SITA 100 mg (n = 378)

Similar documents
Supplementary Table 1. Baseline Characteristics by Quintiles of Systolic and Diastolic Blood Pressures

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers

Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic

Supplementary Appendix

Supplementary Table 1. Patient demographics and baseline characteristics (treated patients).

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values

Supplementary Online Content

Clinical Trial Synopsis TL-OPI-518, NCT#

Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution

Tables of Normal Values (As of February 2005)

PFIZER INC. THERAPEUTIC AREA AND FDA APPROVED INDICATIONS: See USPI.

Supplementary Online Content

Supplementary Appendix

Supplementary Online Content

GALECTIN-3 PREDICTS LONG TERM CARDIOVASCULAR DEATH IN HIGH-RISK CORONARY ARTERY DISEASE PATIENTS

SYNOPSIS OF RESEARCH REPORT (PROTOCOL BC20779)

Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with

SUPPLEMENTARY DATA. Supplementary Table S1. Clinical characteristics of the study subjects.*

Nature Medicine: doi: /nm.3891

The clinical trial information provided in this public disclosure synopsis is supplied for informational purposes only.

SYNOPSIS 2/198 CSR_BDY-EFC5825-EN-E02. Name of company: TABULAR FORMAT (For National Authority Use only)

Table S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group

egfr > 50 (n = 13,916)

Bariatric Surgery versus Intensive Medical Therapy for Diabetes 3-Year Outcomes

Effective and Safe Management of Patients With Type 2 Diabetes and Chronic Kidney Disease Using Sitagliptin

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.

Statistical Analysis Plan FINAL. DexComG4 (DexCom Corporation) CGMMDI GOLD-Study

Supplementary Appendix

SUPPLEMENTAL MATERIAL

Supplementary Appendix

(n=6279). Continuous variables are reported as mean with 95% confidence interval and T1 T2 T3. Number of subjects

SUPPLEMENTARY DATA. Supplementary Table 1. Baseline Patient Characteristics

Supplementary Note Details of the patient populations studied Strengths and weakness of the study

pulmonary artery vasoreactivity in patients with idiopathic pulmonary arterial hypertension

JARDIAMET. (empagliflozin and metformin hydrochloride) 5 mg/500 mg, 5 mg/850 mg, 5 mg/1000 mg, 12.5 mg/500 mg, 12.5 mg/850 mg, 12.

Newer Drugs in the Management of Type 2 Diabetes Mellitus

Ertugliflozin Compared with Glimepiride in Patients with Type 2 Diabetes Mellitus Inadequately Controlled on Metformin: The VERTIS SU Randomized Study

Lab Values Explained. working at full strength. Other possible causes of an elevated BUN include dehydration and heart failure.

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)

SUPPLEMENTARY DATA. Supplementary Figure 1. PubMed

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.

Effects of Lowering LDL Cholesterol on Progression of Kidney Disease

Research Article The Effects of Simvastatin on Proteinuria and Renal Function in Patients with Chronic Kidney Disease

Table S1. Characteristics associated with frequency of nut consumption (full entire sample; Nn=4,416).

Laboratory Issues David Winsemius, MD, MPH Heritage Laboratories/HooperHolmes

Supplemental Table S2: Subgroup analysis for IL-6 with BMI in 3 groups

Multiphasic Blood Analysis

Supplementary Online Content

Data Analysis Plan for assessing clinical efficacy and safety of ER niacin/laropiprant in the HPS2-THRIVE trial

Clinician Blood Panel Results

Application of the Diabetes Algorithm to a Patient

ABFM Diabetes SAM Part 4

Supplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Online Appendix (JACC )

Module 2. Global Cardiovascular Risk Assessment and Reduction in Women with Hypertension

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled

Diabete: terapia nei pazienti a rischio cardiovascolare

Efficacy/pharmacodynamics: 85 Safety: 89

Study No.: Title: Rationale: Phase: Study Period: Study Design: Centres: Indication: Treatment: Objectives: Primary Outcome/Efficacy Variable:

Soo LIM, MD, PHD Internal Medicine Seoul National University Bundang Hospital

Patient enrolment details CKDOD registry

SCIENTIFIC STUDY REPORT

Efficacy and Safety of Canagliflozin Used in Conjunction with Sulfonylurea in Patients with Type 2 Diabetes Mellitus: A Randomized, Controlled Trial

CVD Prevention, Who to Consider

A factorial randomized trial of blood pressure lowering and intensive glucose control in 11,140 patients with type 2 diabetes

Supplementary materials

Know Your Number Aggregate Report Single Analysis Compared to National Averages

VITROS MicroSlide Assay Summary

Sample received from: Botali International Enterprise Co., Ltd Tianjin Port Free Trade Zone

Effects of Sodium-Glucose Cotransporter 2 Inhibitors on Metabolic Parameters in Patients With Type 2 Diabetes: A Chart-Based Analysis

ABSTRACT ORIGINAL RESEARCH. Ichiro Nakamura. Hiroshi Maegawa. Kazuyuki Tobe. Satoshi Uno

Table 1 Baseline characteristics of 60 hemodialysis patients with atrial fibrillation and warfarin use

Multiple Factors Should Be Considered When Setting a Glycemic Goal

(For National Authority Use Only) Name of Study Drug: to Part of Dossier:

MEMORANDUM. These reference ranges are effective immediately but sample requirements remain unchanged currently.

Author Correction to: Diabetes Ther /s

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

Supplementary Online Content

Metabolic Syndrome and Chronic Kidney Disease

DIABETES AND LABORATORY TESTS. Author: Josephine Davis

Addendum to Commission A14-12 (canagliflozin) 1

Cardiovascular Diabetology. Open Access ORIGINAL INVESTIGATION. C. R. L. Cardoso 1, N. C. Leite 1, C. B. M. Moram 2 and G. F.

Mipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3

Joslin Diabetes Center Joslin Diabetes Forum 2013: The Impact of Comorbidities on Glucose Control Scenario 2: Reduced Renal Function

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions

Faculty Affiliation. Faculty Disclosures. Learning Objectives. Prevalence and Burden of Diabetes in the United States

LEPTIN AS A NOVEL PREDICTOR OF DEPRESSION IN PATIENTS WITH THE METABOLIC SYNDROME

Supplementary Online Content

Clinician Blood Panel Results

Statin therapy in patients with Mild to Moderate Coronary Stenosis by 64-slice Multidetector Coronary Computed Tomography

Deprivation Study. The Freiburg Study

Form 8: Post Transplant Annual Followup

The role of physical activity in the prevention and management of hypertension and obesity

2.0 Synopsis. Choline fenofibrate capsules (ABT-335) M Clinical Study Report R&D/06/772. (For National Authority Use Only) Name of Study Drug:

Appendix This appendix was part of the submitted manuscript and has been peer reviewed. It is posted as supplied by the authors.

Clinical research. A b s t r a c t. Introduction

Supplementary Online Content

Effective Health Care

Transcription:

Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755) Glipizide 40 (11) 47 (12) 87 (12) Glipizide extended release 18 (5) 16 (4) 34 (5) Glyburide/glibenclamide 133 (35) 128 (34) 261 (35) Glimepiride 106 (28) 121 (32) 227 (30) Gliclazide 30 (8) 26 (7) 56 (7) Gliclazide modified release 50 (13) 37 (10) 87 (12) Glyburide micronized 0 2 (1) 2 (<1) Tolazamide 1 (<1) 0 1 (<1) Sulfonylurea daily dose at baseline, n (%) < Minimum daily dose required * 5 (1) 7 (2) 12 (2) Minimum daily dose required * 373 (99) 370 (98) 743 (98) Changed sulfonylurea dose, n (%) Unchanged 338 (89) 345 (92) 683 (90) Changed 40 (11) 32 (8) 72 (10) Decreased 33 (9) 31 (8) 64 (8) Increased 5 (1) 3 (1) 8 (1) Interrupted 4 (1) 0 4 (1) SITA, sitagliptin; CANA, canagliflozin. * Sulfonylurea minimum daily dose required at randomization is defined as: glipizide, 20 mg; glipizide extended release, 10 mg; glyburide/glibenclamide, 10 mg; glimepiride, 4 mg; gliclazide, 160 mg; gliclazide modified release, 60 mg; glyburide micronized, 6 mg. Only for subjects who had sulfonylurea dose change on at least 7 consecutive days.

