ONLINE SUPPLEMENT ANGIOTENSIN-(1-7) PREVENTS CARDIOMYOCYTE PATHOLOGICAL REMODELING THROUGH A NO/cGMP DEPENDENT PATHWAY. Enéas R.M. Gomes 1, Aline A. Lara 1, Pedro W.M. Almeida 1, Diogo Guimarães 1, Rodrigo R Resende 2, Maria J. Campagnole-Santos 1, Michael Bader 3, Robson A.S. Santos 1, Silvia Guatimosim 1 1 Department of Physiology and Biophysics, Federal University of Minas Gerais, Belo Horizonte, MG, 31270-901, Brazil 2 Institute of Learning and Research Santa Casa of BH (IEPSC BH), Belo Horizonte, Brazil 3 Max-Delbrück Center for Molecular Medicine (MDC), Robert-Rössle-Str. 10, D-13125 Berlin, Germany Short title: Protective signaling by Ang-(1-7) in cardiomyocytes Address for correspondence Silvia Guatimosim Institute of Biological Sciences Federal University of Minas Gerais Av. Antônio Carlos 6627 Belo Horizonte, MG - CEP: 31270-901 - Brazil Phone: (31) 3409-2952, FAX: (31) 3409-2924 E-mail: guatimosim@icb.ufmg.br 1
Expanded Materials and Methods Ang II infusion in TG rats A 14-day infusion of Ang II (6 µg/kg/h) or vehicle (0.9% NaCl, 0,5 µl/h) was performed using osmotic minipumps (ALZET, model 2002) implanted subcutaneously in the dorsal region under tribromoethanol anesthesia (2.5%, 1 ml/100 g of body wright), as previously described 1. Systolic Blood Pressure Measurement For monitoring systolic blood pressure (SBP) we performed the current tail-cuff method 2, 3. SBP was measured by the tail-cuff method using a XBP1000 Series Rat Tail Blood Pressure System (Kent Scientific, Torrington, CT). Cardiac and cardiomyocyte hypertrophy measurements To analyze the extension of cardiac hypertrophy we performed a heart weight/tibia length ratio measurement. For cardiomyocyte hypertrophy we measured cellular area in adult ventricular cardiomyocytes or in NRCM stained with anti-α-actinin antibody. Confocal images were analysed using LSM image browser software (Zeiss). DAF- measurents in neonatal cardiomyocytes Measurement of NO production in living NRCM was done using the membrane permeable fluorescent indicator DAF-FM (Molecular Probes) as previously described 4. NO measurements were performed in NRCM treated with peptides for 36 h. 2
Cytoplasmic/Nuclear fractionation Adult ventricular myocytes were harvested in ice-cold homogenization RIPA buffer (150 mm NaCl, 0.5% deoxycholate, 1% Triton X-100, 1: 300 Sigma protease inhibitor cocktail and 50 mm Tris-HCl at ph 7.4). The homogenate was centrifuged at 100 g for 5 min (4 C). The resulting supernatant was centrifuged again at 600 g for 5 min (4 C) to obtain the nuclear pellet and the cytoplasmic extract (supernatant). The pellet was incubated with RIPA buffer containing 0.3% SDS and DNAse (1 mg ml 1 ) for 30 min (4 C) and then centrifuged at 2000 g for 10 min (4 C) to obtain the nuclear extract (supernatant), as previously described 5. Purity of cytosolic and nuclear cell fractions was assessed with anti-gapdh and anti-histone 3 antibodies. GAPDH was found only in the cytosolic fraction whereas histone-3 was found only in the nuclear extract. Western blot Adult ventricular myocytes were harvested as described above and protein content was quantified according to Bradford protein assay 6. 40-60 µg of protein were separated by SDS-PAGE. Antibodies and their sources are as follows: anti-nfatc3 1:1000 (Santa Cruz BioTech), anti-gsk3β 1:1000 and anti-phospho (Ser 9) GsK3β 1:1000 (Cell Signaling), CaMKII 1:1000 (SAB), phospho-camkii 1:1000 (Millipore), anti-histone-3 1:1000 (Cell Signaling), and anti-gapdh 1:5000 (Clontech). Immunodetection was carried out using enhanced chemiluminescence (Amersham Biosciences). Protein levels were expressed as a ratio of optical densities. Quantitative Real time PCR 3
