This PDF file includes: Supplementary Figures 1 to 6 Supplementary Tables 1 to 2 Supplementary Methods Supplementary References

Similar documents
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

(B D) Three views of the final refined 2Fo-Fc electron density map of the Vpr (red)-ung2 (green) interacting region, contoured at 1.4σ.

SUPPLEMENTAL FIGURE LEGENDS

Cbl ubiquitin ligase: Lord of the RINGs

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Detergent solubilised 5 TMD binds pregnanolone at the Q245 neurosteroid potentiation site.

Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random

Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR

KDM2A. Reactions. containing. Reactions

T H E J O U R N A L O F C E L L B I O L O G Y

Eukaryotic transcription (III)

Supplementary Figure 1

Supplementary Information for Structural basis for the inhibition of Polo-like kinase 1

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Tel: ; Fax: ;

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Nature Immunology: doi: /ni.3631

Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity.

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

Supplementary Figure 1

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Alpha thalassemia mental retardation X-linked. Acquired alpha-thalassemia myelodysplastic syndrome

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

The Role of Protein Domains in Cell Signaling

Supplementary Figure S1 Supplementary Figure S2

crossmark Ca V subunits interact with the voltage-gated calcium channel

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

Excerpt from J. Mol. Biol. (2002) 320, :

Supplementary Materials for

SUPPLEMENTARY INFORMATION

Supplementary Materials for

SUPPLEMENTAL INFORMATION. Evolving Spindlin1 Small Molecule Inhibitors Using Protein Microarrays

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

Histone acetyltransferase CBP-related H3K23 acetylation contributes to courtship learning in Drosophila

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Appendix

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

SUPPLEMENTARY INFORMATION

Supporting Information

supplementary information

Supplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

Supplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular

Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression

Supplements. Figure S1. B Phalloidin Alexa488

ab E3 Ligase Auto- Ubiquitilylation Assay Kit

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

The clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1

Data Sheet. Fluorogenic HDAC 8 Assay Kit Catalog #: 50068

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

(a-r) Whole mount X-gal staining on a developmental time-course of hearts from

SUPPLEMENTARY INFORMATION

Table S1. X-ray data collection and refinement statistics

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Nature Methods: doi: /nmeth Supplementary Figure 1

Supplementary Materials for

Supplementary Information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:

EpiQuik Circulating Acetyl Histone H3K18 ELISA Kit (Colorimetric)

Supplementary Materials for

Crystallization-grade After D After V3 cocktail. Time (s) Time (s) Time (s) Time (s) Time (s) Time (s)

Nature Structural & Molecular Biology: doi: /nsmb.3218

Data are contained in multiple tabs in Excel spreadsheets and in CSV files.

Nature Structural & Molecular Biology: doi: /nsmb.1933

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Molecular Medicine: Gleevec and Chronic Myelogenous Leukemia. Dec 14 & 19, 2006 Prof. Erin O Shea Prof. Dan Kahne

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

List of Figures. List of Tables

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

SUPPLEMENTARY INFORMATION

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

SUPPLEMENTARY INFORMATION

Supplementary Figure S1. Appearacne of new acetyl groups in acetylated lysines using 2,3-13 C 6 pyruvate as a tracer instead of labeled glucose.

Nature Immunology: doi: /ni.3866

Protein methylation CH 3

Phenylketonuria (PKU) Structure of Phenylalanine Hydroxylase. Biol 405 Molecular Medicine

Structure of the measles virus hemagglutinin bound to the CD46 receptor. César Santiago, María L. Celma, Thilo Stehle and José M.

Supplementary Information for. Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling. Marilyn D. Resh 1,2,6*

Supplementary Materials for

Workshop on Analysis and prediction of contacts in proteins

Supplementary Figure 1. Comparative analysis of thermal denaturation of enzymatically

Supplemental Information. An Atlas of b-glucuronidases. in the Human Intestinal Microbiome

33VASTVNGATSANNHGEPPS51PADARPR58

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Transcription:

Structure of the catalytic core of p300 and implications for chromatin targeting and HAT regulation Manuela Delvecchio, Jonathan Gaucher, Carmen Aguilar-Gurrieri, Esther Ortega, Daniel Panne This PDF file includes: Supplementary Figures 1 to 6 Supplementary Tables 1 to 2 Supplementary Methods Supplementary References

