of DNA Mutations and Cancer PROBLEM How can the changes in DNA that lead to cancer be modeled? BACKGROUND Cancer is the uncontrolled growth of cells that produces tumors. Cancer is almost always caused by mutations in the DNA or by the abnormal activity of genes that control cell growth and cell mitosis. Abnormal genes that cause cancer are called oncogenes. Oncogenes have been discovered for many kinds of cancers. Cell mutations commonly happen within the body, yet only a very small number of mutations ever lead to cancer. The fact that few mutations lead to cancer is due to several factors: Most mutated cells cannot perform the normal cell functions and thus die quickly. Only a few mutated cells that do survive lose their ability to maintain normal cell growth. Potentially cancerous cells are often destroyed by the body s immune system. DNA and its associated repair enzymes have a precise self-checking system that cuts and repairs any abnormal DNA segments before mitosis occurs. How then does cancer occur? The chance of developing cancer is increased when the risk of genetic mutations is increased. Some chemical, physical, or biological agents increase the chance of mutations. These agents are called carcinogens if they produce mutations that cause cancer. Carcinogens include the following. Ionizing radiation, such as ultraviolet rays and X-rays, can break DNA strands and cause an increase in mutations. Chemical substances such as cigarette smoke can cause mutations. Physical irritants, such as foods that cause a continual wearing down of the lining of the small intestine, can cause mutations. Biological agents that can cause cancer include viruses that attack the DNA of normal cells. For example, the AIDS virus has been linked to a type of skin cancer called Kaposi s sarcoma. Therefore, getting HIV increases a person s risk factor for this cancer. Heredity affects mutations. Most cancers require two or more mutations in a gene before cancer can occur. If a person inherits a particular mutation, only one more mutation in the same gene may be needed to cause cancer. Researchers estimate that heredity may be a factor in 5 7 percent of all types of cancer. In this simulation you will act as a DNA sequence checker in a cell. You must find all the mistakes in the DNA or the cell will become cancerous and lead to the death of the organism. Biotechnology Manual 123
OBJECTIVES Compare sequences of DNA bases to find mutations. Analyze statistics about cancer occurrence and age. Materials (per group) laboratory recordsheets pencils Safety No extra precautions are needed. Procedure 1. Imagine that you are the DNA sequence checker in a cell. First, estimate do not count the total number of mistakes you expect to find in the following two DNA base sequences. Write your estimate on the first estimate line on your laboratory recordsheet. Then carefully examine the two DNA base sequences. Look for base pairs that have the wrong complementary bases. Circle the base pairs that are wrong. Answer question 1 on your recordsheet. AATTGCGAATCATGCAGCCTGACCGCTAAACCCGATCGCTTAAGGCCTTAACCGTCAGACTA TTAACGGTTAGTACGTCGGACTGGCGATTTGGGCTAGGGAATTCCGGAATTGGCAGTCTGAT CAGCCTGACCGCTAAACCCGATGATGCAGCCTGACCACGTCGGTACTTAACCGTCAGATGACCG GACGGTCTGGCGATTTGGGCTACTACGTCCGACTGGTGCAGCCATGAATTGGCAGTCTTCTGGC 2. Suppose a strand of DNA were removed from the cells lining the lungs of a man who smokes three packs of cigarettes per day. Estimate the number of mistakes you expect to find in the following DNA base sequence from the smoker s lung cells. Write your estimate on the second estimate line on your recordsheet. Then examine the DNA base sequence. Look for base pairs that have the wrong complementary bases. Circle the bases that are mismatched. Answer question 2 on the recordsheet. GAATTGGCAGTCTGATGCAGCCTGACCACGTCGGTAAGGCCTTAATTGCCAATCATGCAGATTGG CTTAAGCGTCAGACTACGTGGGACAGGTGCAGCGATTCCCGAATTAAGGGTTAGTTCGTCTAACC 3. Examine the data in the table. Answer question 3 on the recordsheet. Percentage of People Who Develop Cancers at Certain Ages BIRTH TO 39 40 TO 59 60 TO 79 Males 1.68 (1 in 60) 7.51 (1 in 13) 32.27 (1 in 3) Females 1.91 (1 in 52) 9.29 (1 in 11) 23.06 (1 in 4) California Cancer Facts and Figures, 1995 by American Cancer Society, California Division, Inc. 124 Biotechnology Manual
4. The higher incidence of cancer with age may be caused by a slowing down of the DNA sequence checker. Estimate the number of mistakes you expect to find in the following DNA base sequence. Write your estimate on the third estimate line on your recordsheet. To simulate slower checking, find the number of mistakes in the strand below. Answer question 4 on the recordsheet. CAGCCTGACCGCTAAACCCGATGATGCAGCCTGACCACGTCGGTACTTAACCGTCAGATGAC- CGCCGGAATTCCGGACTGCTA GTCGGACTGGCCATTTGGGCTACTACGACGGACTGGTGCAGCCATGAATTGGCAGACTACTG- GCGGCCTTAAGGCCTGACGAT Biotechnology Manual 125
Laboratory Recordsheet 13 A Simulation of DNA Mutations and Cancer Estimate #1: Estimate #2: Estimate #3: ANALYSES AND CONCLUSIONS 1a. How many mistakes did you find? If you found the right number, you have saved the cell from cancer! But you must remain on guard for more mutations to come. If you did not find all the mutations, your cell is now cancerous. b. For each of the mistakes, explain what was wrong. c. Compare your estimate #1 to the actual number of mistakes. Explain any differences between the two numbers. 2a. How many mistakes did you find? 126 Biotechnology Manual
b. Compare your estimate #2 to the actual number of mistakes. Explain any differences between the two numbers. 3a. Using the information in the table, describe the relationship between age and cancer. b. Explain what factors you think would contribute to this relationship. c. Cigarette smoke is the number-one cause of cancer in the United States today. About 25 percent of all cancer deaths are due to cigarette smoke. Using your knowledge of cancer, explain why. 4a. How many mistakes did you find? Biotechnology Manual 127
b. Compare your estimate #3 to the actual number of mistakes. Explain any differences between the two numbers. c. Would this cell develop into a cancerous cell? Explain your reasoning. 128 Biotechnology Manual