SUPPLEMENTARY INFORMATION - PDF Free Download

logfc SUPPLEMENTARY INFORMATION FACS purifiction for SCs & progenitors of emryo, dult nd tumour E E7 P Live Singlets Live Singlets d SCC mirna Signture: more thn FC in SCCs compred to Norml SCs mir- mir-3 mir- mir-9 mir- mir-3 mir-9 mir-7 mir-3 let-7i mir- mir-79 mir- mir-7 mir-9 mir- mir- mir-9 mir-93 mir-39 mir-33 mir- mir- mir-7 e Reltive mrna level DAPI CD3, CD7 DAPI Sc CD. GFP Linege Neg Lhx Live Epi HF Pdzrn3 E7 SSC-W GFP P SSC-W CD3 p3 FSC-W FSC-W Integrin α Lhx Epi Singlets HF-SC ORS Pdzrn3 P Sc DAPI CD3, CD7 DAPI CD3, CD7, CD CD CD CD3 Linege Neg Live Linege Neg Lhx Adult Sc SSC-W GFP Tumor SSC-W Integrin β Integrin α FSC-W FSC-W Integrin α c CSC / HF-SC Epi... Singlets Suprsl SC specfic mrkers in emryo & dult SC specfic mrkers in tumours HF-SCs epi-scs SCC-BC enriched SCC-BC depleted Fold Chne: SCC/HF-SC.. mir- mir-3 mir-9 mir- mir-7 mir- mir-c let-7c HF Ccnd Vlidtion of SCC signture mirs Bsl mir-c DAPI Cd CD3, CD7 CD mir-7 K Sc Integrin α Vim Tumor SSC-W GFP K FSC-W Epi HF HF-SCs nd progenitors epi-scs nd progenitors ORS (out root sheet) SCC-sl SCC-suprsl Lhx Nftc SCC UP sig mir- mir-3 mir-9 mir- mir-7 mir- SCC DOWN sig mir-c let-7c mir-c mir-7 f UP-regulted in SCCs DOWN-regulted in SCC-s 9.39 9. In situ hyridiztion of skin/scc undnt mirnas Emryo Adult Ppillom SCC mir- mir-3 mir- mir-7.79.999.77.7.93.77.37.79.73.9.373.779.77 3.9777 3.33379 3.7 3.99 3.97 3.7 3.337 3.3 3.39 3.977 3.333 3.99 3.797 3.37 3. 3. 3.9793 3.73 3.3 3.993 3.9.7339.7.7773.9.9.37.99..39.77.977.7799.33..33737. mir-9 mir- mir-3 mir-7 mir-3 mir-3 mir- mir-97 mir- mir- mir-7 mir- mir- mir-7 mir- mir- mir- mir- mir- mir- mir-99 mir- mir- mir-99 mir-3 mir- mir-9 mir-9 mir-3 mir-3 let-7c mir- mir- mir-33 mir-99 mir-3 mir- mir-7 mir- mir- mir- mir- mir-339 mir- mir-3 mir-9 mir-9 mir- mir- mir- mir- mir-c mir-3 mir-93 mir- mir- mir-3 mir-3 mir-9 mir-9 mir- mir- mir-7 mir- mir-3 mir-33 mir- mir- mir-7 mir-3c mir-7 mir- mir-3 mir- mir-3 mir- mir-3 mir- mir-77 mir-c mir-93 mir-93 mir-3 mir-9.79.39979.33.937.3.779.9.3.79.999.793.79.397.79.7.79.9.7.3.3779..339.33.393.797.93..79 -.73 -.3997 -.379 -.93 -.3339 -.339 -.77 -.979-3. -3.9-3.73-3.7-3.9797-3.337-3.3-3. -3.993-3.9799 -.7793 -.993 -.3 -.7 -.77 -.9 -.7393 -.79 -.77 -.37 Supplementry Figure mirna profiling of skin progenitors from different stges of development, homeostsis nd tumourigenesis., FACS scheme for norml stem cells nd progenitors t different stges of skin development, nd for ppillom nd SCC progenitors nd their progenies t different stges of mlignnt progression. Plese refer to Methods for detiled gtes. -c, Quntittive PCR to quntify the reltive mrna levels for group of cell-type specific mrkers to vlidte the purity of FACS isolted popultions: Lhx nd Pdzrn3 for HF progenitors (E7, P), Cd3 nd Lhx for dult HF stem cells, Trp3 for E7 Epiderml progenitors, Sc for P nd dult epiderml progenitors; Ccnd, Cd, Krt nd Vim for SCC-SC upregulted mrkers nd Krt, Lhx nd Nftc for SCC-SC downregulted mrkers compred to HF-SCs. Pired t-tests were used. At lest three iologicl replictes were performed; shown re men ± s.d. n = 3 independent experiments. P<.. P<.. d, SCC signture mirnas (cut off RRMM) tht re conserved etween mouse nd humn nd exhiit X chnge in sl cells (BCs) of SCCs reltive to norml SCs (DEseq P vlue <.). e, qpcrs confirmed suset of mirna signtures discovered in mirna profiling. Pired t-tests were used. At lest three iologicl replictes were performed; shown re men ± s.d. n = 3 independent experiments. P<.. P<.. f, mirna in situ hyridiztions of known nd SCC-relted mirnas in development nd mlignnt trnsformtion. These results showed tht mir-, n essentil mirna known to govern skin epithelium homeostsis, is rodly nd undntly expressed throughout skin development nd trnsformtion; mir-3, known to promote skin strtifiction nd suppress metstsis, is specificlly enriched in the suprsl lyers t ll stges; mir- known to mintin norml SC self-renewl nd drive skin tumourigenesis is trnsiently upregulted during erly stge of enign tumourigenesis; mir- 7 is rodly expressed during emryogenesis nd lter ecomes more restricted to suprsl lyers during dult nd tumour development. At lest three iologicl replictes were performed; shown re representtive imges. Scle r = µm. WWW.NATURE.COM/NATURECELLBIOLOGY Mcmilln Pulishers Limited. All rights reserved

