General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Similar documents
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin

Supporting Information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c

SUPPLEMENTARY INFORMATION

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

2.5. AMPK activity

Supplementary Figure 1

GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC

Supplementary Data Table of Contents:

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Supplementary Figure 1

GLUCOSE CONCENTRATION INCREASES IGF EXPRESSION FROM SYNOVIAL MEMBRANE

Supporting Information

Supplementary Materials

Supplementary Information

INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells

Protein extraction and western blot analysis Protein extraction was performed as

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

SUPPLEMENTARY INFORMATION

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

perk/erk STAT5B

Supporting Information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

Supplementary Information

Supplementary Materials for

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplemental Material:

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Cell Lysis Buffer. Catalog number: AR0103

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Mammalian Tissue Protein Extraction Reagent

Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

Pair-fed % inkt cells 0.5. EtOH 0.0

Supplementary Materials for

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

SUPPLEMENTARY INFORMATION

Role of Tyk-2 in Th9 and Th17 cells in allergic asthma

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

SUPPLEMENTARY FIGURES

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were

SUPPLEMENTARY INFORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Taylor Yohe. Project Advisor: Dr. Martha A. Belury. Department of Human Nutrition at the Ohio State University

1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University

Analyses of Intravesicular Exosomal Proteins Using a Nano-Plasmonic System

PRODUCT INFORMATION & MANUAL

SUPPLEMENTARY INFORMATION

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

RayBio KinaseSTAR TM Akt Activity Assay Kit

Supplementary Materials for

Effec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers

Exosomes function in antigen presentation during an in vivo Mycobacterium tuberculosis infection

The murine Resistin coding sequence was amplified from a fetal mouse cdna library and cloned

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2

Supplementary Figures

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

A copy can be downloaded for personal non-commercial research or study, without prior permission or charge

2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.

Transcription:

General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems Europe, Abingdon, UK) were measured enzymatically. Plasma triacylglycerol (TAG) and non-esterified fatty acids (NEFA) (Bio-vision, California, USA) levels were measured as previously described(33). Gene Expression Analysis: RNA was extracted from epididymal adipose tissue (EAT), 3T3L1 adipocytes and bone-marrow macrophages using TRI-Reagent and stored at -80 C. Single-stranded cdna was prepared using High-Capacity cdna Archive Kit (Applied Biosystems, Warrington, UK). Labeled primers and probes and TaqMan Universal Mastermix were obtained from Applied Biosystems. mrna expression was quantified by real-time PCR (RT-PCR) on an ABI 7700 Sequence Detection System (Perkin-Elmer Applied Biosystems). To control for between-sample variability, mrna levels were normalized to GAPDH for each sample by subtracting the C t for GAPDH from the C t for the gene of interest producing a ΔC t value. The ΔC t for each treatment sample was compared to the mean ΔC t for control samples using the relative quantification 2 -(ΔΔCt) method to determine fold-change. Immunoblot analysis: Protein was harvested from adipose tissue or cells by lysing in RIPA buffer containing complete protease (Roche Ltd, Dublin, Ireland) and phosphatase inhibitors. Protein concentration was quantified by Bradford assay (Bio-Rad Laboratories Inc., CA, USA). Equal concentrations of lysate (10µg) were reduced, separated by SDS-PAGE, transferred to nitrocellulose membranes, blocked and incubated overnight (at 4 C) in primary antibody. Blots were probed with antibodies to phosphorylated Akt, phosphorylated STAT3, SOCS3, serine-phosphorylated IRS-1 (Cell Signaling Technology, MA), whole cell IRS1, whole cell GLUT4, phosphorylated insulin receptor (IR) (Upstate, Millipore, MA), or β-actin (Abcam, MA). Blots were washed, incubated in secondary antibody and visualized using Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific Inc., USA). Levels of tyrosine phosphorylated IRS-1 were measured in adipose tissue protein lysates using a pathscan ELISA platform (Cell Signaling Technology, MA). Immunohistochemistry: Adipose tissue samples were fixed in formalin and paraffin embedded. Samples were deparaffinised and hydrated using xylene and alcohol. Antigen retrieval was performed in 0.01M citrate buffer at a PH of 6 for 30 minutes. To quench endogenous activity, sections were incubated in the dark in H 2 O 2 for 30 minutes at room temperature. After washing in PBS, sections were blocked and incubated with primary F4/80 antibody overnight at 4 C. Sections were incubated with secondary antibody (ABC kit from Vectastain) for 1 hour at room temperature, before washing with PBS. Sections were detected with DAB and counterstained with H 2 O 2 before being visualized using a Nikon 80i microscope.

