Qian Gao Fudan University

Qian Gao Fudan University

Outline Background & Objectives Genotyping methods Establish the epidemiological field sites Preliminary results of Molecular epidemiology of TB in China Molecular epidemiology of TB in Songjiang, Shanghai.

No. of Patient Tuberculosis in China Second largest number of tuberculosis 1600000 1400000 1200000 1000000 800000 600000 400000 200000 0 1990 1993 1996 1999 2002 2005 2008 (year) 患病人数 发病人数 新发病例 复治病例 Global Tuberculosis Control 2010, WHO The largest number of drug resistant patients Total drug resistance rate = 37.79%(560,000/year) Drug resistance among new patients = 35.16%(459,000/year) Drug resistance among treated patients = 55.17% (101,000/year) National DR-TB Survey(2007-2008)

Key issue of TB control What s the main cause of tuberculosis cases? Recent transmission or Latent TB reactivation What s the main cause of drug-resistant TB? Primary drug resistance or acquired drug resistance Wu P.,et al., PLoS One, 2010, e10468

Objectives To figure out the proportion of recent transmission in all culture-positive TB cases To figure out the proportion of primary drugresistant cases in all drug-resistant cases

Hypothesis: Recent transmission Unique Cluster Infection Dormancy Reactivation n

Genotyping Methods

IS6110-RFLP

Sopligotyping (Spacer oligo typing) IS6110 DR locus H37Rv X Spacer BCG H37Rv X Barnes PF, Cave MD. New Engl J Med 2003; 349:1149-56

VNTR (variable number of tandem repeats) 1 CGAATTCTTCGGTGGTCTCGAGTGCTCCG >>>>>>>>>>>>>>>>>>>>> 30 CTCATCTGCGCCGCTCCTCCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA 1 83 CTCATCTGCGCCGCTCCTCCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA 2 136 CTCATCTGCGCCGCTCCTGCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA 3 189 CTCATCTGCGCCGCTCCTGCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA 4 242 CTCATCTGCGCCGCTCCTGCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA 5 295 CTCATCTGCGCCGCTCCTCCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA 6 347 CATGGTCAGCCAGCGACGCTACACCGTAGGTTGGACACCATGAGTCAGAC <<<<<<<<<<<<<<<<<<<<< 3 4 5 Strain 1 Strain 2 Strain 3 A B C D 3 3 4 5 3 3 4 5 A B C D Strain 1 4 3 2 5 Strain 2 3 3 4 5 Strain 3 3 3 4 5

Genotyping Methods Spoligotyping: low discriminatory power IS6110-RFLP: high discriminatory power, but difficult to analyze VNTR: PCR-based, simple and easy to perform, digital number easy to compere between labs. H37Rv pattern 2 3 3 2 2 6 1 3 3 3 2 1 Variable discriminatory power: loci exhibited different discriminatory power among geographically distant areas

Ideally VNTR typing First line loci(for genotyping of all isolates) Select appropriate number of loci(8-12 loci) Stable,easy to perform and analysis Suitable discrimination power of each locus,high discrimination power when combined Second line loci (for genotyping of isolates clustered by 1 st line loci ) High similarity among Beijing strains, patients share identical 1 st line loci genotype could not have epidemiological links For isolates with identical 1 st line loci genotype, run on the same gel (avoid reading bias in different gels)

Select the VNTR loci Study fields Total Beijing genotype Sichuan 216 115 53 Guangxi 176 109 62 Shanghai 396 314 79 Shandong 206 160 78 Henan 197 177 90 Heilongjiang 184 159 86 Total 1375 1034 75 %

Discrimination power of Selected loci in different studies

Comparison of different VNTR loci Loci No. of strains No. of genotyp es No. of clusters No. of clustered strains HGI 95% CI VNTR-12 1211 794 154 571 0.9944 0.9928 0.9960 VNTR-15 1208 767 157 598 0.9937 0.9918 0.9956 VNTR-16 1071 837 119 353 0.9984 0.9978 0.9989 VNTR-7 1130 699 163 594 0.9940 0.9923 0.9958

TB genotyping Kit Identificatio n of M. tuberculosis M. tuberculosis Mtb Kit NTM Sequencing of 16S rrna Identificatio n of Beijing strains Cluster analysis Determination of Beijing strains deletion of RD105 region VNTR-12 for genotyping of all M. tb isolates For isolates clustered with VNTR-12, further high variable loci were used

Study Design Wuchang, Heilongjiang Study Design Prospective, population-based epidemiologic study From June 2009 to Dec 2010 Wusheng, Sichuan Weishi, Henan Fei, Shandong Songjiang, Shanghai Represent different regions of China Pingguo, Guangxi Fields Areas(km 2 ) Population Prevalence of TB cases (/100,000 people) Heilongjiang(Wuchang) 3,756 520,000 512 Shandong(Feixian) 1,893 950,000 330 Henan(Weishi) 1,307 868,000 497 Shanghai(Songjiang) 604 1,634,000 96 Sichuan(Wusheng) 966 838,000 544 Guangxi(Pingguo) 2,473 456,500 477

Study strategy Establish the epidemiological fields Screen all suspected TB patients Questionnaire Patients & Close contact Culture positive TB patients Indentify MTB DST Genotyping Clustered Unique Cluster investigation Elucidate the recent transmission model

Establish the epidemiological field sites TB hospital, 1-2 general hospital and several community clinics Human resource: 3-5doctors and 3-4 lab staff Instruments (Biosafety cabinets, incubator, Autoclave etc.) Laboratory capacity: Sputum AFB stain, Microscopy, Cult ure Epidemiologic Investigation: In both hospital & community In country level

Epidemiology field sites In province-level: Laboratory capacity Drug Susceptibility Test Liquid culture Molecular genotyping New diagnosis assays

Workshop Training Techniques of TB rapid diagnosis New methods of case-finding TB epidemiological database based on network Ethics in clinical research Biosafety, DST and conservation of strains in laboratory

Quality assurance Provided commercial products (culture and DST medium, staining and Genotyping Kit) and standard protocols The DST results reported by provincial CDC were confirmed by detecting the gene mutation Site supervision: twice per year

Internet-based database www.epitb.fudan.edu.cn To collect and manage the data Microscopy and culture VNTR genotyping DST results Clinical information of TB patients from questionnaires Demographic information of close contacts of TB patients from questionnaires

Network of Epidemiology field sites Sputum microscopy DST Epidemiologic investigation Internet-based database Sputum culture VNTR genotyping Data analysis Staff management Quality Control County-level lab Provincial lab Lab in Fudan University

Case finding Methods Passive case finding: screen suspected TB cases among those who go to TB hospital or suspected cases who are referred from general hospitals Active case finding: screen suspected TB cases who are recommended by community health workers Screening suspected TB patients Clinical symptom: cough for at least 2 weeks, fever, chest pain, weight loss Chest X-ray 3 sputum for AFB, 2 sputum for L-J culture Drug Susceptible Tests Proportion method on L-J medium (INH and RIF) Genotyping analysis 16-loci VNTR (identification of the clustered strains) DTM-PCR (identification of Beijing genotype strains)

Patients enrolled 11,942 suspected TB patients (Jun, 2009 Dec, 2010) 1470 (12.3%) culture-positive patients 1409 (95.8%) were identified as MTB isolates Field sites Suspected TB cases Culture Positive (%) Wusheng (Sichuan) 1136 201 (17.7) Pingguo (Guangxi) 2078 198 (9.5) 1375 (97.6%) had DST & genotyping results Songjiang (Shanghai) 2326 397 (17.1) Fei (Shandong) 3302 224 (6.8) Weishi (Henan) 2956 256 (8.7) Wuchang (Heilongjiang) 1144 194 (17.0) Total 11942 1470 (12.3)

Characteristics of TB patients Regions Total Male (%) Patient Age (%) <25 25~44 45~64 >65 Wusheng (Sichuan) 216 165 (75.3) 37 (17.1) 77 (35.7) 83 (38.4) 19 (8.8) Pingguo (Guangxi) 176 128 (71.9) 24 (13.6) 65 (36.9) 53 (30.1) 34 (19.3) Songjiang (Shanghai) 396 261 (66.0) 113 (28.5) 164 (41.4) 69 (17.4) 50 (12.6) Fei (Shandong) 206 158 (76.7) 39 (18.9) 35 (17.0) 61 (29.6) 71 (34.5) Weishi (Henan) 197 144 (73.1) 25 (12.7) 50 (25.4) 48 (24.4) 74 (37.6) Wuchang (Heilongjiang) 184 125 (67.9) 31 (16.7) 50 (27.2) 71 (38.6) 32 (17.4) Total 1375 981 (71.3) 269 (19.6) 441 (32.1) 385 (28.0) 280 (20.3)