Reltive Luciferse ctivity # of reds per reds SUPPLEMENTARY INFORMATION Genomic mir- locus RNA Pol II driven mir- mir- Drosh: mirna iogenesis SA-miR design SA-miR- HBGFP PGK U mir- mture sequence TAGCTTATCAGACTGATGTTGA 3 mir- mture sequence CAACAGCAGTCGATGGGCTGTC 3 SA-miR design SA-miR- HBGFP PGK U mirna trgeting TAGCTTATCAGACTGATGTTGA 3 CAACAGCAGTCGATGGGCTGTC 3 mir- trgets mir- trgets c.... % % % SA-miR Control... 3 - - + + - - + + - - + + - - + + - - + + - - + + mir- mir-9 mir-scr mir- mir-3(-) mir-7 Control SH-miR Vector N.S Scr 3'UTR mir- Sensor Accurte processing of mir end with SA-miR Enhnced trget sensitivity with SA-miR Reported ckone: SH-miR Control SA-miR Next genertion ckone: SA-miR Vector N.S p3 3'UTR mir-3 sensor Vector Scr 3'UTR mir- Sensor 3 Vector p3 3'UTR mir-3 Sensor Supplementry Figure Design nd chrcteriztion of lentivirl SAmiRNA expression vectors., Schemtic to show differences in mir- nd mir- sequences nd the corresponding strnd-specific SA-miRs., SA-miRNAs re pooled nd pckged into lentivirus to trnsduce cultured mouse SCC cells. Cells were isolted dys post infection, sorted with endogenous GFP, nd sujected to deep sequencing. The normlized reds for position nd isomirs were plotted to demonstrte fithful end processing using SA-miRNA system. Grey r represents control cells trnsduced with SA vector driving the expression of scrmled sequence lone, reflecting endogenous isomir levels. A different Scrmled sequence ws used from the shown in the grph. c, To compre the efficcy of our SA-miRs with oft-used SH-miRs (pentr/psm (U), Addgene 737), we performed luciferse reporter ssys to exmine the effects of mir- nd mir-3 on their estlished trget genes Scr nd p3,, respectively, expressed in either the SH-miR or the SA-miR ckone. All vectors were co-trnsfected with mir mimics t equl concentrtion in controls nd experiments. Similr sensor-medited inhiition (chieved y nti-sense sequences of mir- or mir-3) ws oserved from oth, ut stronger trget inhiition ws oserved only from SA-miRNA medited mir- nd mir-3 expression when using 3 UTR reporters. Pired t-tests were used to compre SH-miR to SHcontrol, nd SA-miR to SA-control, respectively. At lest three iologicl replictes were performed; shown re men ± s.d. n = 3 independent experiments. P<.. N.S. Not Significnt. WWW.NATURE.COM/NATURECELLBIOLOGY 3 Mcmilln Pulishers Limited. All rights reserved

SA-miR Tumour deth & prolifertion Cspse 3 Ki7 Ki7 quntifiction: or SA-miR tumours Ki7+ nuclei % SA-miR Clonl dominnce y mirs (DNA sequencing, cont. Fig. 3d) mir- Tumor () MIR- mir-99 Tumor () MIR-99 mir-c Tumor (3) MIR-c mir- Tumor () MIR- mir- Tumor () mir- Tumor () MIR- MIR- mir- Tumor () MiR- mir- Tumor () MiR- Supplementry Figure 3 More cndidte oncomirs in skin SCCs identified from in vivo pooled screen with SA-miRNA lirry., Cspse 3 nd Ki7 stining of tumours show unchnged poptosis nd heightened mitosis, respectively, in oncogenic HRs tumours derived from the SAmiRNA lirry trnsduced cohort compred to tht of lirry. Scle r = µm. At lest five iologicl replictes were performed; shown re representtive imges. Ki7 positive nuclei s percentge of totl nuclei ws quntified nd shown. Pired t-tests were used to compre SA-miR to. Shown re men ± s.d. n = independent experiments. P<.)., Trgeted deep sequencing of SA-miRNA inserts in the tumours emerging from nimls trnsduced with the SA-miR lirry showed tht three different mirna fmilies hd mirs tht were overrepresented in tumours. OncomiRs mir- nd mir- were lso cptured. Clonl dominnce ws not oserved in regions of the ckskin djcent to the tumour (shown) or in E. or P skin (see Fig. 3). Numers of tumours re shown in prentheses. The frequency of clonl dominnce in these tumours ws significntly less thn tht seen for mir- nd mir- (see Fig. 3). WWW.NATURE.COM/NATURECELLBIOLOGY Mcmilln Pulishers Limited. All rights reserved

In vivo epidermis: restricted expression of selected strnd with SA-miR Signl specificity shown with wounded mouse ckskin Scrmle mir- mir- Reltive mirna level mir- mir- SA-miR- SA-miR- mir- +/- mir- -/- c K K Scr Colony formtion ssy: HF-SCs mir- mir- Holoclone # d % EdU+ 7 3 Scr mir- mir- Anoikis in culture: MKs % AnnexinV+ 3 Scr mir- mir- mir-/ Supplementry Figure Vlidtion of mir- in driving SCC progression in vivo., Strnd-specific expression of SA-miR- nd SA-miR- vectors in vivo. Note tht SA-miR- elevted mir- ut did not ffect mir- levels; SA-miR- elevted mir-, ut did not ffect mir- levels in the skin epidermis 3 dys fter infection. Pired t-tests were used to compre SA-miR to. At lest three iologicl replictes were performed; shown re men ± s.d. n = 3 independent experiments. P<., P<.., In situ hyridiztions on dy 7 post-wound mouse ckskin, showing specific mir- nd mir- proe signls in heterozygous ut not mir--/- skin. MiR- locus ws trnscriptionlly ctivted during wounding nd hs een proposed to e regulted y numer of trnscription fctors in the context of norml skin nd cncer,3. Scle r = µm. c, SCs purified from the ulge of HFs from WT skin nd then trnsduced with either, SA-miR- or SA-miR- were sujected to colony formtion ssys in culture. Colonies were stined with Rhodmine B, weeks fter seeding t the concentrtions indicted t left. Numers of holoclones (defined y clones >µm in dimeter nd typicl of stem cells) re shown in the grph elow. Note elevtion in the numer of stem cells, prticulrly when mir- is elevted. d, SA-miR overexpression of mir- or mir- in kertinocytes resulted in their incresed prolifertion (top grph) nd decresed poptosis in suspension cultures (ottom grph). Pired t-tests were used to compre SA-miRs to. At lest three iologicl replictes were performed; shown re men ± s.d. n = 3 independent experiments. If not ssocited with pssenger strnd mir, denotes sttisticl significnce. P<., P<.. WWW.NATURE.COM/NATURECELLBIOLOGY Mcmilln Pulishers Limited. All rights reserved

Gel digestion: Crispr edited mouse SCCs sgrna Scr mir 7 p p p Supplementry Figure CRISPR/CAS strtegy to knockout mir- locus. Surveyor ssy: the CRISPR/CAS-edited mir- locus is mplified y PCR from ΔSCC genomic DNA nd then digested y n endonuclese enzyme tht only cuts the non-mtched DNA position (introduced y CRISPR editing). If editing is successful, the 7 p PCR product is cleved into nd p smller nds. WWW.NATURE.COM/NATURECELLBIOLOGY Mcmilln Pulishers Limited. All rights reserved

