SUPPLEMENTAL MATERIAL Supplemental Methods: Histology of Heart Hearts were fixed in 4% paraformaldehyde (ph 7.4) overnight, embedded in paraffin, and serially sectioned into 5-µm slices. Standard hematoxylin and eosin (HE) staining or immunofluorescence was performed with these slices. Measurement of Myocardial Infarct Size To measure the infarct size, isolated perfused hearts were frozen at -80 C for 10 min and cut into slices (5-6 slices/heart), which were then incubated in a sodium phosphate buffer containing 1 % 2,3,5-triphenyl-tetrazolium chloride for 15 min to visualize the unstained infarcted region. Infarct and left ventricle (LV) areas were determined by planimetry with Image/J software from NIH. The infarct size was calculated as infarct area divided by LV area. To measure the infarct size of rat hearts in vivo, at the end-point, the animals were anesthetized with sodium pentobarbital (50 to 100 mg/kg i.p. to effect) and heparinized (400 USP U/kg, i.p.). The heart was excised and the ascending aorta was cannulated (distal to the sinus of Valsalva), then perfused retrogradely with Alcian blue dye (5 % solution) to visualize the area at risk (AAR). The coronary artery was re-occluded at the site of occlusion before perfusion with Alcian blue solution. The subsequent procedures were the same as those for ex vivo hearts. The infarct size was calculated as infarct area divided by AAR 1. 1
Echocardiographic Evaluation of Cardiac Morphology and Function We first trained mice on 2 or 3 separate occasions by picking them up by the nape of the neck and holding them firmly in the palm of one hand in the supine position, with the tail held tightly between the last two fingers. The left hemithorax was shaved, and transthoracic echocardiography was performed using a Doppler echocardiographic system (GE vivid7) equipped with a 13 MHz linear transducer (GE i13l). The heart was first imaged using the two-dimensional mode in the parasternal long-axis and short-axis views. The short-axis views, including papillary muscles, were used to position the M-mode cursor perpendicular to the ventricular septum and LV posterior wall. Images obtained during training sessions were not recorded. Once the mice were acclimated to these procedures, images were stored in digital format on a magnetic optical disk for review and analysis. Measurements of the LV internal end-diastolic diameter (LVIDd) were taken at the time of the apparent maximal LV diastolic dimension, whereas measurements of the LV internal end-systolic diameter (LVIDs) were taken at the time of the most anterior systolic excursion of the posterior wall. LV ejection fraction (EF) was calculated by the cubic method: LVEF (%) = {(LVIDd) 3 - (LVIDs) 3 }/ (LVIDd) 3 100, and LV fraction shortening (FS) was calculated by FS (%) = (LVIDd - LVIDs) / LVIDd 100. The data are averaged from 5 cardiac cycles. PI3K Activity Hearts of or mice were perfused on a Langendorff apparatus with or without IPC (four cycles of 5 min of ischemia followed by 5 min of reperfusion), homogenized and immunoprecipitated with PI3K-p85 antibody (Upstate). Immunoprecipitated enzyme and 2
PI(4,5)P2 substrate were incubated for 1 h at room temperature in the reaction buffer. Kinase reaction was stopped by pelleting the beads by centrifugation and transferring the reaction mixture to the incubation plate and incubated overnight at 4 o C with a PI (3,4,5) P3 detector protein, then added to the PI (3,4,5) P3-coated microplate for 1 h for competitive binding. A peroxidase-linked secondary detection reagent and colorimetric detection (absorbance was measured at 450 nm) is used to detect PI (3,4,5) P3 detector protein binding to the plate. The colorimetric signal is inversely proportional to the amount PI (3,4,5) P3 produced by PI3 kinase. Adenoviral Infection, hypoxia and H 2 O 2 treatment of Neonatal Rat Ventricular Myocytes Adenovirus-mediated gene transfer was implemented after cardiomyocytes were cultured for 24 h in serum-free DMEM, then cultured for 48 h in DMEM containing 10% FBS in the presence or absence of an adenoviral vector expressing GFP-MG53 or GFP or MG53-shRNA or a scramble-shrna as previously described 2. In a subset of experiments, cardiomyocytes were subjected to hypoxia conditions. In brief, cells were cultured in RPMI1640 / 5 % FBS for 48 h after adenoviral infection for 24 h. Then, the medium was changed to serum-free RPMI1640 saturated with 95% N 2 /5% CO 2, and cells were placed in a 37 C airtight box saturated with 95% N 2 /5% CO 2 for various period of time. O 2 concentrations were < 0.1 % (Ohmeda oxygen monitor, type 5120). For normoxia controls, culture medium was changed to RPMI1640 / 5% FCS / 10% HS, and cells were placed in a 37 C / 5% CO 2 incubator for 3-24 h before analysis. In another subset of experiments, myocytes were insulted with H 2 O 2 for 24h. 3