Drug resistance In total, the rate of new TB cases was 87.7%. Regions New cases Re-treatment cases Total No. DR % MDR % Total No. DR % MDR % Wusheng (Sichuan) 172 12.2 5.8 32 50.0 31.3 Pingguo (Guangxi) 137 8.8 1.5 26 50.0 34.6 Songjiang (Shanghai) 359 12.2 3.1 37 29.7 21.6 Fei (Shandong) 167 21.6 7.8 9 55.6 44.4 Weishi (Henan) 122 11.5 3.3 35 31.4 22.9 Wuchang (Heilongjiang) 148 8.8 2.7 16 18.8 6.3 Total 1105 12.7 4.0 155 38.1 25.8 Primary drug resistance -- 70.3 52.4 -- -- --

Prevalence of Beijing strains In total, 1034 (75%) strains were identified as Beijing genotype. The distribution was significant varied in geographic regions in China (p<0.001). Sichuan Henan Shandong Shanghai Heilongjiang Study fields Total Beijing genotype % Wusheng (Sichuan) 216 115 53 Pingguo (Guangxi) 176 109 62 Songjiang (Shanghai) 396 314 79 Fei (Shandong) 206 160 78 Weishi (Henan) 197 177 90 Wuchang (Heilongjiang) 184 159 86 Guangxi

No associations of Beijing strains and DR Drug sensitivity * and anti-tb treatment history Total cases Beijing infection N (%) OR (95% CI) New cases DS 965 714 (74.0) 1.00 DR 140 105 (75.0) 1.04 (0.68-1.59) INH 119 92 (77.3) 1.15 (0.72-1.85) RIF 65 46 (70.8) 0.92 (0.52-1.64) MDR 44 33 (75.0) 1.12 (0.55-2.33) Re-treated cases DS 96 76 (79.2) 1.00 DR 59 45 (76.3) 1.09 (0.46-2.55) INH 51 39 (76.5) 0.99 (0.42-2.34) RIF 48 37 (77.1) 1.20 (0.49-2.94) MDR 40 31 (77.5) 1.09 (0.42-2.79)

Recent transmission of TB Study Settings Total patients Clustered patients Cluster proportion (%) Maximum no. of patients in a cluster Wusheng (Sichuan) 217 23 10.6 3 Pingguo (Guangxi) 176 38 21.6 4 Songjiang (Shanghai) 395 128 32.4 8 Fei (Shandong) 206 63 30.6 6 Weishi (Henan) 197 62 31.5 6 Wuchang (Heilongjiang) 184 72 39.1 17 Total 1375 386 28.0 -- The identification of clustered patients was restricted to the same field site.

Risk factors of recent transmission Patients with MDR/Beijing strains had significantly high clustering rate Variables Total Clustered (%) Unique (%) P value Adjusted OR(95% CI) MDR 69 24 (34.8) 45 (65.2) 0.025 1.949 (1.087-3.494) Beijing strains 869 270 (31.1) 599 (68.9) 0.002 1.779 (1.233-2.568) Smoking 449 135 (30.1) 314 (69.9) 0.040 1.350 (1.014-1.798) Han ethic 834 236 (28.3) 598 (71.7) 0.001 0.419 (0.254-0.694) BCG vaccination 283 76 (26.9) 207 (73.1) 0.058 0.725 (0.520-1.011) Multivariate analysis with multiple logistic regression model

Epidemiological link 10751 10778 09505 09512 17 patients in one cluster in Heilongjiang site 10714 09673 10435 09811 10400 09827 Case and ID 10333 10241 10173 10156 10058 10005 09907 Public place Confirmed transmission Probable link Possible link

Limitation & Improvement Study period is too short Extension in next five-year Case finding needs to improve Active case finding Culture positive rate is low (~30%) Sputum quality Liquid culture Molecular diagnosis

Incidence rate, N/100,000 Transmission of TB in Songjiang, Shanghai Characterizes of Songjiang Population: total about 1.5 million (0.5 million resident and 1 million of migrant) Industrial districts in Shanghai Resident Migrant 60 50 40 30 20 10 0 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 Map of Shanghai

TB control program in Songjiang Case finding Active case finding initiated at 2003, From 2007, intensify TB screening among resident persons of > 60 years old. Patient management DOTS project From 2003, Shanghai expanded the free TB DOTS program to migrants Laboratory tests 3 sputum for AFB, 2 sputum for L-J culture