Normlized reds c d 7 3 Reltive mrna level mir nd mir expression in mouse nd humn SCCs mouse SCC humn HNSCC mir- mir- mir-3 mir-3 mir- mir- Normlized reds 3 mir- mir- mir-3 mir-3 mir- mir- SA-miR driven mir expression in humn cells FDu HCT 3 SA-miR- SA-miR- Reltive mrna level SA-miR- SA-miR- CRISPR/CAS trgeting of mir- locus in humn SCC cells GTACCACCTTGTCGGG TAGCTTATCAGACTGATGTTGACTGTTGAATCTCATGGCAACACCAGTCGATGGGCTGTC TGACATTTTGGTAT 3 (+) 3 CATGGTGGAACAGCCCATCGAATAGTCTGACTACAACTGACAACTTAGAGTACCGTTGTGGTCAGCTACCCGACAGACTGTAAAACCATA (-) PAM Trget (p) GTACCACCT - - - - - - - - - - GCTTATCAGACTGATGTTGACTGTTGAATCTCATGGCAACACCAGTCGATGGGCTGTC TGACATTTTGGTAT 3 GTACC- - - - - - - - - - - - - - - - - - - - - - - -GACTGATGTTGACTGTTGAATCTCATGGCAACACCAGTCGATGGGCTGTC TGACATTTTGGTAT 3 G- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ATGTTGACTGTTGAATCTCATGGCAACACCAGTCGATGGGCTGTC TGACATTTTGGTAT 3 - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - GATGGGCTGTC TGACATTTTGGTAT 3 GTACC - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - CTGTTGAATCTCATGGCAACACCAGTCGATGGGCTGTCTGACATTTTGGTAT 3 ATTCACATGG CAS9 mir- mir- sgrna (+) (-) mir- mir- Scrmle In situ hyridiztion: mir-/ expression in humn Norml Skin HNSCC Grde HNSCC Grde e Gel digestion: Crispr edited humn SCCs sgrna Scr mir 7 p 3 p p Tumour Vol (mm3) f 3 Humn SCCs pscc mir/ SCC p <. 3 Weeks post trnsplnt Supplementry Figure mir- expression nd CRIPSR/CAS in humn SCCs., mirna sequencing dt of SCCs show tht mir- ut not mir- 3 or mir- is stilized in mouse skin SCCs nd humn HNSCCs, even though ll of these mir guide counterprts re undnt in these tumours. Shown re men ± s.d. n = 3 independent experiments., In situ hyridiztion of mir- nd mir- in prffin-fixed humn tissue rrys with HNSCCs nd norml tissues. Note tht hyridiztions re not s elegnt s with frozen sections (see min Figures) ut the dt re still cler. Scle r = µm. c, Demonstrtion tht the SA-miR vectors used to drive mir- nd mir- chieve elevted expression in humn FDu nd HCT cells. At lest five iologicl replictes were performed; shown re men ± s.d. n = 3 independent experiments. P<., P<.. N.S. Not Significnt. Pired t-tests were used to compre SA-miRs to. d-f, CRISPR/CAS edited humn A3 SCC cells, surveyor ssy, nd deficiency in tumourigenesis. For oth mouse nd humn SCCs, top three predicted off-trget sites were sequenced nd no muttions were detected in the three clones tested (see Methods) Shown re men ± s.d. n = 3 independent experiments. Two-wy ANOVA with repeted mesurement ws performed. WWW.NATURE.COM/NATURECELLBIOLOGY 7 Mcmilln Pulishers Limited. All rights reserved