Supplementary Table 2. Summary of Blood Pressure and Fasting Plasma Lipid Findings at Week 52 (LOCF). Parameter SITA 100 mg CANA 300 mg Systolic BP, n 367 375 Mean ± SD baseline, mm Hg 130.1 ± 14.0 131.2 ± 13.2 LS mean ± SE change 0.9 ± 0.7 5.1 ± 0.7 Difference vs SITA (95% CI) 5.9 ( 7.6, 4.2) * Diastolic BP, n 367 375 Mean ± SD baseline, mm Hg 78.6 ± 8.9 79.2 ± 7.8 LS mean ± SE change 0.3 ± 0.4 3.0 ± 0.4 Difference vs SITA (95% CI) 2.7 ( 3.8, 1.7) Triglycerides, n 353 365 Mean ± SD baseline, mmol/l (mg/dl) 1.9 ± 1.3 (168.2 ± 117.5) 2.1 ± 1.4 (182.7 ± 123.0) LS mean ± SE change, mmol/l (mg/dl) 0.06 ± 0.06 (5.7 ± 5.2) 0.03 ± 0.06 (2.4 ± 5.1) Median (IQR) percent change 4.8 ( 17.1, 33.0) 4.0 ( 26.8, 26.2) LS mean ± SE percent change 11.9 ± 2.9 9.6 ± 2.8 Difference vs SITA (95% CI) 2.3 ( 9.8, 5.3) LDL-C, n 352 363 Mean ± SD baseline, mmol/l (mg/dl) 2.5 ± 0.9 (96.3 ± 35.8) 2.6 ± 1.0 (101.1 ± 36.7) LS mean ± SE change, mmol/l (mg/dl) 0.01 ± 0.04 (0.4 ± 1.5) 0.16 ± 0.04 (6.3 ± 1.5) Median (IQR) percent change 1.3 ( 12.7, 16.7) 4.4 ( 9.9, 22.4) LS mean ± SE percent change 5.2 ± 1.8 11.7 ± 1.8 Difference vs SITA (95% CI) 6.4 (1.7, 11.2) HDL-C, n 353 364 Mean ± SD baseline, mmol/l (mg/dl) 1.2 ± 0.3 (45.7 ± 11.9) 1.2 ± 0.3 (45.6 ± 11.9) LS mean ± SE change, mmol/l (mg/dl) 0.01 ± 0.01 ( 0.5 ± 0.4) 0.07 ± 0.01 (2.9 ± 0.4) Median (IQR) percent change 1.7 ( 9.1, 9.2) 7.0 ( 2.7, 17.1) LS mean ± SE percent change 0.6 ± 0.9 7.6 ± 0.9 Difference vs SITA (95% CI) 7.0 (4.6, 9.3) LDL-C/HDL-C, n 352 363 Mean ± SD baseline 2.2 ± 0.9 2.3 ± 0.9 LS mean ± SE change 0.03 ± 0.04 0.01 ± 0.04 Median (IQR) percent change 0.6 ( 14.8, 20.1) 2.4 ( 17.6, 16.6) LS mean ± SE percent change 7.2 ± 2.0 6.1 ± 2.0 Difference vs SITA (95% CI) 1.1 ( 6.3, 4.2) Non HDL-C, n 353 364