Total RNA was extracted from isolated ventricular cardiomyocytes using Trizol (Invitrogen, São Paulo, Brazil). For quantitative PCR (qpcr), total RNA was treated with DNase I (Ambion, Austin, TX, USA) and first strand cdna was synthesized using High Capacity cdna Transcription Kit (Applied Biosystems, CA, USA) according to manufacturer s instructions. After reverse transcription, the cdna was subjected to qpcr on a 7500 Real Time PCR System (Applied Biosystems, CA, USA) using Power SYBR Green PCR Master Mix (Applied Biosystems, CA, USA). Relative quantification of gene expression was done with the 2 - Ct method using the beta actin gene expression to normalize the data. Primers used were: ANF FW: 5 - GGATTTCAAGAACCTGCTAGA -3 and RE 5 - CTTCATCGGTCTGCTCGCTCA - 3 ; BNP FW 5 - CTCTGGGACCACCTCTCAAG -3 ND RE 5 - ACACTGTGGCAAGTTTGTGC -3 ; β-mhc FW 5 - CCTCGCAATATCAAGGGAAA -3 and RE 5 - TACAGGTGCATCAGCTCCAG -3. TGF-β FW 5 - GAAGCCATCCGTGGCCAGAT-3 and RE 5 - CCAGTGACGTCAAAAGACAG-3. Immunofluorescence Cardiomyocytes were fixed in PFA 4% and permeabilized with Triton X-100 0.5%. Antibodies and their sources were as follow: anti-nfatc3 (Santa Cruz BioTech), anti-α-actinin (Sigma). Anti-rabbit and anti-mouse antibodies conjugated to Alexa-488 and Alexa-633 (Molecular Probes) were used at a dilution of 1:1000, nuclear staining was performed with 4,6-Diamidino-2-Phenylindole (DAPI) 1:50, as previously described 7. 4
Reagents The peptides angiotensin-(1-7), A-779, and angiotensin II were from Bachem. Unless specified, other reagents were obtained from Sigma Chemical Corp. 5
References 1. da Silva LM, Nardoni Goncalves BA, Roberto da SJ, ugusto Souza Dos SR. Altered cardiovascular responses to chronic angiotensin II infusion in aged rats. Regul Pept. 2005;132:67-73. 2. Krege JH, Hodgin JB, Hagaman JR, Smithies O. A noninvasive computerized tailcuff system for measuring blood pressure in mice. Hypertension. 1995;25:1111-1115. 3. Whitesall SE, Hoff JB, Vollmer AP, D'Alecy LG. Comparison of simultaneous measurement of mouse systolic arterial blood pressure by radiotelemetry and tail-cuff methods. Am J Physiol Heart Circ Physiol. 2004;286:H2408-H2415. 4. Dias-Peixoto MF, Santos RA, Gomes ER, Alves MN, Almeida PW, Greco L, Rosa M, Fauler B, Bader M, Alenina N, Guatimosim S. Molecular mechanisms involved in the angiotensin-(1-7)/mas signaling pathway in cardiomyocytes. Hypertension. 2008;52:542-548. 5. Oliveira RS, Ferreira JC, Gomes ER, Paixao NA, Rolim NP, Medeiros A, Guatimosim S, Brum PC. Cardiac anti-remodelling effect of aerobic training is associated with a reduction in the calcineurin/nfat signalling pathway in heart failure mice. J Physiol. 2009;587:3899-3910. 6
6. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248-254. 7. Guatimosim S, Amaya MJ, Guerra MT, Aguiar CJ, Goes AM, Gomez-Viquez NL, Rodrigues MA, Gomes DA, Martins-Cruz J, Lederer WJ, Leite MF. Nuclear Ca2+ regulates cardiomyocyte function. Cell Calcium. 2008;44:230-242. 7
Supplemental Figures Supplemental Figure 1: Ang II induced cardiomyocyte hypertrophy is prevented in TGR rats. A. Representative immunofluorescence images of cardiomyocytes stained with antiα-actinin. B. Bar graph show averaged-cardiomyocyte area for ventricular cardiomyocytes from SD and TG rats treated or not with Ang II. n= number of cardiomyocytes analysed. *p< 0.05 when compared to other groups. Bar=10 µm. 8
Supplemental Figure 2: Overexpression of Ang-(1-7) in TG rats prevents TGF-β upregulation on Ang-II stimulation. TGF-β mrna levels were measured by real-time PCR. n= data from at least 4 independent experiments.*p< 0.05 when compared to SD group, #p< 0.05 when compared to TG group. 9
Supplemental Figure 3: Ang-(1-7) stimulates NO release in NRCM. A. Representative confocal images showing DAF-loaded untreated control (left panel), treated with Ang- (1-7) (middle panel) or with Ang-(1-7) and Ang II (right panel). Bar= 10µm. B. Bar graph shows significant increase in DAF fluorescence in NRCM following treatment with Ang-(1-7) for 36h. Treatment of NRCM with Ang-(1-7) and Ang II also resulted in significant NO production when compared to untreated cardiomyocytes. n= number of cardiomyocytes analysed. *p<0.05 when compared to control cells, and #p< 0.05 when compared to Ang-(1-7) treated cells. 10