Supplementary Fig.1 Biochemical characterization. (a) Mass spectrometry analysis using electrospray ionization (ESI) of the p300 'core' before, and after (b) deacetylation by SIRT2. Inset shows a Western blot of p300 deacetylation by SIRT2. Levels of acetylation were detected by western blot using an anti acetyllysine antibody. Incubation times in hours (h) are indicated above the gel. After overnight (o/n) incubation, SIRT2 was able to completely deacetylate the p300 'core'. (c) HAT activity was measured with a variant in which the AIL was replaced with a 5 residue linker ( 1520 1581). Substrate was a peptide derived from histone H3 (1 20) ARTKQTQRKSTGGKAPRKQL.

Supplementary Fig.2 Structural comparisons of PHD and RING domains. (a) Structure of the BPTF PHD domain bound to H3K4 me3. (b) Superimposed structures of p300 PHD (red), Pygo (2VPE, green), BPTF (3qvz, orange), ING2 (2G6Q, blue). The PHD domain is most similar to the PHD domain of BPTF. (c) Structure based sequence alignment of the PHD domain. Zinc ligand positions are shown as red boxes. Residues that make up the aromatic cage are shown as a blue box and labeled I IV. Residues that make specific contacts with the H3K4me2/3 peptide are shown in green. (d) The RING domain is similar to other RING structures. Superimposed structures of p300 RING (green) and Cbl RING domain (red). The p300 RING domain is missing the second Zinc binding site. The sequence insertion in loop L1 is shown. (e) Structure based sequence alignment of the RING domain. Zinc ligand positions as above. Residues that make specific contacts with E2 enzymes are shown in blue. 3MMK: Residues 56 290 are omitted from the alignment.

Supplementary Fig.3 BRP HAT interaction and structural details and interaction interfaces. (a), The BRP module binds to the HAT domain. Pull down experiments with GST BRP against the HAT domain. Input (I), Wash (W) and Bound (B). (b) Isothermal titration calorimetry based binding curves with wild type BRP or a Bromodomain mutant BRP N1132. (c) Stereo view of the RING HAT interface. (d) Crystal packing in the vicinity of the RING domain. The HAT domain (HAT*) of a crystallographically related molecule packs against the RING domain. (e) There are two p300 molecules in the asymmetric crystallographic unit; they overlay well on each other (rmsd 0.9 Å for 564 Cα residues). Coloring as in Figure 1.

Supplementary Fig.4 Multiple sequence alignment of p300/cbp orthologs. Human (hp300), mouse (mp300), bovine (bp300) and dog (cp300). Also included are the CBP homologs human (hcbp), mouse (mcbp), rat (rcbp), Drosophila melanogaster (dcbp) and Caenorhabditis elegans (ccbp). Identical residues are shown with a red background and similar residues with red letters. Secondary structure elements of p300 are shown above the amino acid sequences. The Bromodomain (BROMO) is highlighted in yellow, the RING domain in green, the PHD domain in red and the HAT domain in blue. Intramolecular contacts between domains: Residues in the BROMO PHD interface ( ). Residues in the RING HAT interface ( ). Residues in the PHD HAT interface (*). The sequence alignment was performed using ClustalW 1 and the figure generated using ESPript 2.

Supplementary Fig.5 Functional analysis of the RING domain and in vivo assays. (a) Superposition of E2 ubiquitin onto the RING domain of p300. The ternary complex of RNF4:UbcH5 ubiquitin (Protein Data Bank entry 4AP4) was superimposed onto the RING domain of p300. Residues of the p300 RING and HAT domains that would sterically clash with UbcH5 or Ubiquitin if the interaction were to follow the mode of the RNF4:UbcH5 ubiquitin complex are colored in red. (b) E3 ligase activity assays. Polyubiquitination assays were done using the indicated p300 constructs and the E2 conjugating enzymes UbcH2, UbcH3, UbcH5a, UbcH5b, UbcH5c, UbcH6, UbcH7, UbcH8, UbcH10 and UbcH13 complex. The result obtained with UbcH5a is shown here. Reactions were incubated for 1 h at 37 C followed by SDS PAGE and immunoblotting. (c-f) H1299 cells were transfected with the indicated expression vectors (c) GFP, (d) GFP BRP, (e) GFP BRP N1132A, (f) GFP Bd. Cells were treated with or without the HDAC inhibitor Trichostatin A (TSA). Ectopically expressed proteins were visualized by GFP and co-detected with an anti-tetraacetyl-histone H4 antibody. Immunofluorescence was performed with anti-ha or anti-h3k56ac antibody. Bar: 10 µm.

Supplementary Fig.6 Uncropped images for the blots shown in figure 4 a and b. (a) Anti p300 K1499 acetyl immunoblot of lysates of H1299 cells transfected with the indicated mutants. (b) Loading control of hemagglutinin (HA)-tagged p300, determined by immunoblotting with anti-ha antibody. (c) Anti p53 K373 K382 acetyl (p53 KAc) immunoblot of lysates of H1299 cells, transfected with the indicated p300 mutants and p53. (d) Loading control of Flag-tagged p53 and (e) HA-p300, determined by immunoblotting with anti-flag or anti-ha antibody, respectively.

Supplementary Table 1. Structure based mutagenesis and functional analysis Mutation Domain Structural Auto Disease PMID* alteration acetylation WT + Bd Bd 1047 1161 + RING RING 1168 1242 +++ 1198 1243 Breast 1070018 AIL HAT 1520 1581 + 8 N1132A Bd KAc binding pocket + F1170E RING RING HAT contact + Y1178D RING E2 binding + C1204R RING Zinc ligation +++ Lymphoid Neoplasm 2139012 I1208D RING E2 binding + 6 E1242R RING RING HAT contact +++ E1242K RING RING HAT contact +++ RTS (CBP) 1256639 F1244A PHD PHD Bromo contact + 1 H1255A PHD Zinc ligation + I1257A PHD PHD HAT contact + L1260E PHD PHD HAT contact + I1265D PHD PHD HAT contact + F1288E W1593E M1596E PHD or HAT PHD HAT contact + D1399Y HAT HAT L1 loop Colon Cancer 2179889 G1443E HAT HAT RING contact + 3 H1449Y HAT HAT RING contact + Y1467F HAT HAT CoA contact Lymphoid Neoplasm 2139012 R1645E HAT HAT RING contact + Malignant Melanoma 62149924 R1645E R1646E HAT HAT RING contact +++ 7 *PMID: Pubmed Identifier

Supplementary Table 2. Interactions in histone peptide arrays with GST BRP Peptide Mod1 Mod2 Mod3 Mod4 N terminus Intensities H4 11 30 K16ac K20ac acetylated 0.288 H4 1 19 R3me2s K5ac K8ac K12ac free 0.279 H4 1 19 K5ac K8ac K12ac free 0.278 H4 1 19 R3me2a K5ac K8ac free 0.277 H4 1 19 K8ac K12ac K16ac free 0.276 H4 1 19 R3me2a K5ac K8ac K12ac free 0.273 H4 11 30 K16ac R19me2a acetylated 0.271 H2B 1 19 K12ac K15ac free 0.269 H4 11 30 R24me2s K20ac acetylated 0.268 H2B 1 19 K5ac K12ac K15ac free 0.265 H4 11 30 K16ac K20me3 acetylated 0.263 H2B 1 19 K5ac K15ac free 0.263 H4 1 19 R3me2s K5ac K8ac free 0.260 H4 1 19 K5ac K8ac K12ac K16ac free 0.258 H4 11 30 K16ac K20me2 acetylated 0.258 H4 11 30 K12ac K16ac K20me2 acetylated 0.258 H2A 1 19 K13ac free 0.258 H2B 1 19 S14P K15ac free 0.255 H4 1 19 S1P R3me2s K5ac K8ac free 0.254 H2B 1 19 K5ac K12ac S14P K15ac free 0.251 H4 11 30 K12ac K16ac K20me1 acetylated 0.251 H4 1 19 S1P R3me2a K5ac K8ac free 0.250 H2B 1 19 K12ac S14P K15ac free 0.250 H4 11 30 K12ac K16ac acetylated 0.247 H4 11 30 K12ac K16ac K20me3 acetylated 0.244 H4 1 19 S1P R3me2a K5ac free 0.243 H4 11 30 K16ac K20me1 acetylated 0.243 H4 11 30 K12ac K16ac K20ac acetylated 0.237 H2B 1 19 K5ac S14P K15ac free 0.236 H2A 1 19 K5ac free 0.235 H4 11 30 K20ac acetylated 0.235 H4 1 19 K12ac K16ac free 0.235 H2A 1 19 S1P K9ac K13ac free 0.234 H2B 1 19 K5ac K12ac free 0.231 H2B 1 19 K15ac free 0.230 H4 11 30 R19me2s K20ac acetylated 0.227 H4 1 19 K8ac K16ac free 0.222 H3 1 19 K4ac R8me2s K9ac free 0.216 H4 11 30 R24me2a K20ac acetylated 0.215 H4 1 19 S1P R3me2s K5ac free 0.212 H2A 1 19 K5ac K9ac K13ac free 0.201 H2B 1 19 K12ac free 0.199 H3 1 19 T11P K14ac free 0.198 H4 1 19 K5ac K8ac free 0.198 H4 11 30 K16ac R17me2a acetylated 0.198 H2A 1 19 S1P K5ac K13ac free 0.196 H4 11 30 K12ac acetylated 0.192 H2A 1 19 S1P K5ac K9ac K13ac free 0.192 H3 7 26 K14ac R17me2a K18ac acetylated 0.189 H4 11 30 R19me2a K20ac acetylated 0.187 H4 1 19 R3me2a K5ac free 0.186 H3 1 19 R2me2a K4ac K9ac free 0.186 H3 26 45 K36ac acetylated 0.184 H4 1 19 K8ac K12ac free 0.184 H3 7 26 K14ac K18ac acetylated 0.183 H4 11 30 K16ac R19me2s acetylated 0.182 H4 1 19 K12ac free 0.180 H3 1 19 S10P K14ac free 0.177 H4 1 19 K5ac free 0.171 H3 1 19 K9ac K14ac free 0.166 H3 1 19 R2me2a K4ac R8me2a K9ac free 0.152 H3 1 19 R2me2s K4ac R8me2a K9ac free 0.150 H4 1 19 R3me2s K5ac free 0.147 H2A 1 19 S1P K5ac K9ac free 0.146 H3 7 26 R17me2s K18ac acetylated 0.141 H4 1 19 S1P K5ac free 0.138 H4 1 19 K8ac free 0.136 H3 7 26 K14ac R17me2s K18ac acetylated 0.133 H3 1 19 R2me2s K4ac R8me2s K9me3 free 0.124 H2A 1 19 S1P K5ac free 0.124 H2A 1 19 K5ac K13ac free 0.123 H2A 1 19 K9ac K13ac free 0.115 H2A 1 19 K5ac K9ac free 0.114 H4 11 30 K16ac acetylated 0.109 H4 11 30 K16ac R17me2s acetylated 0.108 H3 16 35 R26me2a K27ac acetylated 0.106 H4 1 19 R3me2s K8ac free 0.104 H2A 1 19 S1P K13ac free 0.101 H4 1 19 R3me2a K8ac free 0.096 H3 1 19 K4ac R8me2a K9me3 free 0.083 H3 1 19 R2me2s K4ac R8me2s K9ac free 0.082 H3 7 26 R17Citr K18ac acetylated 0.080 H3 7 26 R17me2a K18ac acetylated 0.074

H3 1 19 K4ac R8me2s K9me3 free 0.066 H2A 1 19 K9ac free 0.060 H3 16 35 R26me2s K27ac acetylated 0.058 H3 1 19 R2me2a K4me3 K9ac free 0.038 H3 1 19 R2me2s K4ac R8me2a K9me2 free 0.032 H3 7 26 K18ac acetylated 0.018 H3 1 19 R2me2a K4ac R8me2s K9ac free 0.017 H3 1 19 K4ac R8me2a K9ac free 0.016 H3 1 19 K9me2 K14ac free 0.008 H3 16 35 K27ac acetylated 0.005 Supplementary References 1. Thompson, J.D., Higgins, D.G. & Gibson, T.J. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673 80 (1994). 2. Gouet, P., Robert, X. & Courcelle, E. ESPript/ENDscript: Extracting and rendering sequence and 3D information from atomic structures of proteins. Nucleic Acids Res. 31, 3320 3 (2003).

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback