Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC 58 675 mnoxo1 TCTTCCCGCTTCCTGTG GGTGGGGCTGGCC 58 435 mnox2 TCCTCTTGGTTTTGTGTGG CGTTCTTTTGCTCTTCC 60 652 mp22 phox TGGGGCGTCGGTGGGCCTG TCCCGCCTCTCTGTCCTGG 65 579 mp40 phox GCGCTGCGTCGGG TCCCGTGGTCCGG 60 537 mp47 phox GGGTGTTCCCCTTG CTCGGTTCCCTGCTT 58 533 mp67 phox TGCCTTCTGCTCGGTG TCCCTTTCCTCCCCTTCC 58 456 mnox4 CCTGCTCTTTGGCTGTCCCT CGGCTCTGCCCCTGG 60 311 mgapdh CTCGTCTCTGCGTGGTGG GCTCCCGCTCTCGCCC 60 300.T.: nnealing Temperature Supplementary Table 2. Primer sequences for conventional RT-PCR on human islets Gene 5 Forward 3 5 Reverse 3.T. ( C) Product (bp) hnox1 TTCGCCGCTGTCCTG CCTCCGTGGCCGC 60 353 hnox2 TGGTGGCTGGTGTT GGGTTGGGCTTCCTTTT 60 475 hnox3 CCGGGCGTCTCTTGGT CCGTGTTTCCGGGGGT 60 432 hnox4 CCGCCGCTCTCG CCCTGTTGCTTTGGTTT 60 417 hnox5 TCCTCCTCGTGTGGCTTCT GCTCGGGCGTCCTG 60 535 hgpdh CCCCTCTCTGGGG TCCCGTCTTCTGGGTGG 55 302 Supplementary Table 3. Primer sequences for real-time RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3 mnox1 CCCGCGGGTCGTGTT GCTGCCTCGCTTCCTCT mnox2 CTGGTGTGGTTGGGGCTGTGTC CGGCCGTGCTGCCCGGGT mnox4 CCGGCGTCCTGGCTTTCT TGCTTTTTCCCTCTTCTTGTT mcyclophilin CTGCTGCCCC GCCTCCGCCTTCGTCT Supplementary Table 4. Target sequence of ON-TRGETplus SMRTpool Nox2 sirn Target Sequence 1 Target Sequence 2 Target Sequence 3 Target Sequence 4 CGGGUUCUCUUUU UCUCCGCUCUUUCCC GUGUGGGCCUGUU GUUGCCCCGUCUG
Supplementary Figure 1. Morphology of pancreatic islets from control (WT) and Nox2-deficient mice. () Freshly isolated islets from WT (left panels) and (right panels) in culture medium seen by transmission light microscopy under two different magnifications. () Immuno-staining of pancreas sections on WT (left panels) and (right panels) using antibodies against insulin (green) revealing beta-cells and against glucagon showing alpha-cells (red). Nuclei were stained with DPI (blue). WT Footnote: Immunohistochemistry was perfomed on adult mouse pancreata harvested in cold PS and treated overnight at 4 C in 4% paraformaldehyde before embedding in paraffin. Then, 6µm thick tissue sections with 50µm intervals were mounted on adhesive-coated slides and incubated with primary antibodies for 2hr at room temperature with mouse anti-insulin (1:500 dilution; Sigma) and rabbit antiglucagon (1:100 dilution; Dako), followed by 1hr incubation of anti-mouse lexa Fluo 488 (Molecular Probes) and anti-rabbit lexa Fluo 555 (Molecular Probes) conjugated antibodies (1:1000 dilution) to reveal specific staining. DPI staining was performed to visualize cell nuclei. Sections were analyzed on a Zeiss xiophot microscope equipped with an xiocam color CCD camera (Carl Zeiss). Sizes of islet and beta-cell area were analyzed with ImageJ software (NIH).
Supplementary Figure 2. Effects of DPI on glucose-stimulated insulin secretion in mouse islets. () Dose-response of the electron transporter inhibitor DPI, commonly used as NDPH oxidase inhibitor, on insulin secretion in WT mouse islets stimulated by 22.8mM glucose (Glc) compared to basal release at 2.8mM glucose (asal). *P<0.005 versus asal, ###P<0.005 versus Glc in the absence of DPI. () Effects of 10µM DPI on insulin secretion in WT, Nox1ko, and Nox4ko mouse islets. P<0.01 versus corresponding asal of the same genotype, #P<0.05 versus Glc of WT, &P<0.05 versus corresponding Glc of the same genotype. Data are means±sem of 4 independent experiments. DPI 0.1µM 1µM 10µM Insulin secretion (ng insulin / islet) 0.6 0.4 0.2 & # & & & asal Glc Glc+10 M DPI 0.0 WT Nox1ko Nox4ko
Supplementary Figure 3. Glucose-induced superoxide generation measured by DHE-based direct fluorimetry in WT and mouse islets. P<0.01 versus WT. Data are means±sem of 3 independent experiments. Superoxide generation (% WT) 100 80 60 40 20 0 WT Footnote: groups of 20 islets were loaded with 25μM DHE in the presence of 22.8mM glucose. Fluorescence was measured in a thermostated plate reader (Fluostar Optima; MG Labtechnologies, Offenburg, Germany) for 60min with excitation at 544nm and emission at 590nm. Slope of fluorescent signals versus time represented the rate of superoxide generation (1). 1. Sarre, Gabrielli J, Vial G, Leverve XM, ssimacopoulos-jeannet F: Reactive oxygen species are produced at low glucose and contribute to the activation of MPK in insulin-secreting cells. Free Radic iol Med 52:142-150, 2012
Supplementary Figure 4. In vivo glucose homeostasis in WT and mice. Following an overnight fast, control (WT) and Nox2-deficient () mice at 2 months (), 3 months () and 4 months (C) of age were subjected to an ipgtt. Mice were challenged with 3mg/g of glucose per body weight and glycemia determined over a 2hr period of time after glucose injection. (D) Plasma insulin levels were determined before (T=0) and 15min (T=15min) after glucose administration for ipgtt in 2-4 month old mice (N=6). Data are means±sem. C D