RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using

Similar documents
Supplementary Materials and Methods

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

Supplementary Data. Supplementary Methods:

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

Effects of metallothionein-3 and metallothionein-1e gene transfection on proliferation, cell cycle, and apoptosis of esophageal cancer cells

Supplementary Information

Supplementary Figure 1

BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL

Bin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng,

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

Supplementary data Supplementary Figure 1 Supplementary Figure 2

SUPPLEMENT. Materials and methods

Effect of Survivin-siRNA on Drug Sensitivity of Osteosarcoma Cell Line MG-63

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

Pair-fed % inkt cells 0.5. EtOH 0.0

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.

Supplemental Information

Title page. Title: MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

MicroRNA-92gene expression in epithelial ovarian cancer using a novel Real-Time Polymerase change reaction

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

In-vitro assay for Cytotoxicity activity in ethonolic extract of fruit rind of Couropita Guianensis aubl

Silibinin Is an Inhibitor of mir-24-3p Gene Expression in T47D Breast Cancer Cell Line

Annals of Oncology Advance Access published January 10, 2005

Cell lines and tissue samples. The 18 human NSCLC cell lines used in this. study included eight adenocarcinoma cell lines (ADCs; A427, A549, LC319,

York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).

Supporting Information

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Data Sheet. NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621

Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor

8. CHAPTER IV. ANTICANCER ACTIVITY OF BIOSYNTHESIZED SILVER NANOPARTICLES

Serum mirna expression profile as a prognostic biomarker of stage II/III

Supplementary Figure 1

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Instructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary webappendix

IN VITRO HORMESIS EFFECTS OF SODIUM FLUORIDE ON KIDNEY CELLS OF THREE-DAY-OLD MALE RATS

The Annexin V Apoptosis Assay

Instructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

RNA preparation from extracted paraffin cores:

SUPPLEMENTARY INFORMATION

The levels of mrna expression in the mouse brain were measured at 52 dpi after the brains were divided into five regions: cortex, hippocampus,

MolecularMD. One-Step qrt-pcr BCR-ABL Kit. Product Description and User Manual. For Quantitative RT-PCR Analysis of BCR-ABL. Contact Us.

SUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis

Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular. State Key Laboratory of Bioreactor Engineering, East China University of

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-

CHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000)

Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

Supplementary Appendix

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

Hopkins University, Howard Hughes Medical Institute, USA) (27). Cells were maintained in DMEM

A role of ghrelin in canine mammary carcinoma cells proliferation, apoptosis and migration

Supplementary Data. Different volumes of ethanol or calcium solution were slowly added through one of four

RESEARCH COMMUNICATION. sirna Mediated Silencing of NIN1/RPN12 Binding Protein 1 Homolog Inhibits Proliferation and Growth of Breast Cancer Cells

IN VITRO ANTICANCER ACTIVITY OF FLOWER EXTRACTS OF COUROUPITA GUIANENSIS

The effect of insulin on chemotherapeutic drug sensitivity in human esophageal and lung cancer cells

Supplemental Information

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

Human Rotavirus A. genesig Standard Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only

By: Dr Mehrnoosh Shanaki

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells

Nature Neuroscience: doi: /nn Supplementary Figure 1

RESEARCH ARTICLE. Comparative Evaluation of Silibinin Effects on Cell Cycling and Apoptosis in Human Breast Cancer MCF-7 and T47D Cell Lines

Supporting Information

SUPPLEMENTARY METHODS

Supplementary Information Titles Journal: Nature Medicine

Rotavirus A. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... Non structural protein 5 (NSP5) 150 tests.

Supplementary Information

Report on the Development of HP8 a Natural Herbal Formulation for Prostate Health

Oligo Sequence* bp %GC Tm Hair Hm Ht Position Size Ref. HIVrt-F 5 -CTA-gAA-CTT-TRA-ATg-CAT-ggg-TAA-AAg-TA

Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)

For Research Use Only Ver

For Research Use Only Ver

This chapter deals with the evaluation of alpha amylase inhibitory

SUPPLEMENTARY INFORMATION

Effec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers

Single Cell Quantitative Polymer Chain Reaction (sc-qpcr)

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma. patients. Supplemental data. First author: Baojun Wang

Electronic Supplementary Information. Direct chemiluminescence detection of circulating. micrornas in serum samples using a single-strand specific

A COH protocol with human recombinant FSH (Gonal-F, Merck Serono S.A., Madrid,

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

A novel isothermal amplification approach for rapid identification of BCR-ABL fusion genes at onset:

Journal of Chemical and Pharmaceutical Research, 2017, 9(12): Research Article

Prothrombin (Human) ELISA Kit

IL-13 Augments Compressive Stress-induced Tissue Factor Expression in Human Airway Epithelial Cells

Supplementary information

Transcription:

Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions. 2 µg of total RNA was used for cdna synthesis with random hexamers. For RT-PCR amplification of HOXB7, an initial amplification using HOXB7 primers was done with a denaturation step at 95 C for 10 min, followed by 28 cycles of denaturation at 95 C for 1 min, primer annealing at 55 C for 30 s, and primer extension at 72 C for 45s. Upon completion of the cycling steps, a final extension at 72 C for 5 min was done and then the reaction was stored at 4 C. Real-time PCR was carried out using an ABI PRISM 7500 Sequence Detection System (Applied Biosystems). Reactions were run in triplicate in three independent experiments. The geometric mean of housekeeping gene GAPDH was used as an internal control to normalize the variability in expression levels. The primer sequences are provided in Supplemental table 1. Expression data were normalized to the geometric mean of housekeeping gene GAPDH to control the variability in expression levels and were analyzed using the 2 -ΔΔCT method described by Livak and Schmittgen (1). Immunohistochemistry (IHC). IHC staining and scoring were done as previously described (2). Tissue sections were incubated with polyclonal mouse antibody against HOXB7 (Sigma-Aldrich, MO) at dilutions of 1:200 overnight at 4. For negative controls, the mouse anti-hoxb7 antibody was replaced with normal nonimmune

serum. The cells at each intensity of staining were recorded on a scale of 0 (no staining), 1 (weak staining = light yellow), 2 (moderate staining = yellowish brown), and 3 (strong staining = brown). An intensity score of 2 with at least 50% of malignant cells with positive HOXB7 staining was used to classify tumors with high expression, and < 50% of malignant cells with nuclear staining or < 2 intensity score classified tumors with low expression of HOXB7. Mouse anti-ki-67 monoclonal antibody (Dako, Copenhagen, Denmark) was used to evaluate the Ki-67 labeling index, which was calculated as the positive tumor nuclei divided by the total number tumor cells in each case. The cut-off value was based on a measurement of heterogeneity with a log-rank test statistical analysis with respect to overall survival. Using this assessment system, 30% was identified as an optimal cutoff value for Ki-67 labeling index. 3-(4,5 -Dimethyl-2-thiazolyl)-2,5 -diphenyl-2h-tetrazolium bromide (MTT) assays. Cells were seeded on 96-well plates at initial density of (5 10 3 /well). At each time point, The cells were stained with 100μl sterile MTT dye (0.5 mg/ml, Sigma-Aldrich, MO) at each time point for 4 h at 37ºC followed by removal of the culture medium and addition of 150 μl of dimethyl sulphoxide (DMSO) (Sigma-Aldrich, MO). The absorbance was measured at 570 nm, with 655 nm as the reference wavelength. All experiments were performed in triplicates. The data were analyzed by factor analysis and one-way ANOVA. Cell cycle analysis. Cell cycle distribution was examined by measuring the cellular DNA content using flow cytometry. Cells at 80-90% confluence were incubated for

36 h in the RPMI-1640 medium containing 0.5% FBS, then released through culturing back in RPMI-1640 medium with 10% FBS for 12 h. 1x10 6 cells were collected and fixed with 70% cold ethanol. After treated with RNase A (10 μg/ml) for 30 minutes at 37 C, the cells were resuspended in 0.5 ml propidium iodide (PI) solution (50 μg/ml in 0.1% sodium citrate with 0.1% NP-40). Cell cycle distribution was analyzed by FACScan cytometry (Becton-Dickinson, San Jose, CA, USA). References: 1. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402-8. 2. Liao WT, Wang X, Xu LH, et al. Centromere protein H is a novel prognostic marker for human nonsmall cell lung cancer progression and overall patient survival. Cancer 2009;115:1507-17.

Supplementary Table Supplementary Table S1. Primer Sequences Used for Reverse Transcription-Polymerase Chain Reaction (PCR) and Real-time Quantitative Reverse Transcription-PCR (5' to 3') Gene Forward primer Reverse primer Probe RT-PCR HOXB7 AGAGTAACTTCCGGATCTA TCGGCTTCAGCCCTGTCTT GAPDH CCACCCATGGCAAATTCCATGGCA TCTAGACGGCAGGTCAGGTCCAC HOXB7 AGAGTAACTTCCGGATCTA CAGGTAGCGATTGTAGTG FAM-ACCCCTGGATGCGAAGCTCA-TAMRA Real-time PCR p27kip1 CCGGTGGACCACGAAGAGT GCTCGCCTCTTCCATGTCTC FAM-AACCCGGGACTTGGAGAAGCACTGC-TAMRA cyclind1 CCGTCCATGCGGAAGATC ATGGCCAGCGGGAAGAC FAM-CTTCTGTTCCTCGCAGACCTCCAGCAT-TAMRA GAPDH GACTCATGACCACAGTCCATGC AGAGGCAGGGATGATGTTCTG FAM-CATCACTGCCACCCAGAAGACTGTG-TAMRA

Supplementary Table S2. Correlation between Clinicopathologic Features and HOXB7 expression in CRC Characteristics HOXB7 Expression Low High Age mean(56) 48 58 > mean (56) 55 63 Gender Male 55 72 Female 48 49 Histology Columnar adenocarcinoma 82 99 Mucinous adenocarcinoma 10 15 Others 11 7 Pathologic stage 1 11 6 2 62 81 3~4 19 25 Dukes Stage A 14 2 B 46 41 C 17 32 D 26 46 T stage 1~2 29 11 3 48 74 4 26 36 N stage 0 65 62 1 30 45 2 8 14 Distant metastasis 0 (no) 77 75 1 (yes) 26 46 Ki-67 labeling index <30% 57 45 31% 46 76 P 0.843 0.359 0.577 0.275 <0.001 0.012 0.071 0.042 0.007

Supplementary Table S3. Univariate and Multivariate Analyses of HOXB7 expression level in different prognostic parameters in patients with CRC using Cox Regression model Variable T stage Pathologic stage HOXB7 Category No. Patients 1~2 40 3 122 4 62 1 17 2 143 3~4 44 Low 103 High 121 Univariate analysis P Regression Coefficient (S.E) P Multivariate analysis Relative Risk 95% Confidence Interval <0.001 0.524(0.183) <0.001 1.689 1.366-2.890 <0.001 0.687(0.177) <0.001 1.987 1.544-3.366 0.006 0.824(0.225) 0.027 2.279 1.062-2.687