CAPN FKPM RGMA FKPM CAPN FKPM 3 - mir- cndidte trget expression in HNSCCs vs. Norml tissues p <. p <. p <. p <. HNSCC Norml HNSCC Norml p <. p =. p =.3 p <. ROR FKPM - HNSCC Norml HNSCC Norml FAM7A FKPM SSBP FKPM 3 HNSCC Norml Cndidte trget expression correltion with mir- in HNSCC p =.3 p =.39 p =. p =. 3 FAM7A FKPM LCA FKPM LCA FKPM HNSCC Norml - HNSCC Norml High Low High Low High Low High Low PPML FKPM PPML FKPM TIMP FKPM - HNSCC Norml FHL FKPM ROBO FKPM FHL FKPM - - - mir- cndidte trget expression in HNSCCs vs. Norml tissues p <. p <. p =.33 PDCD FKPM HNSCC Norml HNSCC Norml HNSCC Norml p =.9 UBL3 FKPM p =.9 - HNSCC Norml HNSCC Norml HNSCC Norml Cndidte trget expression correltion with mir- in HNSCC PDCD FKPM p =.7 High Low High Low PAIPB FKPM PAIPB FKPM p <. YOD FKPM p <. p =.99 High Low RGMA FKPM - p =. p <. p =.3 p =. 3. ROR FKPM SSBP FKPM - -. High Low High Low High Low High Low TIMP FKPM..... ROBO FKPM 3 - p =. p =.9 UBL3 FKPM High Low High Low YOD FKPM High p =. Low c Puttive mir- trget Puttive mir- trgets Low RGMA level correltes with poor survivl in humn HNSCC Low PDCD level correltes with poor survivl in humn HNSCC Low YOD level correltes with poor survivl in humn HNSCC P vlue=.9e- P vlue=.3e- P vlue=.99e-3 Supplementry Figure 7 More mir- nd mir- puttive trgets in SCCs., of mir- nd of mir- predicted trgets re downregulted in HNSCCs compred to norml tissues. Shown re men ± s.d. n = 3 for norml tissues nd n = 3 for tumours. Unpired t-test ws used to compre norml to tumour smples., Predicted trgets tht inversely correlte with mir- or mir- levels in tumours, respectively. Shown re men ± s.d. n = for tumour smples. Pired t-test ws used to compre low to high expression tumour smples. c, In ddition to mir- trget PHACTR (see min text), RGMA (mir- trget), PDCD(miR- trget) nd YOD(miR- trget) expression levels inversely correlted with poor prognosis in HNSCCs n = 7~33 tumour smples. Log-rnk test method ws used to compre ptient survivl etween high nd low expression smples. WWW.NATURE.COM/NATURECELLBIOLOGY Mcmilln Pulishers Limited. All rights reserved

SA-miR-.. pscc- SCC-SA-miR- Phctr αtu Vector WT PP Phctr αtu Supplementry Figure mir- trgets Phctr in SCCs. - Western lot showing suppressed levels of Phctr resulting from SA-miR- overexpression (), nd Phctr levels from WT or PP mutnt expression (). In, the numers indicte densitometry vlues normlized ginst α-tuulin nd mesured y ImgeJ. At lest three iologicl replictes were performed; shown re representtive imges. WWW.NATURE.COM/NATURECELLBIOLOGY 9 Mcmilln Pulishers Limited. All rights reserved

Phctr Western Blot (Suppl Figure 7d) SCC-SA-miR- pscc- SA-miR- Phctr Western Blot (Suppl Figure 7e) SCC-SA-miR- pscc- Control WT Phctr PP Phctr SA-miR- R Western Blot (Figure f) shphctr shscr SA-miR- Supplementry Figure 9 Whole Western Blot gel scn. WWW.NATURE.COM/NATURECELLBIOLOGY Mcmilln Pulishers Limited. All rights reserved

Supplementry References Cmpeu, E. et l. A verstile virl system for expression nd depletion of proteins in mmmlin cells. PLoS ONE, e9 (9). Yi, R., Poy, M. N., Stoffel, M. & Fuchs, E. A skin microrna promotes differentition y repressing stemness. Nture, 9 (). Ahmed, M. I., Mrdryev, A. N., Lewis, C. J., Shrov, A. A. & Botchkrev, N. V. MicroRNA- is n importnt downstrem component of BMP signlling in epiderml kertinocytes. Cell Sci., 3399 3 (). 3 Snd, M. et l. Microrry nlysis of microrna expression in cutneous squmous cell crcinom. J. Dermtol. Sci., 9 (). Supplementry Tle Legends Supplementry Tle : SCC signture mirs -- fold chnge (FC) of expression in SCC compred to their control SCs; whether lso cptured s pp-bc signture. Supplementry Tle : SA-miRNA lirry oligo sequences. Supplementry Tle 3: Counts of tumors with clonl dominnce cptured in screen. Supplementry Tle : 77 genes re more thn fold chnged in hed & neck SCCs compred to norml tissue. Supplementry Tle : genes re predicted to e mir- nd/or mir- trgets. Supplementry Tle : Puttive mir cndidtes correlte with ptient prognosis. Supplementry Tle 7: Brcodeded sequencing primers for SA-miRNA lirry. Supplementry Tle : Primers nd oligos used. WWW.NATURE.COM/NATURECELLBIOLOGY Mcmilln Pulishers Limited. All rights reserved