High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22

Similar documents
SUPPLEMENTARY INFORMATION

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Glycemic control in diabetes is restored by therapeutic manipulation of cytokines that regulate beta cell stress

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

SUPPLEMENTARY FIGURES AND TABLE

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplemental Material:

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Plasma exposure levels from individual mice 4 hours post IP administration at the

Supplementary Information:

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Effect of BI-1 on insulin resistance through regulation of CYP2E1

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

Peter Walter, UCSF IRE1 Signaling Affects Cell Fate during the Unfolded Protein Response

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST)

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

SUPPLEMENTARY INFORMATION

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Supplementary Figure 1:

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Spleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.

Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-10. Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald,

Supplemental Figure 1

The effect of interleukin-22 treatment on autoimmune diabetes in the NOD mouse

islets scored 1 week month months

Supplementary Figures

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

Supplementary Materials for

Grup de fisiologia digestiva i adaptacions nutricionals Institut de Nutrició i Seguretat Alimentaria

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Connective Tissue Response in IBD

Intestinal Microbiota in Health and Disease

SUPPLEMENTARY INFORMATION

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Nature Medicine: doi: /nm.4078

Supporting Information

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic

Cell Quality Control. Peter Takizawa Department of Cell Biology

4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation.

Supplementary Figure 1 IL-27 IL

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

Supplemental Figure 1: Lrig1-Apple expression in small intestine. Lrig1-Apple is observed at the crypt base and in insterstial cells of Cajal, but is

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

SUPPLEMENTARY INFORMATION

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Grade of steatosis. group Case No. Supplementary Figure 1:

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

Caffeine Modulates Hyperoxia - Induced Angiogenesis in Newborn Mice

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supporting Information Table of Contents

Accepted Manuscript. Title: The role of barrier function, autophagy, and cytokines in maintaining intestinal homeostasis

Supplementary Figure 1

Supplementary table I. Real-time primers used in the study. The fold change was obtained by

The role of intestinal microbiota in metabolic disease-a novel therapeutic target.

Nature Immunology: doi: /ni Supplementary Figure 1

Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis

Supplementary Figure 1

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

Mechanisms of Cell Injury: Loss of Calcium Homeostasis

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle

Supplementary Material

SUPPLEMENTARY INFORMATION

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Nature Immunology: doi: /ni Supplementary Figure 1

Supplementary Materials

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane

SUPPLEMENTARY INFORMATION

Transcription:

Supplementary Information High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22 Max Gulhane 1, Lydia Murray 1, Rohan Lourie 1, Hui Tong 1, Yong H. Sheng 1, Ran Wang 1, Alicia Kang 2, Veronika Schreiber 1, Kuan Yau Wong 1, Graham Magor 3, Stuart Denman 4, Jakob Begun 1, Timothy H. Florin 1, Andrew Perkins 3, Páraic Ó Cuív 2, Michael McGuckin 1 and Sumaira Z. Hasnain 1 (1) Immunity, Infection and Inflammation Program, (2) University of Queensland Diamantina Institute, Translational Research Institute (3) Blood and Bone Diseases Program, Mater Research Institute - The University of Queensland, Translational Research Institute, Brisbane, Australia, (4) The Commonwealth Scientific and Industrial Research Organization, St Lucia, Brisbane, Australia The authors declare no conflict of interest Correspondence Dr. Sumaira Z. Hasnain Mater Research Institute University of Queensland, Translational Research Institute, 37 Kent St, Woolloongabba, Qld 4102 t: +61-7-34436939, f: +61-7-31632550 ; E: sumaira.hasnain@mater.uq.edu.au ABBREVIATIONS IBD, inflammatory bowel disease; KLF4: Kruppel-like factor 4 ER, endoplasmic reticulum; UPR, unfolded protein response; sxbp1, spliced X-box binding protein 1; PERK, protein kinase RNA-like ER kinase; ATF6, activating transcription factor 6; IRE-1, inositol requiring enzyme-1; NEFA, Non-esterified fatty acid; ROS, reactive oxygen species; inos, inducible nitric oxide synthase.

Supplementary Figure Legends: Supplementary Figure 1: Wild-type C57BL/6 mice were fed a high fat diet (HFD) or regular control diet (Con) for 3 weeks (n=6-7 per group), 11 weeks (n=5-6 per group) or 22 weeks (n=8-12 per group). (a) Final body weights (in grams) of mice at the time of sampling. (b) TNF- α, IL- 1β, and IL- 17a secreted by anti- CD3/anti- CD45 stimulated leukocytes isolated from mesenteric lymph nodes of control and mice kept on a HFD for 22 weeks. The red dashed line depicts the limit of detection. mrna level of proinflammatory cytokines (c) Il4, (d) Il13 and (e) Il23 was determined by qrt-pcr in the distal colon. Normalized to B-actin and expressed as a fold change of the respective controls. n = 6-8. Data presented as mean ± SEM, One way ANOVA with Bonferroni post-test. *p<0.05 **p<0.01 ***p<0.001. Supplementary Figure 2: Wild-type C57BL/6 mice were fed a high fat diet (HFD) or regular control diet (Con) for 3 weeks (n=6-7 per group), 11 weeks (n=5-6 per group) or 22 weeks (n=8-12 per group). (a, c, e) Volumetric analysis of mature mucin as a percentage of crypt area as depicted by Periodic Acid Schiff s-alcian blue staining shown in Fig 2a. (b, d, f) ImageJ analysis of area stained with Muc2 antibody using immunohistochemistry. qrt-pcr was used to determine the levels of (g) goblet cell protein trefoil factor 3 (Tff3) and (h) goblet cell differentiation factor Spdef. Data is normalized to B-actin and expressed as a fold change of the respective controls. (i) Immunohistochemistry and area stained analysis with Muc2 precursor antibody was used to assess the Muc2 misfolding. (j) Immunofluorescence was used to determine the levels of claudin-1 (original images depicted in Fig. 2e) (k) Crypt length measurements (µm). Data presented as mean ± SEM or box plots with whiskers show median. Q1, Q3 and min/max, One-Way ANOVA with Bonferroni post-test. *p<0.05 **p<0.01 ***p<0.001. Supplementary Figure 3: Colon weight/length ratio from wild-type C57BL/6 or Winnie mice fed a high fat diet (HFD) or normal chow diet (NCD) for 9 weeks following weaning (3 weeks of age). One-Way ANOVA with Bonferroni post-test. ***p<0.001 compared to NCD. n = 5-8.

Supplementary Figure 4: (a) Serum triglyceride levels in control mice compared to mice kept on HFD for 3, 1 and 22 weeks. n = 6-8. LS174T cells were treated with Control BSA, 0.5mM Palmitate or 1 mm butyrate, 1 mm proprionate, 15 mm acetate or 50 ng/ml of IL-22 for 24 hours. mrna levels of ER stress markers (b) GRP78, (c) spliced XBP1, goblet cell differentiation factor (d) KLF4, major component of goblet cells (e) MUCIN-2 and the component of the glycocalyx cell surface (f) MUCIN-1, was determined by qrt-pcr. qrt-pcr was used to determine the expression of oxidative stress marker Nos2 (g), and Griess Assay was used to determine the changes in oxidative stress protein Nitrite (h). qrt-pcr data is normalized to mean expression of β-actin and expressed as a fold change compared to BSA controls. Statistics: n= 8 per group (2 individual experiments). One way ANOVA with Bonferroni post-test; *p<0.05 **p<0.01 ***p<0.001. Supplementary Figure 5: Wild-type C57BL/6 mice were fed a high fat diet (HFD) or normal chow diet (Con) for 22 weeks. After 18 weeks, recombinant IL-22 was administered at 20 ng/g or 100 ng/g i.p for 4 weeks. (a) Colon weight/length ratio was determined as a measure of inflammation. (b) Staining with mature Muc2 antibody, imagej analysis depicting the intracellular Muc2 staining as a percentage of crypt area. (c) Crypt length measurements (µm). (d) Staining with Ki67 antibody to assess a change in proliferation. (e) Representative images of epithelial cell apoptosis detected by triphosphate nick-end labeling (TUNEL) staining in the colon. Negative control shows background autoflourescence and positive control shows apoptosis in epithelial cells digested with DNAse. (f) Staining with Grp78 antibody, showing an increase in ER stress in HFD mice and a reduction with IL-22 treatment. One-Way ANOVA with Bonferroni post-test. ***p<0.001 compared to NCD. n = 8-12. Supplementary Figure 6: Levels of Bifidobacterium spp., Clostridium cluster XIVa, Bacteroides spp. and Clostridium cluster IV were determined in the DNA extracted from faecal samples. n = 4 per group. One way ANOVA with Bonferroni post-test; *p<0.05 **p<0.01 ***p<0.001.