Culture positive rate (%) Improvement of Laboratory ability Induced sputum improves the diagnosis of tuberculosis Field site No spontaneous sputum Success induced Increased rate of culture positive TB cases (%) Culture positive Songjiang 126 125 99.2 28 22.4 120 (%) 100 100 94.4 91.1 80 78.8 60 40 20 62.3 61.9 36.9 30.1 20.5 7.4 38.3 11.5 51.6 53.7 54 21.1 22.5 37.2 Sm(+) Cul(+) Sm (-) Cul(+) Cul(+) 0 2006 2007 2008 2009 2010 2011

Characteristics of TB patients Total 2007 2008 2009 2010 2011 Total (N) 808 85 124 185 186 228 Migrant (%) 67.5 55.3 63.7 66.1 71.5 71.5 Male (%) 67.2 77.6 66.1 63.5 68.0 66.4 Age (%) <45 yrs 69.4 60.0 61.3 68.8 71.0 76.2 45 yrs 30.4 40.0 37.1 30.7 29.5 23.8 Beijing strains(%) 76.2 68.2 72.6 78.1 81.5 74.9 Drug resistant(%) 16.4 22.4 21.8 13.5 12.5 17.0 MDR (%) 4.9 4.7 9.7 4.8 3.7 3.0

Cluster proportion by time period Year Cluster proportion within (%) 1 yrs 2 yrs 3 yrs 4 yrs 5yrs 2007 21.2 2008 7.3 15.8 2009 23.3 17.0 20.8 2010 18.5 24.4 19.9 21.5 2011 16.5 21.9 25.1 22.6 24.0 35.0 Cumulated proportion of clustered cases 30.0 25.0 20.0 15.0 10.0 2007+ 2008+ 2009+ 2010+ 5.0 0.0 2007 2008 2009 2010 2011

Sampling frame 2009-2011 Total TB cases (n=1535) Culture-positive (n=691,45%) Culture-negative (n=844,55%) Isolates genotyped Unable to obtain isolates (n=43) Yes (n=629, 90%) Remain for cluster analysis (n=599, 95%) Not available (n=19) False-positive cultures (n=30)

Characteristics of TB patients, 2009-2011 71% of the TB cases were from migrants. Characteristics Migrant cases (n=427) Resident cases (n=172) P value No. % No. % Female (sex) 167 39.1 38 22.1 < 0.001 Age (median, IQR) 27 22-38 55 37-71 < 0.001 BMI value (mean±sd) 20.6± 3.1 20.1± 3.0 0.08 Previously treated 29 6.8 21 12.2 0.03 Diagnosis delay days (median, IQR) 32 16-63 35 17-70 0.08 Clinical symptoms Cough 317 90.1 133 86.4 0.2 Cavity 174 51.5 80 53.3 0.7 Laboratory test Smear positive 240 68.2 98 63.4 0.3 Beijing strains 319 74.7 145 84.3 0.01 Drug resistant 81 19.0 30 17.4 0.6 MDR 15 3.5 8 4.7 0.5

25.7% (154/599) of patients were categorized into 55 clusters 24.3% in 2009, 24.4% in 2009-2010 25.7% in 2009-2011 Of the 55 clusters, Cluster analysis 24 (43.6%) were involved with both migrants and residents TB patients among migrants were less likely to be clustered (23.0%, 98/427 vs. 32.6%, 56/172, p=0.01), compared to resident patients. Cluster size No. of clusters No. of clustered patients Total Migrants only Residents only Both involved Total Migrant Resident 2 38 20 7 11 76 53 23 3 9 1 3 5 27 12 15 4 5.... 5 20 11 9 7 1.... 1 7 6 1 11 1.... 1 11 6 5 13 1.... 1 13 10 3 Total 55 21 10 24 154 98 56

Cluster proportion by age

Risk factors for genotypic clustering

Epidemiological link Super market In 52 cases, 2 cases were family members, 2 cases had experience of contacting with the same TB cases, 9 cases in were linked by places they frequently visited. In total, 11 cases (21.2%) had clearly epidemiological link.

Comparison with previous studies Cluster proportion North America, South Africa, Malawi et al. 30-70%, North European 15-19% High risk factors HIV+ homeless drug abuse low income et al. HIV+: easy from infection to diseases General population in Shanghai Transmission settings Close relative contact Bus Bar School Hospital, et al. Casual transmission

Suggestion Cluster proportion is not comparable with previous studied The Big challenge for China TB control program How to block the transmission of TB?

Summary Establishment of epidemiological field sites in six provinces in China. Cluster rate in China is not comparable with that in other countries Recently transmission is a important factor and should not be overlooked TB control is big challenge for China

Staff in each field sites Acknowledgement 11 th National five-year Key Project