Real-time PCR The following primer pairs were used for quantitative real-time PCR: 18S RNA, 5 -GGA AGG GCA CCA CCA GGA GT-3 (forward) and 5 -TGC AGC CCC GGA CAT CTA AG-3 (reverse). The primers for MG53 were 5'-CGAGCAGGACCGCACACTT-3' (forward) and 5'-CCAGGAACATCCGCATCTT-3' (reverse). Amplification was performed as follows: 94 C for 30 s and 30 cycles at 94 C for 30 s, 55 C for 30 s, and 72 C for 30 s. The cycle number at which the emission intensity of the sample rose above baseline was referred to as Ct (threshold cycle) and was proportional to target concentration. Data presented are the average of at least 4 independent experiments. Gene silencing through RNA interference The sequence of MG53-shRNA was GAGCTGTCAAGCCTGAACTCT, while the sequences of CaV3 shrna was GACATTCACTGCAAGGAGATA. The sequence of the scramble-shrna was GCCTGCCGTCCAAAGTTGTAA. Adenovirus expressing GFP-MG53 fusion protein was packaged using the Stratagene Adeasy system. Adenoviruses expressing CaV3-shRNA, or the scramble-shrna were generated in HEK293 cells using the BLOCK-iT adenoviral RNAi expression system, according to the manufacturer s protocol (Invitrogen). The efficiency of gene knockdown was assessed by Western blotting and functional studies at 72 h after adenoviral shrna transfection. Co-immunoprecipitation 4
Cells were lysed in lysis buffer A (30 mm Hepes (ph7.6), 100 mmnacl, % Nonidet P-40, and protease inhibitors mixture) on ice for 10 min, and the lysates were clarified by centrifugation at 4 C for 10 min at 13,000 rpm. The supernatant was mixed with nprotein A Sepharose TM 4 Fast Flow (GE Healthcare) and the antibody and incubated at 4 C for 2 h. The resins were then washed three times with lysis buffer A, and the bound proteins were detected by Western blotting. Materials Antibodies of p-erk1/2, ERK1/2, p-akt, Akt, p-gsk3β, GSK3, p-stat3, STAT3, COX IV, and GAPDH were from Cell Signaling Technology. The antibodies of β-actin, PKCε and β-tubulin were from Santa Cruz. The antibody of CaV3 was from Abcam. The antibodies of Kir6.2 and Connexin 43 were from Bioworld Technology. The antibody of PKG was from Stressgen. The antibody of p85-pi3k was from Upstate. MG53 antibody was described previously 3. The Akt inhibitor was from Calbiochem (Cat. #: 124005). Unless indicated otherwise, all chemicals were from Sigma. References: 1. Shen YT, Depre C, Yan L, Park JY, Tian B, Jain K, Chen L, Zhang Y, Kudej RK, Zhao X, Sadoshima J, Vatner DE, Vatner SF. Repetitive ischemia by coronary stenosis induces a novel window of ischemic preconditioning. Circulation. 2008;118:1961-1969. 2. Shen T, Zheng M, Cao C, Chen C, Tang J, Zhang W, Cheng H, Chen KH, Xiao RP. Mitofusin-2 is a major determinant of oxidative stress-mediated heart muscle cell apoptosis. J Biol Chem. 2007;282:23354-23361. 3. Cai C, Masumiya H, Weisleder N, Matsuda N, Nishi M, Hwang M, Ko JK, Lin P, Thornton A, Zhao X, Pan Z, Komazaki S, Brotto M, Takeshima H, Ma J. MG53 5
nucleates assembly of cell membrane repair machinery. Nat Cell Biol. 2009;11:56-64. 6
Supplemental Figures A. B. MG53 GAPDH Data Supplement Figure I: No morphological differences between wild type () and mice at the age of 2-3 months. (A) Representative immunoblot of MG53 protein levels in myocardial lysates from and mice. (B) HE staining of coronal sections of hearts from and mice.
GFP-MG53 MG53 GAPDH Adv-GFP 10 30 60 Adv-GFP-MG53 10 30 60 (m.o.i.) 80 kd 53 kd Data Supplement Figure II : Overexpression of Adv-GFP-MG53 in cardiomyocytes. Representative immunoblot of MG53 and GFP-MG53 protein levels in lysates of cardiomyocytes infected with Adv-GFP and Adv-GFP-MG53 at indicated titers for 24 h (n = 5).
A. MTT ** ** Hypoxia Adv-GFP Adv-GFP-MG53 - - - - + - - - + + + + - + - - - + B. MTT ** ** H 2 O 2 Adv-GFP Adv-GFP-MG53 - - - - + - - - + + + + - + - - - + C. MTT * ** Hypoxia Scramble-shRNA MG53-shRNA Adv-GFP-MG53 - + + + + + - - + - + - - - - + - + - - - - + + Data Supplement Figure III: A-C
Data Supplement Figure III : Overexpression of MG53 protects cardiomyocyte against hypoxia- and oxidative stress-induced cell death, whereas knockdown of MG53 acerbates cell death. (A) Overexpression of MG53 protects cardiomyocytes against hypoxia-induced cell-death. Cell viability was indexed by MTT assay in cells infected with Adv-GFP or Adv-GFP-MG53 (30 m.o.i.) for 24 h and then subjected to hypoxia for 12 h (n = 12, ** p <1 vs groups in the absence of hypoxia or Adv-GFP-MG53, p <1 vs hypoxia and hypoxia + Adv-GFP). (B) Overexpression of MG53 protects cardiomyocytes against H 2 O 2 -induced cell-death. Cell viability was indexed by MTT assay in cells infected with Adv-GFP or Adv-GFP-MG53 (30 m.o.i.) for 24 h and then subjected to H 2 O 2 (200 μm) treatment for 24 h (n = 12, ** p <1 vs groups in the absence of H 2 O 2 or Adv-GFP-MG53, p <1 vs H 2 O 2 and H 2 O 2 + Adv-GFP). (C) MG53 gene silencing worsens hypoxia-induced cell death (12 h). Cell viability of NVMC in the presence or absence of Adv-MG53, MG53-shRNA or Scramble-shRNA, assayed by MTT (n = 12, * p <5, ** p <1 as indicated).
A B PKCε PKG GAPDH GAPDH PKCε/GAPDH PKG/GAPDH C D Mitochondria Kir6.2 Connexin 43 GAPDH Cox IV Kir6.2/GAPDH Connexin 43/Cox IV Data Supplement Figure IV: Expression of PKCε, PKG and Kir6.2 at protein level was not altered in hearts. Representative immunoblots and average data of PKCε (A), PKG (B), Kir6.2 (C) and mitochondria Connexin 43 (D) protein levels in myocardial tissues from and mice (n = 4 for each group).
MG53 CaV3 Merged Data Supplement Figure V: Colocalization of MG53 and CaV3. Confocal immunofluorescence costaining to visualize the colocalization of MG53 (red) and CaV3 (green) in an adult cardiomyocyte (scale bar is 10 μm).
A. B. PI3K-p85 CaV3 GAPDH GAPDH PI3K-p85 protein (fold of ) CaV3 protein (fold of ) Data Supplement Figure VI: Expression of p85 subunit of PI3K (PI3K-p85) or CaV3 at protein level was not altered in hearts. (A) Representative immunoblots and average data of PI3K-p85 protein levels in myocardial tissues from and mice (n = 4 for each group). (B) Representative immunoblots and average data of CaV3 protein levels in myocardial tissues from and mice (n = 9 for each group).
Scramble-shRNA + - + - CaV3-shRNA - + - + Adv-GFP + + - - Adv-MG53 - - + + p-erk ERK 1/2 GFP-MG53 MG53 CaV3 2 Scramble-shRNA CaV3-shRNA * p-erk/erk 1/2 1 0 Adv-GFP Adv-MG53 Data Supplement Figure VII:. Gene silencing CaV3 blocks MG53 overexpression-mediated activation of ERK 1/2. Representative immunoblots and statistical data of phosphorylated and total ERK 1/2 in the lysates of NVMC infected with Adv-GFP or Adv-MG53 (30 m.o.i., 24 h) with or without Adv-CaV3- shrna or Adv-scramble-shRNA (n = 5; * p <5 vs all other three groups).
Supplemental Table Data Supplement Table I. Cardiac Function and Morphology Parameters (n = 8) HR LVIDd LVPWd LVIDs LVPWs EF FS HW BW HW/BW (bpm) (mm) (mm) (mm) (mm) (%) (%) (g) (g) (g/kg) 635.6±19.1 3.02±7 0.71±2 1.76±3 1.11±4 78.86±1.38 41.64±1.27 0.16±1 23.40±1.44 6.88±0.23 624.2±13.3 2.89±0.14 0.67±3 1.61±8 1.11±4 81.59±5 44.12±7 0.15±1 23.10±0.37 6.61±0.40 HR, heart rate. LVID, left ventricle internal diameter. LVPW, left ventricle posterior wall thickness. EF, ejection fraction. FS, fraction shortening. HW, heart weight. BW, body weight. d, diastolic. s, systolic Values are mean ± s.e.m..