"Pseudomonas aeruginosa - PDF Free Download

1394/7/4: 1394/9/30: 1394 $!"/360 / Pseudomonas aeruginosa ETA oprl gyrb 2 1 "$! $%,. %.. +! *" &' () %!"!" $ Pseudomonas aeruginosa : <=> / 3.0 $%, 4 )* 4;" 49 0+: 4 / ) 4"76"5 4 301 2 ETA /oprl /gyrb.0: DE(Multiplex-polymerase chain reaction) Multiplex-PCRA $%, 3 4?0$ 4@ K"L 4 ;. 0< MJ!2 I +"= $! Pseudomonas aeruginosa 55 /"G1 -<>' <=> 3 : 4Q?0$ $=1 0: O4N 4. P", DNA.0: &"N;1 "!":" $6 M DE Cetrimide agar MacConkey agar.9 4"R1 ETA /oprl /gyrb $%,. 0G 100 100 /94/50 /96/36 T"141 gyrb /ETA /oprl$%, 49 %S". %; == % M: &"N;1. 1G W V4 Pseudomonas aeruginosa +: 4 4!. 7 4;" " *@ ETA oprl $%, : " *@ ETA /oprl /gyrb $%, % $ 4;" 7 gyrb $%, 4. 3.0+. $49 +"= $! Pseudomonas aeruginosa +: 4 9. %,/ /Pseudomonas aeruginosa: Pseudomonas aeruginosa %& ETA$oprL$gyrB ".'1 L=G 4$ /* ":M > :! 2043-204 :(360) 33 W1394 %G :S5 0; XE.- "."+, %*)'(!,< *%3 <) JKL9 Pseudomonas aeruginosa $% * 3 M: "Adhesions, Q "; *! ) & N7) O "3)P *!),$% 95 %,:.(3),% P *$& %Q $ A.7 ;P,< "Pseudomonas aeruginosa ;) 2V? "* %.7, >%. N7U.,$% EF) 2- *>, %& W A X 3.C D.(4-5),6 (Elongation factor \ *![&D *>,!% U4 *!.C DH< 3 oprl Pseudomonas aeruginosa?$@ *4A $% (Efflux pump).,$% ( *. U $%,$ $&6 Pseudomonas aeruginosa &' ( )$& *! $% "! ")$& 21 *!(1 $% "*..(1),& 7 ) "( )!*6.3 "4)% " "5 31 %6 >;, ">,,= *!9 $% : ;<% 1 B Pseudomonas aeruginosa?$@ *4A $%.(1) *4A $% %? $D.C D. 4.,$% %?!.C D 3?.C D. %E& ) F.C D "*.?$@ E7 *.?$@ *4A * GD F @.$. 3.(2) %6.$H)<) B Email: tsalehi@ut.ac.ir!" $ %& '() -1,-,-.&' + : -2 2043

P. aeruginosa ETAoprLgyrB o *!>g43 3 $ J96 N@3 "@ "$$%, *$j&? 1393 ) 7 $' $% o '6 $% ; *!^9 *$ 4 3,W "!&..,6 >g43 *?$% 37 *% $% Cetrimide agar MacConkey agar "' $%,% P U ) 24 J, % P),W.,6 *3),? Pseudomonas aeruginosa * *) "Pseudomonas aeruginosa * $]:,q 55 )6 3 "(Triple sugar iron agar) TSI agar "&6 *!3 Q ',q '? 3,7 Simmons citrate agar.(13-15),)$ `) P *!* 3 DNA o 1) * *.,% P >%) (Cinna Pure DNA KIT-PR1613) *% $% < )$ % *: 6 Multiplex-PCR 3 $% )$ % *: "V% 10 J, % P) *?$% 95 $% L *: "r 30 J, % P) *?$% 94 *% $% ^7 *: "r 70 J, % P) *?$% 55 *% "(@ s 35 %,W ) V% 1 J, % P) *?$% 72 *% J, % P) *?$% 72 *% $% ' ^7 *: Jf 3 3. $% >%) %$ *! & D.% 51 ` 3 t41 o 1) (Genbank data base) )%K & D "Oligo DNASIS,q >, 1 V% 10 t` u!$; (Reverse primer) )%.D & D (Forward primer),? $%! & D u, C t<.,% P Q ;),6.(11) ) :% d 6. ( Q '? >,6 >%) *!c1 " < U 2 ; 1X. PCR buffer " < U 10/95 dntp ; (5 mix " < U b 5 0/ ; MgCl 2 Mm) (Deoxynucleotide triphosphate).c D $]: *Q "Pseudomonas aeruginosa F ) * GD F V < *!N7) $% ) oprl?$@ *4A *!.C D.%$% ( * * ( $% &' ( "Pseudomonas aeruginosa Pseudomonas aeruginosa *P )6 *,$% ^9.(2 "6-9),$ $ JW,6 M: < 3 E) db) ) J%? ` * f >gd. e$; *$% "`..,6 $%!<$.(10-11) ),,? *!<; *7 3 6 *! $% $% 1 *$% E7 %Q.,6 >%) Pseudomonas aeruginosa 3 ;D ) 3 P DNA <W $' "! 3 )%. ).%6, gyrb gyra *!` ) (II <%. N' "3 P DNA *$@) *!` $% 3.(11-12),6!<$ E7 3 >%) "Pseudomonas aeruginosa *$ \$ $% gyrb "ETA "oprl ` 9 $% 4 (Multiplex-polymerase chain reaction) Multiplex -PCR * j? i14 K %& V 6$ W ") ) $% & N@3 * P A gyrb "ETA "oprl *!