Mean ± SD baseline, mmol/l (mg/dl) 3.3 ± 1.0 (129.3 ± 40.2) 3.5 ± 1.1 (136.6 ± 41.2) LS mean ± SE change, mmol/l (mg/dl) 0.04 ± 0.05 (1.6 ± 1.8) 0.18 ± 0.04 (6.7 ± 1.7) Median (IQR) percent change 0.7 ( 10.1, 13.7) 2.7 ( 9.0, 16.1) LS mean ± SE percent change 4.0 ± 1.5 7.9 ± 1.5 Difference vs SITA (95% CI) 3.9 (0.0, 7.7) LOCF, last observation carried forward; SITA, sitagliptin; CANA, canagliflozin; BP, blood pressure; SD, standard deviation; LS, least squares; SE, standard error; CI, confidence interval; IQR, interquartile range; LDL-C, low-density lipoprotein cholesterol; HDL-C, highdensity lipoprotein cholesterol; NS, not significant. * p<0.001 versus SITA. Statistical comparison versus SITA not pre-specified. p = NS versus SITA. Statistical comparison versus SITA not performed due to multiplicity control.

Supplementary Table 3. Summary of Changes in Indices of β-cell function at Week 52 (LOCF). Parameter SITA 100 mg (n = 378) CANA 300 mg (n = 377) HOMA2-%B, n 330 347 Mean (SD) baseline 56.8 (35.1) 52.5 (30.1) LS mean change (SE) 9.0 (2.6) 21.6 (2.5) Difference vs SITA (95% CI) 12.6 (5.8, 19.3) Proinsulin/insulin ratio, n 274 275 Mean (SD) baseline, pmol/miu 4.4 (2.5) 4.2 (2.6) LS mean change (SE) 0.2 (0.2) 0.6 (0.2) Difference vs SITA (95% CI) 0.4 ( 0.1, 0.9) Proinsulin/C-peptide ratio, n 193 221 Mean (SD) baseline, pmol/nmol 46.0 (21.5) 46.9 (24.3) LS mean change (SE) 1.0 (1.4) 3.3 (1.2) Difference vs SITA (95% CI) 4.3 ( 7.7, 1.0) AUC C /AUC G ratio (0-3 h), n 77 84 Mean (SD) baseline, pmol/mmol 122.7 (54.1) 113.4 (46.4) LS mean change (SE) 19.3 (4.2) 18.1 (3.9) Difference vs SITA (95% CI) 1.2 ( 12.2, 9.8) LOCF, last observation carried forward; SITA, sitagliptin; CANA, canagliflozin; HOMA, Homeostasis Model Assessment; SD, standard deviation; LS, least squares; SE, standard error; CI, confidence interval; AUC C, C-peptide area under the curve; AUC G, glucose area under the curve.

Supplementary Table 4. Summary of Laboratory Parameters at Baseline and Week 52. Parameter SITA 100 mg CANA 300 mg ALT, n Mean baseline, U/L 209 26.3 7.9 (50.0) 28.0 3.5 (38.1) Bilirubin, n Mean baseline, μmol/l BUN, n Mean baseline, mmol/l egfr, n Mean baseline, ml/min/1.73 m 2 Urate, n Mean baseline, μmol/l Hemoglobin, n Mean baseline, g/l 8.0 2.7 (35.5) 5.6 5.0 (25.2) 89.5 4.5 (14.6) 320.9 6.2 (18.3) 201 139.5 1.8 (6.5) 8.1 12.2 (40.1) 5.4 18.1 (30.5) 88.3 4.7 (11.6) 332.0 6.5 (18.2) 246 140.4 3.7 (6.2) SITA, sitagliptin; CANA, canagliflozin; ALT, alanine aminotransferase; SD, standard deviation; BUN, blood urea nitrogen; egfr, estimated glomerular filtration rate. Supplementary Figure 1. Change in A1C over time (Per-protocol). SITA, sitagliptin; CANA, canagliflozin; LS, least squares; SE, standard error; CI, confidence interval.

Supplementary Figure 2. Change in A1C from baseline to Week 52 by baseline A1C subgroup. * LS, least squares; SE, standard error; SITA, sitagliptin; CANA, canagliflozin. * A1C <8.0%: SITA 100 mg (n = 174), CANA 300 mg (n = 185); A1C 8.0 to <9.0%: SITA 100 mg (n = 122), CANA 300 mg (n = 125); A1C 9.0%: SITA 100 mg (n = 82), CANA 300 mg (n = 67).

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback