Over-Activation of Hypoxia-Inducible Transcription Factor 1 alpha (HIF)-1α by Chronic Hypoxia Mediates Chronic Ischemic Renal Injury

Similar documents
Role of Acid Sphingomyelinase Knockout Mice in Protection Against Hyperhomocystenimia Induced Glomerular Injury

T H E J O U R N A L O F C E L L B I O L O G Y

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury

TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Cardiovascular Protection and the RAS

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.

Gene expression was analyzed by real time PCR (SYBR GREEN PCR Master. Mix, Roche Applied Science) using specific oligonucleotides.

SUPPLEMENTARY DATA. Supplementary Table 1. Characteristics of Subjects.

ASN s Legislative Priorities for 2010

Intra-renal Oxygenation. in Human Subjects

Silencing of hypoxia-inducible factor-1 gene attenuates chronic ischemic renal injury in two-kidney, one-clip rats

Mechanisms of Gene Regulation and Signal! Transduction in Hypoxia!

Supplementary Figure 1:

Prof. Andrzej Wiecek Department of Nephrology, Endocrinology and Metabolic Diseases Medical University of Silesia Katowice, Poland.

The role of oxygen insufficiency in the onset and development of the vascular complications of diabetes

Supplementary Information

Aberrant Promoter CpG Methylation is a Mechanism for Lack of Hypoxic Induction of

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

Histone modifications in kidney disease

Mohammad Husain Department of Biotechnology, Jamia Millia Islamia New Delhi

supplementary information

Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells

RENAL ARTERY STENOSIS. Grand Rounds 10/11/2011

The National Kidney Foundation (NKF) is pleased to submit testimony regarding the impact of

Endothelial HIF-2 mediates protection and recovery from ischemic kidney injury

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

An oxygen-regulated switch in the protein synthesis machinery

Supplementary Information

The mirna-184 drives renal fibrosis by targeting HIF1AN in vitro and in vivo

Summer 2015 Research Opportunity

A Broad Clinical Pipeline of Innovative Diabetes / Renal & Oncology Programs. European Business Development Conference Düsseldorf 24 Sept 2013

Prolyl Hydroxylase Inhibitors

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit

Surgical Pathology Report

General introduction of nephrology. Xiaoqiang Ding M.D., Ph.D. Department of nephrology Zhongshan Hospital, Fudan University

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Special Lecture 11/08/2013. Hypertension Dr. HN Mayrovitz

Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies. Traditional Hypothesis Stress

Coding Hints 2 nd Edition

Research in IBD at University of Colorado Denver

Life After CORAL: What Did CORAL Prove? David Paul Slovut, MD, PhD Co-director TAVR, Dir of Advanced Intervention

Supplementary Material

Dynamic Interaction of Stress Granule, DDX3X and IKK-α Mediates Multiple Functions in

[General Pathology] Introduction to Pathology

Supplemental Figure 1. Vasoconstrictor responses of renal interlobular arteries to ATP. Responses of interlobular renal arterioles to ATP were

Caffeine Modulates Hyperoxia - Induced Angiogenesis in Newborn Mice

Histopathology: Hypertension and diabetes in the kidney These presentations are to help you identify basic histopathological features.

SUPPLEMENTARY FIGURES AND TABLE

Silencing of the Activated Protein-1 Transcription Factor JunD Exacerbates Ischemia/Reperfusion-induced Cerebral Injury

Overexpression of HIF Prolyl-Hydoxylase-2 transgene in the renal medulla induced a salt sensitive hypertension

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Role of Inflammation in Pulmonary Hypertension

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.

The use of pathology surrogate markers in Fabry Disease. Beth L. Thurberg MD PhD Vice President of Pathology Genzyme

Supplementary Fig. S1. Schematic diagram of minigenome segments.

basic research OPEN Minnesota, USA and 4 Department of Biochemistry and Molecular Biology, Mayo Clinic, Rochester, Minnesota, USA

SLOWING PROGRESSION OF KIDNEY DISEASE. Mark Rosenberg MD University of Minnesota

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

Niki Prakoura. Calreticulin upregulation in renal fibrosis

HRZZ project: Genotype-Phenotype correlation in Alport's syndrome and Thin Glomerular Basement Membrane Nephropathy. Patohistological Aspects

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

HDAC Inhibition for Prevention of Fibrosis Following Sepsisinduced

MRI qbold Based Evaluation. Renal Oxidative Metabolism. Department of Radiology and Hernando Gomez, MD Critical Care Medicine

Risk Factors and Management of Acute Renal Injury in Cardiac Surgery

Chapter 6: Medicare Expenditures for CKD

Soluble Lutein (Lutemax2020 ) Prevents Retinal Damage in Streptozotocin (STZ)- induced Diabetic Rats

Management of New-Onset Proteinuria in the Ambulatory Care Setting. Akinlolu Ojo, MD, PhD, MBA

Kidney Lab. Name: By the end of this lab, you should:

Prognosis in CKD Can we do anything about it? Rodney D Gilbert

Ordering Physician. Collected REVISED REPORT. Performed. IgG IF, Renal MCR. Lambda IF, Renal MCR. C1q IF, Renal. MCR Albumin IF, Renal MCR

신장환자의혈압조절 나기영. Factors involved in the regulation of blood pressure

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

2014 Evidence-Based HTN Guideline: Preliminary Data from AMGA s Anceta Collaborative

Dr. Mehmet Kanbay Department of Medicine Division of Nephrology Istanbul Medeniyet University School of Medicine Istanbul, Turkey.

NEDD9 is Upregulated by Hypoxia in Human Pulmonary Artery Endothelial Cells Selectively and Modulates Platelet-Endothelial Adhesion

Correspondence to: Jun-nian Zheng, * These authors contributed equally to this paper.

Doppler ultrasound, see Ultrasonography. Magnetic resonance imaging (MRI), kidney oxygenation assessment 75

Klotho: renal and extra-renal effects

Mechanisms of hepatic fibrogenesis in chronic liver disease

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

renoprotection therapy goals 208, 209

USRDS UNITED STATES RENAL DATA SYSTEM

Diabetes, Obesity and Heavy Proteinuria

Supplemental Figure 1

Supplementary Figures

Supplemental Materials Molecular Biology of the Cell

STATEMENT OF THE NATIONAL KIDNEY FOUNDATION SUBMITTED TO THE HOUSE COMMITTEE ON APPROPRIATIONS;

Implication of CD38 Gene in Podocyte Epithelial-to-Mesenchymal. Transition and Glomerular Sclerosis

Glomerular diseases mostly presenting with Nephritic syndrome

Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion

Faculty/Presenter Disclosure

ATHLETES & PRESCRIBING PHYSICIANS PLEASE READ

Supplemental Figures:

Phosphoinositides Regulate Ciliary Protein Trafficking to Modulate Hedgehog Signaling

Feinberg School of Medicine Chicago IL Division of Nephrology and Hypertension

SUPPLEMENTARY FIGURES

Reducing proteinuria

Transcription:

Over-Activation of Hypoxia-Inducible Transcription Factor 1 alpha (HIF)-1α by Chronic Hypoxia Mediates Chronic Ischemic Renal Injury Romesh Dhaduk Department of Pharmocology and Toxicology Virginia Commonwealth University Short-term Educator Program for Underrepresented Persons (STEP-UP) Mentors: Dr. Pin-Lan Li and Dr. Ningjun Li

Background Once the renal damage reaches a certain threshold, the progression of chronic renal disease is consistent and irreversible. Ultimately leads to fibrosis. Mechanisms are not yet known. According to the United States Renal Data System: Total Medicare spending in 2006 - nearly $355 billion End Stage Renal Disease (ESRD) cost $23 billion. Need efficient therapeutic strategies to reverse or prevent the progress of chronic renal injury.

Background Hypoxia-inducible transcription factor 1 alpha (HIF-1α). Transcription factor. Extremely prevalent in the kidney. Hypoxia detected in all kinds of chronic renal diseases. HIF-1α is up-regulated in different chronic renal diseases. Activation of HIF-1α stimulates the fibrotic factors.

