SUPPLEMENTARY INFORMATION

Similar documents
a b c d e C 3 ]Aspartate [ 20 minutes C 3 ]Hexose-P * * *

Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells

Supplementary Figure 1

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

SUPPLEMENTARY INFORMATION

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Supplementary Figure 1.

The in Vitro and in Vivo Pharmacology of AB101, a Potential Once-Weekly Basal Subcutaneous Insulin

Figure S1. B % of Phosphorylation 32H. 32ss

2.5. AMPK activity

Supplementary Figure 1. Flow cytometry panels used for BD Canto (A) and BD Fortessa (B).

Diet, Exercise and Nutrition in Cancer Prevention and Survivorship

Progestin-only methods Type or dose of progestagen

Francesco Parlati, Ph.D.

Anti-inflammatory properties of SM04690, a small molecule inhibitor of the Wnt pathway as a potential treatment for knee osteoarthritis

Supplementary figure 1. Systemic delivery of anti-cd47 antibody controls tumor growth in

A. Generation and characterization of Ras-expressing autophagycompetent

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

Imtiyaz et al., Fig. S1

SUPPLEMENTARY INFORMATION

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Imaging of Coronary Atherosclerosis. Dr Marc Dweck BHFSenior Lecturer Edinburgh Heart Centre& University of Edinburgh

7th International Congress of the Spanish Society of Obesity Surgery. Valladolid Spain May, 2004.

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

A Sound Track to Reading

TGR5 activation induces intestinal growth and improves intestinal mucositis in mice. Hannelouise Kissow

SUPPLEMENTARY INFORMATION

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis

Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E,

Defects in glucose utilization & GLP-1

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1.

Last updated Glycogen synthesis, glycogenolysis, and gluconeogenesis in primary mouse hepatocytes

An overview of findings from quantitative. research conducted across 6 European countries

Sensitivity of Serum Fructosamine in Short Term Glycemic Control

Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

CANCER OF THE CERVIX

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Recruitment of HBO1 Histone Acetylase and Blocks

Mouse Models for Studying Human Islet Transplantation

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

SUPPLEMENTARY INFORMATION

Supplementary Figure 1

Figure 1 A 2.0. Akt308 Akt Ctl 1h 3h 6h 9h 12h. β-cat. GSK3β. pakt308. pgsk3β/edu E-cad/pAkt308. Akt1. Actin.

Supplementary legends

Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D.

Supplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain.

Comparison between intraperitoneal and subcutaneous insulin infusion: link between routes of administration and hepatic oxidative stress

* * * * * liver kidney ileum. Supplementary Fig.S1

SUPPLEMENTARY INFORMATION

Effect of BI-1 on insulin resistance through regulation of CYP2E1

Validation & Assay Performance Summary

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Supplementary Figure 1

Effective Targeting of Quiescent Chronic Myelogenous

Supplemental Materials Molecular Biology of the Cell

Preclinical Assessment of JTX-2011, An Agonist Antibody Targeting ICOS, Supports Evaluation In ICONIC Clinical Trial

Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice

Examining the Basis of Drug-Drug Interaction (DDI) Labeling Recommendations for Antiviral Approvals from 1998 to 2015

Chapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling

TAU PATHOLOGY REDUCTION WITH SM07883, A NOVEL, POTENT, AND SELECTIVE ORAL DYRK1A INHIBITOR - A POTENTIAL THERAPEUTIC FOR ALZHEIMER S DISEASE

Thyroid Screening in the Newborn: Utah Experience

Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production

The Effect of Metal Chelators on Lipid Peroxidation in Irradiated Erythrocytes

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Disclosures for Prof D L Hay. Research funding: Alder Biopharmaceuticals Inc. Consulting arrangements: Intarcia Therapeutics Inc.

Nature Medicine: doi: /nm.3891

Virological failure to Protease inhibitors in Monotherapy is linked to the presence of signature mutations in Gag without changes in HIV-1 replication

TAU PATHOLOGY REDUCTION WITH SM07883, A NOVEL, POTENT, AND SELECTIVE ORAL DYRK1A INHIBITOR - A POTENTIAL THERAPEUTIC FOR ALZHEIMER S DISEASE

Theme song for the 2018 Los Angeles Religious Education Congress Rise Up! Levántate! A/E. j œ. œ œ. Œ œ œ. Dios te. œ œ œ œ

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Se le ctive C e rvica l Spina l M otionr e strictionpa tie ntse le ctionproce dure 1(B L S a nd A L S)

RayBio KinaseSTAR TM Akt Activity Assay Kit

Molecular assays in HIV-1 Dx and therapeutic monitoring

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged

modified dye uptake assay including formazan test EC 90 not tested plaque reduction assay

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from

Supplementary Figure 1

I ve Participated in a Research Study. Now What? Oleg Shchelochkov, MD NIH/Venditti Lab

doi: /nature14508 Rappsilber et al.

Adiponectin suppresses gluconeogenic gene expression in mouse hepatocytes independent of LKB1-AMPK signaling

Robust Cell-Based Assays for Detection of Neutralizing Antibodies to Follow on Biologics like Insulin, GLP1 & Avastin

Supplementary Figure 1

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Control 7 d cold 7 d CL

A CD123-targeting Antibody-Drug Conjugate (ADC), IMGN632, designed to eradicate Acute Myeloid Leukemia (AML) cells while sparing normal bone marrow

Validation & Assay Performance Summary

Food and Respiratory Allergy in Ghana Insights from population studies among children

Transcription:

SUPPLEMENTRY INFORMTION doi:10.1038/nature11808 NT Phen Met ICR Oligo FCCP pmpk tmpk Supplemental figure 1. -. Primary hepatocytes were treated with 250 um Phenformin, 1 mm Metformin 250 um ICR, 100 nm Oligomycin, or 500 nm FCCP for 2 hours, and assayed for total and phospho T172 MPK () or treated with 5 nm glucagon for 15 minutes and subjected to assay for cmp (). WWW.NTURE.COM/NTURE 1

RESERCH SUPPLEMENTRY INFORMTION NT Glucagon C NT Glucagon NT Glucagon D 100 nm Glucagon (min) NT 5 30 60 120 pmpk tmpk Supplemental Figure 2. -C. Primary hepatocytes isolated from fasted mice were plated in M199 media and treated with the indicated concentrations of metformin and pbs or 100 nm glucagon for 18 hours. Metabolites were extracted with perchloric acid and analyzed by HPLC. D. P rim a ry h e p a to cyte s p late d o ve rn ig h t in M 1 9 9 m e d ia w e re tre ate d w ith 1 0 0 nm g lu ca g o n for th e in d ica te d tim e s a n d e xtra cts w e re p ro b e d b y w e ste rn b lo t fo r th e p h o sp h o ryla tio n sta tu s of M P K. 2 WWW.NTURE.COM/NTURE

SUPPLEMENTRY INFORMTION RESERCH Supplemental figure 3 FRET Ratio (FRET/CFP) Time post-glucagon (10 nm) 500 µm Phenformin No Phenformin CFP Pre-glucagon 200 sec. 600 sec. 1000 sec. High FRET Low FRET Supplemental figure 3. -. Primary hepatocytes were isolated and infected with adenovirus expressing the KR3 FRET-based activity probe.cells were treated with the indicated concentrations of phenformin for 2 hours and images were aquired starting 5 minutes before addition of 10 nm glucaogn.. Representative cells from untreated and phenformin treated cells, pseudocolored to reflect the FRET/CFP ratio.. The calculated FRET/CFP ratios from 30-50 cytoplasmic ROI (one ROI per cell) for untreated, 250 um, and 500 um phenformin treated cells. W W W. N T U R E. C O M / N T U R E 3

RESERCH SUPPLEMENTRY INFORMTION MPK α1/α2 lox/lox 0 C Supplemental figure 4.. P rim a ry h e p a tocyte s w e re p la te d o ve rn ig h t in M 1 9 9 m e d ia a n d tre ate d w ith p b s or IC R a n d stim u la te d w ith 5 n M g lu ca g o n for 1 5 m in ute s. E xtra cts w e re a ssa ye d fo r P K a ctivity (P K I-se nsitive k e m ptid e p h o sp h oryla tio n ).. P rim a ry h e p ato cyte s iso la te d fro m M P K α1 a n d α2 flo xe d m ice infe cte d w ith V -T G -C re o r V -T G -G F P 1 4 d a ys p rio r w e re tre ate d w ith th e in d ica te d IC R d o se for 2 h o u rs a n d stim u la te d w ith 5 n M g lu ca g o n for 1 5 m in u te s. c M P le ve ls w e re q u a ntifie d b y E L IS. C. P rim ary h e p a to cyte s w e re p la te d o ve rn ig h t in M 1 9 9 m e d ia a n d tre a te d w ith 2 5 0 µm IC R fo r 2 h o u rs a n d su b seq u en tly stim u la te d w ith 5 n M g lu ca g o n o r 5 0 µm F o rsk o lin for 1 5 m in ute s. c M P le ve ls w e re q u a ntifie d b y E L IS. 4 WWW.NTURE.COM/NTURE

SUPPLEMENTRY INFORMTION RESERCH Supplemental figure 5.. Primary hepatocytes were incubated with 250 and 500 um phenformin for 2 hours and treated with the indicated glucagon concentrations. Western blots were performed, quantified and three representative blots are shown. WWW.NTURE.COM/NTURE 5

RESERCH SUPPLEMENTRY INFORMTION 0 0 0 0 C PK-DN Phenformin + + + + Supplemental figure 6. -. Primary hepatocytes were isolated, cultured for 18 hours in the presence or absence of 65 um phenformin and treated for 15 minutes with the indicated concentrations of glucagon () or the cell permeable PK agonist SP-8r-cMPS-M (). Western blots were performed for phospho and total PFKF1, CRE, and the IP3R. Three or more western blots were quantified. C. Primary hepatocytes isolated from mice infected with V-TG-PK-DN or V-TG-GFP control virus 7 days earlier were plated and treated for 1 hour with 250 um phenformin or PS and then subjected to a glucose production assay for 2 hours with 10 nm glucagon and 250 um phenformin. Data represents the mean of 3 of these experiments. 6 WWW.NTURE.COM/NTURE

SUPPLEMENTRY INFORMTION RESERCH Supplemental figure 7.. Primary hepatocytes were incubated with 250 um Phenformin for 2 hours, with or without 20 um IMX, 20 um Cilostamide (PDE3i), or 50 um RO-20-1724 (PDE4i) for the final 30 minutes. Cells were treated with 5 nm glucagon for 15 minutes, lysed, and total cellular cmp assayed.. Primary hepatocytes were incubated with 250 um phenformin for 2 hours, treated wiht 5 nm glucagon or 20 um forskolin for 15 minutes, lysed, and total cellular cmp was assayed. WWW.NTURE.COM/NTURE 7

RESERCH SUPPLEMENTRY INFORMTION C Supplemental figure 8. Membranes from primary hepatocytes were isolated and assayed for adenylyl cyclase activity in the presence of the indicated concentrations of forskolin and glucagon. ll incubations included 100 um GTP.. C assays were performed at low (40 um) and high (500 um) TP concentrations in the presence of 300 um MP. ssays were stopped with PC before or after 10 minutes at 30 C. Nucleotides were quantified by HPLC. C. C assays were perfomed with 500 um TP in the presence or absence of 300 um MP. Nucleotides were separated by TLC and the radioactivity in the TP fraction was quantified in scintillation solution after removal from the TLC plates. 8 WWW.NTURE.COM/NTURE

SUPPLEMENTRY INFORMTION RESERCH Glucagon Metformin + + + + ppk Substrates pmpk MPK pcc CC Supplemental figure 9.. Fed mice were fasted for 1 hour and gavaged with water or 500 mg/kg bw of metformin. One hour later mice were injected intraperitoneally with 2 mg/kg glucagon, and liver tissue was collected 5 minutes later. Western blot analysis was performed, examining reactivity to phospho-pk substrate antibodies, phosphorylated and total MPK, and phosphorylated and total CC.. 18 hour fasted mice were gavaged with 50 mg/kg metformin and 1 hour later blood glucose levels were measured. WWW.NTURE.COM/NTURE 9

RESERCH SUPPLEMENTRY INFORMTION C D Metformin + E pmpk tmpk ppfkf1 tpfkf1 pip3r tip3r pkt 473 tkt Supplemental figure 10.. Mice fed normal chow or high fat diet for 10 weeks were fasted overnight and blood glucose was tested., and the total hepatic MP levels were quantified. C-E. Mice fed high fat diet for 10 weeks were fasted overnight and gavaged with 250 mg/kg metformin. One hour later blood glucose was assayed (C) and livers were collected and assayed by western blots for total and phosphorylated MPK, PFKF1, IP3R, and KT (D). pkt/total KT is quantified (E). 10 WWW.NTURE.COM/NTURE

SUPPLEMENTRY INFORMTION RESERCH Supplemental Figure 11 Proposed Model Metformin enters the cell and acts on the mitochondria, causing increased MP. Elevated cellular MP levels inhibit membrane bound denylyl Cyclase, causing a reduction in cellular cmp levels and decreased PK activation and target phosphorylation. WWW.NTURE.COM/NTURE 11

RESERCH SUPPLEMENTRY INFORMTION Supplemental Table 1 denine nucleotides in liver M P (m M ) D P (m M ) T P (m M ) M P / T P N C W ate r 2.3 9 ±.0 9 3.2 8 ±.2 3 3.5 3 ±.3 2 0.7 5 ±.0 8 N C M e tform in 2.9 9 ±.0 6 2.4 7 ±.1 4 1.7 0 ±.1 6 1.9 2 ±.2 4 H F D W ate r 2.8 8 ±.1 6 3.6 9 ±.2 3 3.4 4 ±.1 2 0.8 4 ±.0 5 H F D m etform in 3.0 3 ±.2 1 3.1 4 ±.2 5 2.8 9 ±.3 1 1.0 8 ±.0 9 N o rm a l ch o w (N C ) a n d hig h fa t d ie t fe d m ice (H F D ) w e re fa ste d 1 8 h o urs a n d g a va g e d w ith w a te r o r 2 5 0 m g /kg m etfo rm in. 1 h o ur late r, live rs w e re co lle cte d, a n d a d en in e n u cle o tid e s w e re e xtra cte d a n d q u a ntifie d b y H P L C. M e a su re m e n ts (µm o le s/m g p rote in ) w e re co n ve rte d to co n ce ntratio n s b ase d o n p rote in re co ve ry a n d h e p a to cyte vo lu m e 2 4. de n o te s p< 0.0 5 from w a te r co n tro l. 12 WWW.NTURE.COM/NTURE

SUPPLEMENTRY INFORMTION RESERCH Supplemental Table 2 denine nucleotides in primary hepatocytes M P (µm ) D P (m M ) T P (m M ) M P / T P N T 2 1 5 ± 1 4.8 3.2 1 ±.1 9 5 6.0 2 ±.3 7 6 0.0 3 ±.0 0 1 3 0 µm 2 2 6 ± 2 7.5 3.0 8 ±.2 7 6 6.5 9 ±.1 4 7 0.0 3 ±.0 0 3 1 0 0 µm 2 9 7 ± 3 6.6 4.4 2 ±.6 3 3 7.3 1 ±.7 1 3 0.0 4 ±.0 1 5 2 5 0 µm 7 5 7 ± 1 8 5.6 5.2 6 ±.3 4 9 4.4 6 ±.1 4 0 0.1 6 ±.0 4 1 3 0 0 µm 7 8 3 ± 6 1.0 5.9 8 ±.2 1 5 4.1 2 ±.3 1 7 0.1 9 ±.0 2 6 5 0 0 µm 1 0 3 2 ± 9 0.4 5.8 0 ±.2 2 7 3.1 5 ±,2 7 3 0.3 3 ±.0 4 3 P rim a ry h e p a tocyte s w e re iso la te d from fe d m ice a n d tre a te d w ith p h e nfo rm in for 2 h o u rs. d e n in e n u cle o tid e s w e re e xtra cte d a n d q u a n tified b y H P L C. C o n ce ntratio n va lu e s w e re ca lcu la te d a s in T a b le 1. T h e M P va lu e s a n d tho se in fig ure 1 d a re d e rive d fro m th e sam e e xp e rim e n t. d e n ote s p < 0.0 5 com p a re d to co ntro ls. N T = N o t tre ate d WWW.NTURE.COM/NTURE 13