Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong Duan State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, Renji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200032, China State Key Laboratory of Cell Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031,China Supporting Information The ratio optimization of DOPA to CaP-ZD55-IL-24 The ratio of DOPA to CaP-ZD55-IL-24 was optimized. Several concentrations of DOPA were prepared: 50 µg/ml, 100 µg/ml, 150 µg/ml, 200 µg/ml and 400 µg/ml. The mean size of CaP/Lipids-ZD55-IL-24 changed as the DOPA concentration increased (Figure S1A); the mean size decreased from 904 nm to 121 nm as the concentration of DOPA increased from 50 µg/ml to 150 µg/ml; when the concentration of DOPA was increased to 400 µg/ml, the mean size increased to 397 nm. The minimum mean size was observed at 150 µg/ml, and the compound exhibited good dispersibility (Figure S1B). DOPA did not efficiently coat the CaP-ZD55-IL-24 complex, leading to bulk aggregation (Figure S1C) at 50 µg/ml. Excessive lipids produced empty liposomes, and also caused an increase in size (Figure S1D), as shown in the negatively stained TEM images. Thus, the concentration at the minimum mean size was considered the optimum concentration. 1
Cellular uptake. Huh-7 cells were infected with ZD55-IL-24 or PLC-ZD55-IL-24 at 200 VPs/cell. After 6 hours, the cells were washed three times with PBS and collected. DNA samples were extracted and qualified using real time quantitative polymerase chain reaction (qpcr). Quantitative RT-PCR assay. Total RNAs were isolated by Trizol (Invitrogen, Carlsbad, CA, USA). Reverse transcription was performed with the ReverTra Ace qpcr RT Kit (Toyobo Osaka, Japan). Expression levels of IL-24 mrna was measured by SYBR Green Realtime PCR Master Mix (primers: 5 CCTTCTGGGCTGTGAAAGAC3 and 5 GACAAGGTAACAGCTCTCAG3 ). 18S was used as a reference (5 AACTTTCGATGGTAGTCGCCG3 and 5 CCTTGGATGTGGTAGCCGTTT3 ). 2
Figure S1. Optimization of the ratio of DOPA to CaP/ZD55-IL-24. (A) The changed size of PLC-ZD55-IL-24 at a serial concentration of DOPA. The mean size and TEM image of PLC-ZD55-IL-24 at 150 µg/ml (B), 50 µg/ml (C) and 400 µg/ml (D) DOPA. Data are presented as the means ± SD of three independent experiments. 3
Figure S2. Synthesis and characterization of mpeg 2000 -DPPE. (A) Synthetic route for the production of mpeg 2000 -DPPE. (B) 1 H NMR spectra of mpeg 2000 -DPPE. 4
Figure S3. Cytotoxicity evaluation of PEG/Lipids /CaP. Normal cells (L-929, L02, and QSG-7701) were treated with serial concentrations of PEG/Lipids /CaP. Cell viability was measured using the MTT assay at 48 and 72 hours. Data are presented as the means ± SD of three independent experiments (***P<0.01). 5
Figure S4. Size distribution of PLC-ZD55-IL-24 as measured using a Nanosight 3D Plot. Figure S5. Characterization of DOTAP-ZD55-IL-24. (A) Diameter distribution and (B) zeta potential of DOTAP-ZD55-IL-24. 6
Figure S6. Cytotoxicity of PLC-ZD55-IL-24 in normal human liver cells (QSG-7701). QSG-7701 cells were infected with ZD55-IL-24 and PLC-ZD55-IL-24 in serial dilutions of viral particles. Cell viability was measured using the MTT assay at 48 hours postinfection. Data are presented as the means ± SD of three independent experiments (***P<0.01). Figure S7. Apoptosis of normal human liver cells (QSG-7701). Hoechst 33258 staining (A) and an Annexin V binding assay (B) were examined at 48 h after incubation with ZD55-IL-24 and PLC-ZD55-IL-24 (160 VPs/cell). No obvious nucleic fragmentation or Annexin V-FITC + cells were observed. Scale bar: 50 µm. 7
Figure S8. Uptake of PLC-ZD55-IL-24 in Huh-7 cells. Huh-7 cells were infected with ZD55-IL-24 or PLC-ZD55-IL-24 at 200 VPs/cell and collected at 6 h. Viral genome (E3 gene) number was quantified using an absolute real-time qpcr. Data are presented as the means ± SD of three independent experiments. NS indicates P>0.05 Figure S9. Biodistribution of PLC-ZD55-IL-24 in nude mice bearing Huh-7 xenografts. Nude mice bearing Huh-7 tumors were intravenously injected with 1.5 10 10 VPs ZD55-IL-24 and PLC-ZD55-IL-24. Viral genome (E3 gene) copies in heart, kidney and brain were quantified by real time qpcr at the indicated time.(n=3). ***P < 0.01 versus the corresponding dose in the PLC-ZD55-IL-24-treated group. 8
Figure S10. Transfection of ZD55-GFP and PLC-ZD55-GFP in Hepa1-6 cells. Hepa1-6 and Huh-7 cells were infected with ZD55-GFP and PLC-ZD55-GFP at 200 VPs/cell. At 48 h post-infection, the cells were observed under fluorescence microscopy. Scale bar: 100 μm. Figure S11. IL-24 expression in Huh-7 tumors. 1.5 10 10 VPs ZD55-IL-24, PLC-ZD55-IL-24 were intravenously injected into Huh-7 tumor-bearing nude mice four times every other day. Tumor tissues were harvested from mice four days after the final intravenous injection. (A)The IL-24 mrna expression levels in Huh-7 tumors ware quantified by real time qpcr. ***P < 0.01 (n=3) (18S as reference) (B) Western blot analysis of IL-24 expression in Huh-7 tumors. 9
Figure S12. Correlation analysis between relative tumor volume reduction and IL-24 expression. PBS, 1.5 10 10 VPs ZD55-IL-24 and PLC-ZD55-IL-24 were intravenously injected into Huh-7 tumor-bearing nude mice four times every other day. Tumor harvested at the end of treatment. The IL-24 mrna expression levels in tumors ware quantified by real time qpcr. (n=5) (18S as reference). 10