`.W "W<b. k,!.(11) %6 >,6,? Pseudomonas aeruginosa *!& $%.% < *!& 3 mb) EV JW<b l) " -Wb *W<b. $% < 21 *!& "0/05 EV V *b@,$% 95 & (Multiplex-polymerase chain reaction) Multiplex-PCR.1 gyrb-f gyrb-r ETA-F ETA-R oprl-f oprl-r Pa16s-F Pa16s-R (5 to 3 ) CCTGACCATCCGTCGCCACAAC CGCAGCAGGATGCCGACGCC GACAACGCCCTCAGCATCACCA CGCTGGCCCATTCGCTCCAGCG ATG GAAATGCTGAAATTCGGC CTTCTTCAGCTCGACGCGACG GGGGGATCTTCGGACCTCA TCCTTAGAGTGCCCACCCG gyrb gyrb ETA ETA oprl oprl (bp) 222 222 397 397 504 504 956 956 2044

P. aeruginosa $ Pseudomonas aeruginosa )* + ' " % & '.2 ( g )% $% *; 5 (9) 1, 4 (7) 234 3 (5) 5, 19 * 1 7 SPSS $ ; 3 >% ) *$ x $ 3,W *!>% %.,6 >% % P $ V )$ (version 19, SPSS Inc., Chicago, IL) P$ V 9 : Multiplex PCR \ $ 222 bp, < U< ) 63 gyrb *! ` N f 9 ;Q %$ *$ *! $ $% ) 6* ) 6 (, $% 100)! & * &! $% 956 bp, oprl ` * $ %, $% 96/36 "! * 7 & B &Q 3 ". &! ETA `,?, $% 94/5 504 bp, ( 3 =5 ( 3?* + +. ( + 12 12 % c! < *! & B. & %, W. 4. $ & 3 ) >% 3, 6$ * 6 ^ @*! & *, z J$., % >%, < (;E)). %$ + (polymerase chain reaction) PCR.)/ 0 1 + =5 >1 *+ 956 bp 504 bp 3397 bp 3222 bp *4 1394 "! /360 P Q ) >, < 2,?., % P *3 ),? "MacConkey agar ^ 9 * $ )( 4 1-7 Pseudomonas aeruginosa X 9. (, $% 1) N@3 (, $% 45) 4 Cetrimide agar ^ 9 * $.(1 U6), % 3ETA 3oprL $ & 3 >,6 *3 ),? * < ; 55 * $ $% >, 6 *$ j &? 2 1 :{., 6! & Multiplex-PCR L9 3 6 7 55 (100) g )% $% Multiplex-PCR 10 (1) 2 (4) 2045! >% ) %$ 3., % P (! ") " 397 bp, ETA oprl gyrb 3PCR (3 ) / 33! & * 3N! D &g D ", % >,6 >% %.1,-( *5- /

P. aeruginosa ETAoprLgyrB.(17) ) 9?$ *$% 4 \$ 7 $%.7 ;P ` *$ $U&! kw4 ) )$ $% N@3 3 >,6 *3),? Pseudomonas aeruginosa *!),% ETA ` *$%!),$% 93/67 ",&! $% g@) ` *b) PCR \$ )7: A %% 4 : { V Pseudomonas aeruginosa *!) )6 $% $% K V% r ETA 3 )?.(1) % >%) Pseudomonas aeruginosa *!) i14 *!),$% 95 3 ( ; $U&! *W,!4 $U&!. *W%) "&6 *!\$ E7 &? 3 )$& *!, < *!* i1 4 $% j ) ) \$, "Pseudomonas aeruginosa $% m9 \$ 51 Q $% i14 ". &!.%6 $& $% 4 $ 3 * P? Pseudomonas aeruginosa 3*$& $% r )6 *! ) $% * P(D *!\$ 51 $%,.,6 6% % $ l%) 21 "& '( )6$ 3 $ %@ *$;g)h) U4 & P,7 5? >a %P$)D *` P >g43 ]< l,' "*$1 = % " % V *$ X9. & : Q $%? @.$,.%$% f ",%& $% (gyrb ` }L@ ) gyrb *!` "X9. $% 100 ; >%) %$ *!`. $% ;. 4 *!&. $% ) %? P ",$% 4 "..% >,6 *3),? seudomonas aeruginosa &? 3 $% %? *>,!% ; $%. j6 Pseudomonas aeruginosa 3 >%) *W%), )% Q. PCR ; oprl ETA *!` )6 ~ 3 "Multiplec-PCR =: X9 $%.(),6,$% 70 6 )7: *$%.,% P JEr $ \$. 3 '? A.7 ;P 3 $.< * Cerniglia Khan >%),%& i14 >%) Pseudomonas aeruginosa )6 '? $%.(16),>% ETA ` *$% "!&,$% 96 ETA ` % 3 >%) Pseudomonas aeruginosa )6 \$;P ETA 3 4 oprl ` P J$ oprl 6% 1&! ETA ` 96/36 =: X9 JW<b. {.(17),% P )$. $% oprl ` *3),?,$% F V < *!N7) $% oprl `.%,$% 94/5 %$ $ P i14 '? %$% ( * ) * GD *) 2,%% \$;P $U&! de Vos.(2) g@) *! 3 >,6,? Pseudomonas aeruginosa 3 $.< * X9. ". &!.,% oprl `,? g&! Pseudomonas aeruginosa *P )6 * OprL ` $7 )7: 3 `. ">, )% { XE %& >%) >% $%$@ Pseudomonas aeruginosa )6 * K.(2) ) j ) )6 * oprl ` 3 $U&! Xu `,%& >%) Pseudomonas aeruginosa $& $% Pseudomonas aeruginosa?$@ *4A.C DH< %6 *. j ) )6 Q 7) 3 E fe References 1. Girlich D, Naas T, Leelaporn A, Poirel L, Fennewald M, Nordmann P. Nosocomial spread of the integronlocated veb-1-like cassette encoding an extendedpectrum beta-lactamase in Pseudomonas aeruginosa in Thailand. Clin Infect Dis 2002; 34(5): 603-11. 2. de Vos D, Lim A, Jr., Pirnay JP, Struelens M, Vandenvelde C, Duinslaeger L, et al. Direct detection and identification of Pseudomonas aeruginosa in clinical samples such as skin biopsy specimens and expectorations by multiplex PCR based on two outer membrane lipoprotein genes, opri and oprl. J Clin Microbiol 1997; 35(6): 1295-9. 3. Procop GW. Molecular diagnostics for the detection and characterization of microbial pathogens. Clin 2046

P. aeruginosa ETAoprLgyrB Infect Dis 2007; 45(Suppl 2): S99-S111. 4. Armstrong S, Yates SP, Merrill AR. Insight into the catalytic mechanism of Pseudomonas aeruginosa exotoxin A. Studies of toxin interaction with eukaryotic elongation factor-2. J Biol Chem 2002; 277(4): 46669-75. 5. Hussein SN. Detection of Exo A and OPR I genes in Pseudomonas aeruginosa using polymerase chain reaction. Iraqi J Biotech 2013; 12(1): 44-50. 6. Amini B, Kamali M, Zarei Mahmod Abadi A, Mortazavi Y, Ebrahim Habibi A, Bayat E, et al. Cloning of catalytic domain of exotoxin A from Pseudomonas aeruginosa. J Zanjan Univ Med Sci 2010; 1(71): 24-33. [In Persian]. 7. Aslani MM, Hahsemipour M, Nikbin VS, Shahcheraghi F, Eidi A, Sharafi Z. PCR identification of Pseudomonas aeruginosa based on two outermembrane lipoprotein opri, oprl, and exotoxin A gene. Yafteh 2009; 11(2): 21-6. [In Persian].. Najafimosleh M, Rashnotaie S, Ghaznavi Rad E, Abtahi H, Taleie Gh. Designing of the specific DNA primers for detection of the exoa, oprl and algd pathogenicity genes for rapid diagnosis of Pseudomonas aeruginosa. Tehran Univ Med J 2013; 71(): 493-501. [In Persian]. 9. Nikbin VS, Aslani MM, Sharafi Z, Hashemipour M, Shahcheraghi F, Ebrahimipour GH. Molecular identification and detection of virulence genes among Pseudomonas aeruginosa isolated from different infectious origins. Iran J Microbiol 2012; 4(3): 11-23. 10. Singh A, Goering RV, Simjee S, Foley SL, Zervos MJ. Application of molecular techniques to the study of hospital infection. Clin Microbiol Rev 2006; 19(3): 512-30. 11. Salman M, Ali A, Haque A. A novel multiplex PCR for detection of Pseudomonas aeruginosa: A major cause of wound infections. Pak J Med Sci 2013; 29(4): 957-61. 12. Daikos GL, Lolans VT, Jackson GG. Alterations in outer membrane proteins of Pseudomonas aeruginosa associated with selective resistance to quinolones. Antimicrob Agents Chemother 19; 32(5): 75-7. 13. Brooks GF, Butel JS, Morse SA. Jawetz, Melnick, and Adelberg's medical microbiology. 23 th ed. New York, NY: McGraw-Hill Medical; 2004. p. 401-7. 14. Farmer JJ, Herman LG. Pyocin typing of Pseudomonas aeruginosa. J Infect Dis 1974; 130(Suppl) :S43-S46. 15. Tang YW, Stratton ChW. Advanced techniques in diagnostic microbiology. New York, NY: Springer; 2006. 16. Khan AA, Cerniglia CE. Detection of Pseudomonas aeruginosa from clinical and environmental samples by amplification of the exotoxin A gene using PCR. Appl Environ Microbiol 1994; 60(10): 3739-45. 17. Xu J, Moore JE, Murphy PG, Millar BC, Elborn JS. Early detection of Pseudomonas aeruginosa-- comparison of conventional versus molecular (PCR) detection directly from adult patients with cystic fibrosis (CF). Ann Clin Microbiol Antimicrob 2004; 3: 21. 1. Yousefi Mashouf R, Esmaeili R, Yousef Alikhani M, Ghanbari M. Evaluation of exotoxin A gene and frequency of polymerase chain reaction sensitivity in detection of pseudomonas aeruginosa isolated from burn patients. Tehran Univ Med J 2014; 72(3): 167-73. [In Persian]. 2047

Journal of Isfahan Medical School Received: 26.09.2015 Vol. 33, No. 360, 4 th Week, January 2016 Accepted: 21.12.2015 Molecular Detection of the Genes gyrb, oprl, ETA, in Pseudomonas Aeruginosa Strains Isolated from Clinical Samples of Karaj City Health Centers, Iran Abstract Mahsa Ataee-Ashtiani MSc 1, Taghi Zahraei-Salehi PhD 2 Background: Pseudomonas aeruginosa is one of the most important factors for nosocomial infections, particularly in immunosuppressed patients such as children. Study on the genes gyrb, oprl, ETA, is essential to develop prevention programs; in this study, we tried to the study these genes in an Iranian population using multiplex-polymerase chain reaction (multiplex PCR) method. Methods: 55 different strains of Pseudomonas aeruginosa from clinical specimens collected from Karaj City Health Centers, Iran, after cultivation on the cetrimid agar and MacConkey agar media were detected via biochemical tests. DNA was extracted from bacterial genomics and the sequencing of target genes gyrb, oprl, ETA, was amplified. Findings: Molecular test results showed that the frequencies of oprl, ETA, gyrb and genes were 96.36, 94.50, 100 and 100 percent, respectively. Conclusion: The results show that the genes oprl and ETA are more sensitive and less specific for detecting Pseudomonas aeruginosa; but, using the genes gyrb and has the most specificity. Simultaneous use of the genes oprl, ETA, and gyrb would provide enough sensitivity to detect Pseudomonas aeruginosa from clinical specimens. Keywords: Pseudomonas aeruginosa,, Gene Original Article Citation: Ataee-Ashtiani M, Zahraei-Salehi T. Molecular Detection of the Genes gyrb, oprl, ETA, in Pseudomonas Aeruginosa Strains Isolated from Clinical Samples of Karaj City Health Centers, Iran. J Isfahan Med Sch 2016; 33(360): 2043-1- Department of Microbiology, Saveh Branch, Islamic Azad University, Saveh, Iran 2- Professor, Department of Microbiology, School of Vetrinary Medicine, University of Tehran, Tehran, Iran Corresponding Author: Taghi Zahraei-Salehi PhD, Email: tsalehi@ut.ac.ir 204