Supplementary Figure 1: Comparison of glucose tolerance in high-fat fed WT and IL-1RI -/- mice with age-matched chow-fed controls. (A) Age-matched WT and IL-1RI -/- animals were placed on a chow-diet (10% kcal from fat) at 6-8wks of age for 12 weeks and GTT (1.5g/kg glucose) was performed and compared with high-fat fed animals (45% kcal from fat) (***p<0.001 w.r.t. IL-1RI -/- obese, n=12-31). (B) Area under the curve was calculated and expressed as arbitrary units (AU) (***p<0.001 w.r.t. age-matched counterpart; ###p<0.001 w.r.t. WT, n=8-31). (C) Weight of chow and high-fat fed animals at time of metabolic challenge (*p<0.05 w.r.t. age-matched WT, ### p<0.001 w.r.t. age-matched counterpart, n=8-31). (D) Growth curves for WT and IL-1RI -/- mice fed either a HFD or chow-diet for 12 weeks (*p<0.05 w.r.t. chow-fed WT mice, n=15-31).

Supplementary Figure 2: Immune cell numbers within adipose tissue of WT and IL-1RI -/- mice. (A) Recruitment of total CD3 + T-cells, cytotoxic T-cells (CD3 + /CD8 + /CD4 - ) and helper T-cells (CD3 + /CD8 - /CD4 + ) into adipose tissue of lean and obese mice (12wks HFD) was monitored by flow cytometry (***p<0.001 w.r.t. lean, n=8). (B) Recruitment of mast cells (F4/80 - /CD117 + ) into adipose tissue of lean and obese WT and IL-1RI -/- mice was monitored by flow cytometry (**p<0.01 w.r.t. lean, n=8). (C) Adipose tissue sections from lean and obese WT and IL-1RI -/- were stained for the macrophage marker F4/80 to monitor presence of crown-like structures within the tissue.

Supplementary Figure 3: Adverse effects of pro-inflammatory IL-1β and IL-6 on adipocyte biology. (A) The effect of 72h incubation with increasing concentrations (0.01-20ng/ml) of IL-1β on insulin (100nM)-stimulated 3 H-glucose transport into 3T3L1 adipocytes was evaluated. Basal and insulin-stimulated glucose transport was monitored with each dose of IL-1β and fold increase in transport over basal is presented (**p<0.05, **p<0.01 w.r.t. control cells, n=4). The effect of 72h incubation with increasing concentrations of IL-1β on insulin receptor substrate (IRS)-1 and GLUT4 (B) mrna and (C) protein expression. Effects of 72h incubation of IL-1β on (D) PPAR, fatty acid synthase (FASN), perilipin and SREBP-1c and (E) IL-6 mrna expression in 3T3L1 adipocytes (*p<0.5, **p<0.01, ***p<0.001 w.r.t. control, n=4). (F) Effect of IL-1β (10ng/ml) for 24h on IL-6 secretion from 3T3L1 adipocytes (***p<0.001 w.r.t. control, n=4). (G) The effect of 72h incubation with increasing concentrations of IL-6 (1-10ng/ml) on insulin (100nM)-stimulated 3 H-glucose transport into 3T3L1 adipocytes. Fold increase in glucose transport over basal is presented (*p<0.05, **p<0.01, ***p<0.001 w.r.t. control, n=4). (H) The effect of 72h treatment with IL-6 (10ng/ml) on IRS-1 and GLUT4 mrna levels (n=4).

Supplementary Figure 4: Baseline inflammatory mrna signature of WT and IL-1RI -/- BMM. WT and IL-1RI -/- bone marrow macrophages (BMM) were harvested and treated ± IL-1β (10ng/ml) for 24h. Effects of IL-1β on mrna levels of (A) IL-6, (B) IL-10, (C) SOCS3 and (D) SOCS1 were analyzed by real-time PCR (***p<0.001 w.r.t. control; ##p<0.01, ###p<0.001 w.r.t WT, n=4).