Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Similar documents
IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

Supplementary Figure 1

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

SUPPLEMENTARY INFORMATION

Supplementary Figures

Supplementary Figure 1

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Expanded View Figures

Tissue factor-par2 signaling promotes diet-induced obesity and adipose

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Supplementary Figures

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

SUPPLEMENTARY METHODS

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow

University of California, San Diego La Jolla CA 92093

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

SUPPLEMENTARY FIGURES

SUPPLEMENTARY INFORMATION

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

Nature Immunology: doi: /ni.3412

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

SUPPLEMENTARY INFORMATION

Pearson r = P (one-tailed) = n = 9

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

Supplementary Materials for

Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

SUPPLEMENTARY INFORMATION

Imtiyaz et al., Fig. S1

SUPPORTING INFORMATIONS

(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

perk/erk STAT5B

Supplementary Materials for

Supplementary Figures

SUPPLEMENTAL INFORMATIONS

Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Pair-fed % inkt cells 0.5. EtOH 0.0

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

SUPPLEMENTARY INFORMATION

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance

SUPPLEMENTARY INFORMATION

RayBio KinaseSTAR TM Akt Activity Assay Kit

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Supplemental Information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Information

Supplementary Figure 1.

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human

Supplementary Materials for

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Supplementary Materials for

Inflammation & Type 2 Diabetes Prof. Marc Y. Donath

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the

Supplemental Figure 1

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC

Supplementary Information

SUPPLEMENTARY INFORMATION

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

Supplementary Figure 1. Successful excision of genes from WBM lysates and

We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

SUPPLEMENTARY INFORMATION

Innate Immunity & Inflammation

Transcription:

Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG Interleukin 6 (Il6) hemokine (-X- motif) ligand 10 (xcl10) Interleukin 1 beta (Il1b) Interleukin 18 (Il18) GGGGTTT G TGGTTGT GGT GTGTGTTTGTG TGGGTGTTGT G GTTGGTGT GTTGGGTTTTT GGGGGTGT T aspase-1 (asp1) GTGTGTGTGG TTGGGTTTGT NLR family, pyrin domain containing 3 (Nlrp3) GTGGTGTTGTGGGT TTTTGGGGTTT PYD and RD domain containing (sc/ Pycard) GTGTTGTGGT TTTTGTTTGGTGGTG Thioredoxin interacting protein (Txnip) TTGTGTGGTT TTGGTTGTTGTTGT NLR family, pyrin domain containing 1 (Nlrp1) TGGTTGT TTTGG NLR family, RD domain containing 4 (Nlrc4) TTTGTGTGTTGG TGTTGTG bsent in melanoma 2 (im2) GTGGGGGGG TTTGGTTTGGTTT rginase 1 (rg1) TGGTTTG G GGGTGTTTGGG T -type lectin domain family 7,member a (lec7a) TTTGGTG TGGGGGTGTTTTTG Programmed cell death 1 ligand 2 (Pdc1lg2) GTGGTTTGTTTT TTTGGGGTTTTG Interleukin 1 receptor anagonist (Il1rn) TTGTGGTTGGGTG TTTGGGGTGGGT Mannose-6-phosphate receptor (M6pr) ion channel, 1 (P2X 1) ion channel, 2 (P2X 2) ion channel, 3 (P2X 3) ion channel, 4 (P2X 4) ion channel, 5 (P2X 5) GTGGGGTTTTT T GTTTGTG TTTTGGTG TTTTGGGGTGT GTGTGTGGTTGT T GGGGTGGG TTTTTTTGT T TGGGTGGT GTTGTGTTT TGGTGTGGGTT G TTTGTGGTGGT GTGTGGTTTGTTG TTTGTGTGTGT GTGGGTTGGGGTG

ion channel, 6 (P2X 6) ion channel, 7 (P2X 7) TGTGTGTTGTTGT TTGGTTTTG Forkhead box P3 (Foxp3) TGTGTTGTTT GGGTTGGGTTGTTG coupled 1 (P2Y 1) coupled 2 (P2Y 2) coupled 4 (P2Y 4) coupled 6 (P2Y 6) coupled 10 (P2Y 10) coupled 12 (P2Y 12) coupled 13 (P2Y 13) coupled 14 (P2Y 14) Ribosomal protein L32 (L32) GGTGGGG GGTGTGTTGTGGTG GGGGGTTG GTGTTTGGTT GTTGTGGGGTTTT GGTTTGGGTTTG GTGGTTTT TTGTGTG GGGG TTGGTGG GGGGTTTG TTGGGG G GTTTGTTGT TTGTTGTGTTTG GGTGGTTTGGTGGGT G GTGTGTTGGTGT GGTTGGG TGGTTT Supplementary Figure 1. Upregulation of the Nlrp1 and Nlrc4 transcripts in WT with HFD. Quantitative-PR (q-pr) analysis of Nlrp1 and Nlrc4 mrn levels in epididymal WT from HFD-fed WT mice for the indicated time periods, compared to WT mice on LFD. N=5 mice per group. Mice were plated on HFD at age of 6w old, and the LFD mice were age-matched with 12w HFD. Values represent mean ± s.e.m. *, P<0.05, **, P<0.01 and ***, P<0.001.