Collagen I/III level (normalized intensity) ANG II + Ang II + Ang II + A Scrambled Scrambled Scrambled Scrambled HIF1alpha- sirna ANG II + + Naïve Control sirna sirna sirna AngII HIF-1a sirna AngII sirna 1 2 3 4 5 6 HIF1- -actin B Ang II + Ang II + Scrambled Scrambled HIF1alpha- Naïve sirna sirna sirna 1 2 3 4 5 6 7 8 Collegan I/II I TIMP -1 C 2.5 2.0 * - actin 1.5 1.0 0.5 * 0.0 Naïve Scrambled sirna Ang II + scrambled sirna Ang II + HIF1alphasiRNA

Background Chronic hypoxia is possibly responsible for the overactivation of HIF-1α in chronic kidney diseases. HIF-1α may be a pathogenic factor that mediates chronic renal injury. At present, no direct evidence showing the contributing role of HIF-1α in this process. Therefore, in the present study we use 2 kidneys 1-clip rat as a chronic renal ischemia model to test our hypothesis, which is whether HIF-1α is increased in clipped kidneys and whether HIF-1α shrna blocks renal injury.

Hypothesis Hypoxia HIF-1α Fibrogenic factors Extra Cellular Matrix

Animal Model Making a clip on the left renal artery Plasmid transfection by intra renal artery injection

mrna level Bioluminescent Signal After Transfection of Luciferase Plasmids as Reporter genes. A 12000 11000 10000 9000 8000 7000 Color Bar Min = 6541.8 Max = 12482 B Click # CAR20090902162232 Wed, Sep 02, 2009 16:22:54 Em filter=open Bin:HS (16), FOV19.9, f1, 1m Camera: IS0648N4048, Spectral Instruments TE 2.0 Luciferin + O 2, ATP Oxyluciferin + Light 1.6 (Substrate) Luciferase 1.2 (Reporter Gene) Series: NJ-luciferase Experiment: 3/27/2009 Label: blue-2 Comment: body photo Analysis Comment: Weeker-back-5 bkg sub flat-fielded cosmic 0 5 10 14 (days)

Mean Artery Blood Pressure (mmhg) Blood Pressure Changes 200 180 160 140 120 100 80 60 ACEI Ctrl LE HE 40 1 3 5 8 10 12 14 16 18 20 Day after Surgery

HIF1a Level in Cortex HIF-1α Expression in Each Group A HIF-1 B 1 2 3 4 5 6 7 8 Ctrl L LE HE 5.0 4.0 3.0 -Actin Ctrl=Normal Animal+ Luciferase, L=Clipped Animal+Luciferase, LE=Clip+ACEI+Luciferase, HE=Clip+ACEI+HIF-1 shrna 2.0 1.0 0.0 Ctrl L LE HE

Glomerular Damage Index (GDI) Glomerular Damage in Each Group A Ctlr L B 4 3 LE HE 2 1 0 Ctrl (N=4) L(n=3) LE(n=7) HE(n=7)

Collagen Staining Area Ratio (%) Effect of Silencing HIF-1α on Collagen Distribution A 25 B LE 20 15 10 HE 5 0 Ctrl(n=4) L(n=3) LE (n=7) HE (n=7)

Effect of Silencing HIF-1α on CD5, B Cell Marker 100X 200X Clip+ACEI+Luciferase Clip+ACEI+HIF-1α shrna Clip+ACEI+Luciferase Clip+ACEI+HIF-1α shrna Cortex Medulla

Conculsion Clip over-activates hypoxia-inducible transtription factor 1 alpha (HIF-1α) expression by chronic hypoxia. Over-activation of HIF-1α contributes to chronic ischemic renal injury. Inflammation is involved in this renal injury. Silencing HIF-1α can protect chronic ischemic renal injury.

Future Directions Use disease models such as diabetic nephropathy, hypertensive nephropathy and see whether silencing HIF- 1α can protect against chronic ischemic renal injury. HIF prolyl hydroxylase (PHD): Oxygen sensor that regulate HIF-1a levels in response to changes of oxygen concentrations In normoxia, targets HIF-1α for destruction. To determine whether PHD will also be involved in CKD via regulation of HIF-1alpha.

Acknowledgements Dr. Pin-Lan Li and Dr. Ningjun Li; Dr. Zhengchao Wang and Dr. Qing Zhu; Lori P. Payne; All other staff in the lab; This work is supported by NIH and STEP-UP.