Supplementary Figure 2. Morphological changes of epididymal WT with HFD feeding. Representative images of H&E stained WT sections from LFD and HFD male WT mice. The LFD mice were age-matched with 6w HFD mice. Note the increase of adipose-infiltrating cells upon long-term HFD. Supplementary Figure 3. Liver and pancreas morphology in mice with whole body P2X 7 - ablation. Representative images of H&E stained liver and pancreas sections from agematched LFD-fed WT, 12w HFD-fed WT and P2X 7 (KO) mice.

Supplementary Figure 4. Microarray analysis and the expression of P2 receptors in WT of WT and P2X 7 mice. () Heat-map showing the fold-changes of genes in WT of WT or P2X 7 (KO) mice on LFD or 12w HFD. Only genes that are upregulated (red) or downregulated (blue) by HFD in WT of WT mice (using the criteria of q < 0.001 and fold change > 1.5), a total of 3097 genes, shown. The fold-changes shown as signal log ratio. Each column represents an independent sample (n=3-4 mice each). (B) Q-PR analyses of P2X and P2Y genes in 12w HFD-fed WT and P2X 7 WT, n=10 mice per group. Of note, P2X 2, P2X 6, P2Y 4, P2Y 13 and P2Y 14 were not detected in WT in Q-PR. () RT-PR analysis of various P2Y genes in purified primary adipocytes, SV, epididymal WT, liver and peritoneal macrophages (Mac) of WT mice. L32, a loading control. No RT, negative controls with no reverse transcription.

Supplementary Figure 5. Whole body P2Y 2 -ablation does not affect metabolic status of obese mice nor inflammatory status of obese WT. () Growth curve of age-matched male WT and P2Y 2 mice upon HFD feeding. (B-E) Metabolic phenotypes of 21w-old male mice upon 15w HFD: Glucose tolerance test with 1g glucose/kg BW following a 16 h fast (B), insulin tolerance test with 36 μg insulin/kg BW following a 5 h fast (), epididymal WT weight (D), serum glycerol level following a 4 h fast (E). (F) Q-PR analysis of inflammatory and inflammasome genes in 15w HFD-fed WT and P2Y 2 WT. (G-H) Western blot analysis (G) and quantification (H) of pro-caspase-1 p45, cleaved caspase-1 intermediate p35, IκB, rg1, phosphorylated (p-s473) and total KT protein levels in 15w-HFD-fed WT and P2Y 2 WT following a 4 h fast. For all, n=5-13 mice per group. Values represent mean ± s.e.m.

Supplementary Figure 6. Reconstitution of adipose tissue SV fractions following congenic bone marrow transplantation (BMT) between D45.1 + and D45.2 + mice. BMT was performed between congenic D45.1 + and D45.2 + male 57BL/6 mice. 4w post recovery, flow cytometry analysis was used to determine the ratio of engraftment in spleen and SV, as indicated by D45.1 and D45.2 cell surface markers. Briefly, 2 10 5 cells were incubated with 20 μl of antibodies diluted at optimal concentrations for 20 min at 4. ells were washed three times with PBS and then resuspended in 200 μl PBS for analysis using the FSalibur Flow ytometer (BD Biosciences). PerP-D45.1, biotin-d45.2, FIT-avidin and isotype control antibodies were purchased from Biolegend, ebioscience and BD Biosciences. Note that the majority of SV cells are D45.1 + in D45.2 + mice after BMT, as shown in the bottom right panel. Supplementary Figure 7. Morphology of the liver and pancreas in 16w HFD-fed chimeric mice. Representative images of H&E stained liver and pancreas sections from 28w-old chimeric BMT mice after 16w HFD feeding (the same mice as shown in Fig. 5-6).

Supplementary Figure 8. Western blot analyses of caspase-1 p20 in WT of () WT mice under LFD and 12w HFD with a negative control from asp1 mice, showing the specificity of the antibody, (B) WT and P2X 7 mice under 12w HFD, and () chimeric BMT mice under 16w HFD. For all, samples were the same as the ones shown in the Figures 1D, 4 and 6. Upon electrophoresis on 12% SDS-PGE and transfer, the PVDF membranes were blocked in 5% milk for 40 minutes and then incubated with rat anti-mouse caspase-1 p20 antibody overnight. Only a weak signal indicating p20 at 20kD could be detected, together with a strong nonspecific band at 25kD. Nonetheless, these data are consistent with the data for the caspase-1 intermediate p35 shown in Figures 1, 4 and 6.