PI3K / AKT / mtor. Signalling Pathway in Cancer. PI3K / AKT / mtor Related Antibodies from CovalAb

Similar documents
PI3K-Akt-mTOR. Signalling pathway in cancer PI3K-Akt-mTOR-related products from Covalab

Phospho-AKT Sampler Kit

Growth and Differentiation Phosphorylation Sampler Kit

A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se

Supplementary Material

Interrogating mtor Inhibition in Patients with HRPC

Antibodies for Unfolded Protein Response

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))

Phosphorylation Site Company Cat #

Receptor mediated Signal Transduction

The PI3K/AKT axis. Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia. Introduction

AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855

Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28

PI3K-Akt-mTOR Pathway, Flyer

Anti-Lamin B1/LMNB1 Picoband Antibody

FACTORS AFFECTING SKELETAL MUSCLE PROTEIN SYNTHESIS IN THE HORSE

Signal Transduction Pathway Smorgasbord

Crosstalk Between MDM2 and Akt Signaling Pathway in Oncogenesis.

Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.

Supplementary Information. Table of contents

S6K1 mediates oncogenic glycolysis in Pten deficient leukemia

q 2017 by The University of Chicago. All rights reserved. DOI: /690105

Expanding mtor signaling

Optimizing Nutritional Strategies to Promote Growth in Newborns

Megan S. Lim MD PhD. Translating Mass Spectrometry-Based Proteomics of Malignant Lymphoma into Clinical Application

Product Datasheet. DARC Antibody NB Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Publications: 5

Oxidant Stress and Signal Transduction in the Nervous System with the PI 3-K, Akt, and mtor Cascade

Ras, PI(3)K and mtor signalling controls tumour cell growth Reuben J. Shaw 1 & Lewis C. Cantley 2

Product Datasheet. EMMPRIN/CD147 Antibody (MEM-M6/1) NB Unit Size: 0.1 mg. Store at 4C. Do not freeze. Publications: 2

Studies on cell growth promoting AKT signaling pathway a promising anti-cancer drug target

Product Datasheet. IGF-I R Antibody (3G5C1) NB Unit Size: 0.1 ml

Product Datasheet. ERCC1 Antibody (8F1) NB Unit Size: 0.1 ml

JOSÉ BASELGA. Massachusetts General Hospital Cancer Center, Boston, Massachusetts, USA

The Relationship Between Insulin Resistance and Hyperinsulinemia on Mammary Cancer Growth and Development

Phospho-PRAS40 Thr246 predicts trastuzumab response in patients with HER2-positive metastatic breast cancer

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α

Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors

KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION

Beyond PTEN mutations: the PI3K pathway as an integrator of multiple inputs during tumorigenesis

Lecture #27 Lecturer A. N. Koval

ProteoScan Cancer Lysate Arrays. QC and Validation Data

TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway

Fluorescence Microscopy

VEGF Polyclonal Antibody Catalog Number PA Product data sheet

Supplementary Material. Part I: Sample Information. Part II: Pathway Information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

SUPPLEMENTARY INFORMATION

RayBio KinaseSTAR TM Akt Activity Assay Kit

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5

Case Study - Informatics

Primary resistance to ATP-competitive mtor inhibitors for the treatment of solid tumors. Gregory Stuart Ducker

Antibodies. for the study of CELL BIOLOGY & CANCER RESEARCH

Product Datasheet. KAP1 Antibody NB Unit Size: 100 ul. Store at 4C. Do not freeze. Publications: 16

Product Datasheet. Endothelin-1 Antibody (TR.ET.48.5) NB Unit Size: 100 ul. Store at -20C. Avoid freeze-thaw cycles.

Supplementary Materials for

Molecular mechanisms of metabolic regulation by insulin in Drosophila

Diabetes. Insulin Signaling PTPases PI 3-K / Akt Pathway GSK-3 Nutrient Sensing (mtor / AMPK ) PPARs GLP-1, DPPIV & Neprilysin

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

TITLE: A Genetic Approach to Define the Importance of Rheb in Tuberous Sclerosis

REVIEW AKT in cancer: new molecular insights and advances in drug development

Review Article Mammalian target of rapamycin: a central node of complex signaling cascades

K-LISA mtor Activity Kit Cat. No. CBA055

New Insights Into Molecular Basis of Glioblastoma Multiforme and Associated Immunosuppression

ABSTRACT: INTRODUCTION

Product Datasheet. Caspase-8 Antibody - (active/cleaved) NB Unit Size: 0.05 ml. Store at -20C. Avoid freeze-thaw cycles.

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Concise Reference. HER2 Testing in Breast Cancer. Mary Falzon, Angelica Fasolo, Michael Gandy, Luca Gianni & Stefania Zambelli

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

FOR REVIEW. BMB Reports - Manuscript Submission. Manuscript Draft. Manuscript Number: BMB

p53 and Apoptosis: Master Guardian and Executioner Part 2

Planar Waveguides: How Nano Layers Enable to Detect Zepto Moles of Macro Molecules in Pico Liter Spots on Micro Arrays

ab For the qualitative measurement of phosphorylated Ser2448 of mtor protein in cell and tissue lysates.

PIK3CA Mutations in HER2-Positive Breast Cancer

7. PI3K-Akt regulation as a molecular mechanism of the stress response during aerobic dormancy

Phosphoserine Detection Kit

Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients

Current development of mtor inhibitors as anticancer agents

PCB 3023 Exam 4 - Form A First and Last Name

Organ Size Control by Hippo and TOR Pathways

Glycogen Synthase Kinase 3 is Required for Optimal AKT Activation

Easy50 PI3K Inhibitor Array*

Iso-Insulin ELISA ( ), Brochure

TITLE: Cyclin E, A Powerful Predictor of Survival in Breast Cancer-A Prospective Study

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

M.Sc Thesis- Yaryna Storozhuk- McMaster University- Medical Sciences MOLECULAR RESPONSES OF LUNG CANCER TO IONIZING RADIATION:

Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis

Novel Strategies in Systemic Therapies: Overcoming Endocrine Therapy Resistance

supplementary information

PI3K Background. The SignalRx R & D pipeline is shown below followed by a brief description of each program:

Supporting Information

Critical Review. What Controls TOR? Estela Jacinto Department of Physiology and Biophysics, UMDNJ-Robert Wood Johnson Medical School, Piscataway, NJ

cdc2 cyclin B regulates eef2 kinase activity in a cell cycle- and amino acid-dependent manner

Cell Lysis Buffer. Catalog number: AR0103

The mtor Signalling Pathway in Human Cancer

Diagnostic test Suggested website label Description Hospitals available

Minireview Shrinkage control: regulation of insulin-mediated growth by FOXO transcription factors Thomas P Neufeld

Supplementary Materials for

PI3K/mTOR Dual Inhibitor

PI3K-AKT-mTOR-Signaling and beyond: the Complex Network in Gastroenteropancreatic Neuroendocrine Neoplasms

Transcription:

NEWSLETTER Version 1 From Research to Discovery PI3K / AKT / mtor Signalling Pathway in Cancer PI3K / AKT / mtor Related Antibodies from CovalAb www.covalab.com CovalAb - 11 avenue Albert Einstein 69100 VILLEURBANNE - France Tel: +33 (0) 437 654 230

Amongst the numerous pathways implicated in cancer development, the PI3K/AKT/mTOR signalling pathway is highly active in cancer cells. Mutation or amplification of the PI3-kinase or AKT genes, as well as loss of function of PTEN protein, result in the activation of the mtor pathway, which is associated with a poor prognosis in cancer, and therapy resistance. Antibodies 14-3-3 (60C10) Ms Hu, Ms, Rat IHC - P, WB mab71368 14-3-3 (C-Terminus) Rb Rat, Hu, Ms... IHC - P, WB pab70029 14-3-3 Rb Hu, Ms, Rat IHC - P, IP, WB pab74800 14-3-3 Beta (aa1-246) (J2E9) Ms Hu ELISA, IHC - P, WB mab70291 14-3-3 Beta (N-Terminus) Rb Hu, Ms, Rat IHC - P pab72731 14-3-3 Beta (N-Terminus) Rb Hu, Ms, Rat IHC - P, WB pab74861 14-3-3 Beta Rb Hu, Zfi ICC, IF, IHC - P pab73313 14-3-3 Beta Rb Hu, Zfi ICC, IF, IHC - P pab73314 14-3-3 Beta Rb Hu, Ms, Rat IHC - P, WB pab75102 14-3-3 Epsilon / YWHAE (aa1-255) (5A5) Ms Hu ELISA, IHC - P, WB mab70282 14-3-3 Eta / YWHAH (N-Terminus) Rb Chick, Hu, Ms IHC - P, WB pab74766 14-3-3 Gamma (KC21) Ms Hu, Ms, Rat WB mab50115 14-3-3 Gamma / YWHAG (aa1-247) (J3H10) Ms Hu ELISA, IHC - P, WB mab70294 14-3-3 Gamma (HS23) Ms Hu, Ms, Rat WB mab50036 14-3-3 protein Sigma (Stratifin) Rb Hu, Ms, Rat ELISA, IHC, WB pab0392 14-3-3 protein Sigma phosphoserine 248 (Stratifin-pSer248) Rb Hu ELISA, WB, IHC pab0713 14-3-3 protein Zeta/Delta phosphoserine 184 (KCIP-1/pSer184) Rb Hu ELISA, WB, IHC pab0644 14-3-3 Tau / YWHAQ (aa1-245) (AT1A1) Ms Hu ELISA, IHC - P, WB mab70297 14-3-3 Zeta Delta / YWHAZ (C-Terminus) Rb Hu, Ms, Rat IF, IHC - P, WB... pab74327 14-3-3 Zeta Delta / YWHAZ (Internal) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74404 14-3-3 Zeta Delta / YWHAZ (pser58) Rb Hu, Ms, Rat IHC - P, WB pab72083 AKT Rb Hu, Ms, Rat IHC - P, IP, WB pab75231 AKT1 (C-Terminus) Rb Hu IHC - P, WB pab72125 AKT1 (N-Terminus) Rb Hu, Ms, Rat IHC - P, WB pab70307 AKT1 (pser473) Rb Hu ELISA, IHC - P, WB pab70039 AKT1 (pthr308) Rb Hu ELISA, IHC - P, WB pab70040 AKT1 (pthr308) Rb Hu, Ms, Rat IHC - P, WB pab71951 AKT1 Rb Hu, Ms, Rat WB, IHC, IF... pab80597 AKT1 Rb Hu, Rat, Ms ELISA, WB, IHC pab0895-p AKT1 pser473 Rb Hu, Rat, Ms ELISA, WB pab0834-p AKT1 pthr308 Rb Hu, Rat, Ms ELISA, WB pab0832-p AKT1 pthr450 Rb Hu, Rat, Ms ELISA, WB pab0833-p AKT1/2/3 (Internal) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74277 AKT2 (1B6) Ms Hu, Mk, Rat IF, IHC - P, WB... mab70099 AKT3 (aa119-136) (66C1247.1) Ms Hu, Ms, Rat IHC - P, WB mab70131 AKT3 (aa119-136) Rb Hu, Ms, Rat IHC - P, WB pab74591 AKT3 (Internal) Goat Hu, Ms, Rat ELISA, IHC - P, WB pab72934 AKT3 (N-Terminus) Rb Hu, Ms IHC - P, WB pab70308 ATG13 (C-Terminus) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab70353 14-3-3 Beta pab73313 14-3-3 Gamma mab50036 AKT1(pSer473) pab70039 Anti-14-3-3 Beta ICC staining (in green) of HeLa cells. Immunocytochemistry of paraformalhehydefixed cells. DAPI in blue. Anti-14-3-3 Gamma western blot staining of lane 1 : HeLa cell lysate lane 2 & 3 : bengamide treated (8h) cell lysate. Anti-AKT1 IHC staining of human skeletal muscle. Immunohistochemistry of formalin-fixed paraffinembedded tissue after heat-induced antigen retrieval. www.covalab.com CovalAb - 11 avenue Albert Einstein 69100 VILLEURBANNE - France Tel: +33 (0) 437 654 230 1

REFERENCES 1. Yuan TL and Cantley LC. PI3K pathway alterations in cancer: variations on a theme. 2008. Oncogene 27:5497-510 2. Yang WL et al. Regulation of Akt signaling activation by ubiquitination. 2010. Cell Cycle 9:487-97 3. Zhao B. Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control. 2007. Genes Dev 21:2747-61 4. Sakamaki JI et al. Arginine methylation of BCL-2 antagonist of cell death (BAD) counteracts its phosphorylation and inactivation by Akt. 2011. PNAS 108:6085-90 5. Takahashi-Yanaga F and Sasaguri T. GSK-3beta regulates cyclin D1 expression: a new target for chemotherapy. 2008. Cell Signal 20:581-9 6. Wullschleger S et al. TOR signaling in growth and metabolism. 2006. Cell 124:471-84 7. De Benedetti A and Graff JR. eif-4e expression and its role in malignancies and metastases. 2004. Oncogene 23:3189-99 8. Wade M et al. The p53 orchestra: Mdm2 and Mdmx set the tone. 2010. Trends Cell Biol 20:299-309 9. Chipuk JE et al. Direct activation of Bax by p53 mediates mitochondrial membrane permeabilization and apoptosis. 2004. Science 303:1010-4 10. Fu Z and Tindall DJ. FOXOs, cancer and regulation of apoptosis. 2008. Oncogene 27:2312-9 www.covalab.com CovalAb - 11 avenue Albert Einstein 69100 VILLEURBANNE - France Tel: +33 (0) 437 654 230 ABBREVIATIONS Akt = protein kinase B; BAD = Bcl-2-associated death promoter; Bax = Bcl2-associated X protein; Bcl-2 = B-cell lymphoma protein-2; Bim = BH3-only protein; Cyclin D1 = G1/S-specific cyclin-d1; eif4ebp1 = eukaryotic translation initiation factor 4E-binding protein 1; FoxO1 = forkhead box protein O1; GAB2 = GRB2-associated-binding protein 2; Grb2 = growth factor receptor-bound protein 2; GSK3 = glycogen synthase kinase 3; IRS-1 = insulin receptor substrate 1; Mdm2 = mouse double-minute 2 protein; mlst8/gβl = mammalian lethal with SEC13 protein 8/G protein beta subunit-like; mtor = mammalian target of rapamycin; mtorc1 = mammalian target of rapamycin complex 1; mtorc2 = mammalian target of rapamycin complex 2; PDCD4 = programmed cell death protein 4; PDK1 = 3-phosphoinositide-dependent protein kinase 1; PI3K = phosphatidylinositol 3 kinase; PRR5 = proline-rich protein 5; PTEN = phosphatase and tensin homolog; p27kip1 = cyclin-dependent kinase inhibitor 1B; p53 = tumor protein 53; Rheb = Ras homolog enriched in brain; RTK = receptor tyrosine kinase; XIAP = X-linked inhibitor of apoptosis; YAP = Yes-Associated Protein/ Yorkie homolog. www.covalab.com CovalAb - 11 avenue Albert Einstein 69100 VILLEURBANNE - France Tel: +33 (0) 437 654 230 2

Antibodies BAD pab80585 Bim mab70713 CCND1 pab70552 Anti-BAD IF staining of rat thymus. Anti-BCL2L11/Bim IHC staining of human heart. Immunohistochemistry of formalinfixed, paraffin-embedded tissue after heatinduced antigen retrieval. Anti-Cyclin D1 IF staining (in green) of HeLa cells. Actin filaments in red. ATG13 (C-Terminus) Rb Hu, Ms, Rat WB, IHC, IF... pab81118 BAD (C-Terminus) Rb Hu, Ms, Rat WB, IHC, IF... pab80585 BAD (C-Terminus) Rb Hu, Ms, Rat IHC - P, WB pab74999 BAD (C-Terminus) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74258 BAD (Internal) Rb Hu, Ms, Rat ELISA, IHC - P pab74329 BAD (N-Terminus) (BYC001) Ms Ms, Hu IHC - P, IP, WB mab70326 BAD (pser112) Rb Hu, Ms, Rat IHC - P, WB pab71955 BAX (6A7) Ms Hu, Ms, Rat IHC - P, IP, WB mab71211 BAX (Internal) Rb Hu, Ms, Rat ELISA, IF, IHC - P pab73965 BAX (N-Terminus) Rb Ms, Hu, Rat IHC - P, IP, WB pab74913 BAX (N-Terminus) Rb Hu ICC, IHC - P, WB pab74874 BAX Rb Hu WB, ICC, IF... pab80303 BCL2 / Bcl-2 (11C5) Ms Hu IHC - P, IP, WB mab71374 BCL2 / Bcl-2 (aa41-54) Ms Hu FC, IF, IHC - P mab70328 BCL2 / Bcl-2 (Internal) Rb Hu, Ms, Rat IF, IHC - P, WB... pab73966 BCL2 / Bcl-2 (pser70) Rb Hu IHC - P pab71957 BCL2 / Bcl-2 (pthr56) Rb Hu IHC - P, WB pab71956 BCL2 / Bcl-2 Rb Hu IHC - P, WB pab75275 BCL2 Rb Hu ELISA, WB, ICC pab80216 BCL2 Rb Hu, Ms WB, IHC, IF... pab80584 Bim / BCL2L11 (Internal) Rb Hu, Ms, Rat ICC, IHC - P, WB pab70412 Bim / BCL2L11 (N-Terminus) Rb Hu, Ms, Rat IHC - P, WB pab74063 Bim Ms Hu, Ms, Rat WB, ICC, IF... mab80032 Bim Rb Hu, Ms, Rat ELISA, WB, IHC pab80416 Bim Rb Hu, Ms, Rat WB, ICC, IF... pab80307 CCND1 / Cyclin D1 (CD1.1) Ms Hu, Rat FC, ICC, IHC - F mab70713 CCND1 / Cyclin D1 (Ser90) Rb Hu, Ms IF, IHC - P, WB... pab70552 CDKN1B / p27 Kip1 (4B4-E6) Ms Hu IF, IHC - P, WB... mab70794 CDKN1B / p27 Kip1 (C-Terminus) Rb Hu, Ms, Rat IHC - P, IP, WB pab73599 CDKN1B / p27 Kip1 (C-Terminus) Rb Hu, Ms, Rat IHC - P, IP, WB pab74928 CDKN1B / p27 Kip1 (Internal) Goat Hu, Ms, Rat ELISA, IHC - P, WB pab72942 CDKN1B / p27 Kip1 (pthr187) Rb Hu ELISA, IHC - P, WB pab70627 CDKN1B / p27 Kip1 (pser10) Rb Hu, Ms, Rat IHC - P, WB pab72061 CDKN1B / p27 Kip1 Rb Hu IHC - P, WB pab74994 EIF4B (aa150-200) Rb Hu, Ms, Rat... IHC - P, WB pab74158 EIF4B (aa570-630) Rb Hu, Mk, Ms IHC - P, WB pab74169 EIF4B (pser422) Rb Hu ELISA, IHC - P, WB pab75290 www.covalab.com CovalAb - 11 avenue Albert Einstein 69100 VILLEURBANNE - France Tel: +33 (0) 437 654 230 3

Antibodies EIF4EBP1 pab70848 FOXO1 pab74237 mtor pab74323 Anti-EIF4EBP1/4EBP1 IHC staining of human prostate. Immunohistochemistry of formalin-fixed paraffin-embedded tissue after heat-induced antigen retrieval. Anti-FOXO1 western blot staining of HeLa cell lysate. Anti-MTOR IHC staining of human testis. Immunohistochemistry of formalin-fixed, paraffinembedded tissue after heat-induced antigen retrieval. EIF4E (C-Terminus) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74060 EIF4E (N-Terminus) Rb Hu IHC - P, WB pab72277 EIF4EBP1 / 4EBP1 (aa101-118) Rb Hu, Ms, Rat GS, IHC - P, WB pab72829 EIF4EBP1 / 4EBP1 (C-Terminus) Rb Hu ICC, IHC - P, WB pab70848 EIF4EBP1 / 4EBP1 (Internal) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74250 EIF4EBP2 / 4EBP2 (aa99-120) Rb Hu, Ms, Rat IHC - P, WB pab72830 EIF4ENIF1 (C-Terminus) Goat Hu, Ms, Rat ELISA, IHC - P, WB pab72332 FOXO1 (aa242-655) (7H3) Ms Hu IHC - P, WB mab70133 FOXO1 (C-Terminus) Goat Hu, Ms, Rat... IHC - P pab73015 FOXO1 (Internal) Rb Hu, Ms, Rat IF, IHC - P, WB... pab74237 FOXO1 (N-Terminus) Rb Hu, Ms, Rat WB, ICC, IF... pab81123 FOXO1 (N-Terminus) Rb Hu, Ms, Rat ICC, IHC - P, WB pab70979 FOXO1 (pser256) Rb Hu, Ms, Rat IHC, IHC - P, WB pab73083 GAB2 (Internal) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74281 Glycogen synthase kinase-3 Rb P. fals. ELISA, IHC, WB pab0250 Glycogen synthase kinase-3 Beta 2 Rb Hu ELISA, WB, IF pab0668 GRB2 (C-Terminus) Rb Hu, Ms, Rat IHC - P, WB pab73178 GRB2 (C-Terminus) Goat Hu, Ms, Rat ELISA, IHC - P, WB pab72922 GRB2 Rb Hu IHC - P, WB pab72987 GSK3B / GSK3 Beta (C-Terminus) Rb Hu, Ms, Rat IHC, IHC - P, WB pab75210 GSK3B / GSK3 Beta (pser9) Rb Hu GS, IF, IHC - P pab70152 GSK3B / GSK3 Beta Rb Rat, Hu, Ms IF, IHC - P, WB pab75234 IRS1 (aa1223-1242) Rb Hu, Ms, Rat IHC - P pab72749 IRS1 (C-Terminus) Rb Hu IHC - P, WB pab72768 IRS1 (Internal) Rb Hu, Ms, Rat ELISA, IF, IHC - P pab73796 IRS1 (Internal) Rb Hu, Ms ICC, IHC - P, WB pab71542 IRS1 Rb Hu, Ms WB, ICC, IF... pab80318 MDM2 (1A7) Ms Hu ELISA, IHC - P, WB mab70863 MDM2 (aa154-167) (SMP14) Ms Hu, Ms IHC, IHC - F, IP mab71411 MDM2 (aa177-195) Rb Ms ELISA, IHC - P, WB pab70162 MDM2 (pser185) Rb Ms ELISA, IHC - P, WB pab70163 MDM2 (pser395) Rb Hu ELISA, IHC - P pab71722 MDM4 / MDMX (2D10F4) Ms Hu ELISA, IF, IHC, WB mab70075 MLST8/ GBL (aa150-200) Rb Hu, Ms, Rat IHC - P, WB pab74502 MLST8/ GBL (C-Terminus) Rb Hu, Ms, Rat IHC - P, WB pab71043 mtor (aa2440-2457) Rb Hu, Ms, Rat IF, IHC - P, WB... pab70158 mtor (C-Terminus) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74323 www.covalab.com CovalAb - 11 avenue Albert Einstein 69100 VILLEURBANNE - France Tel: +33 (0) 437 654 230 4

Antibodies mtor (C-Terminus) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74267 mtor (N-Terminus) Rb Hu, Ms ICC, IHC - P, WB pab71788 mtor (pser2448) Rb Hu ELISA, IHC - P, WB pab70076 mtor Rb Hu, Ms ELISA, WB, IHC pab0894-p p53 / TP53 (Acetyl-Lys379) Rb Hu, Ms, Rat ELISA, IF, IHC - P pab73997 p53 / TP53 (C-Terminus) Rb Hu IF, IHC - P, WB... pab74272 p53 / TP53 (C-Terminus) Rb Hu, Ms, Rat IF, IHC - P, WB... pab74392 p53 / TP53 (C-Terminus) Rb Hu, Ms, Rat IF, IHC - P, WB... pab74391 p53 / TP53 (N-Terminus) Rb Hu, Rat ELISA, IHC - P, WB pab74269 p53 / TP53 (N-Terminus) Rb Hu, Ms, Rat IF, IHC - P, WB... pab74271 p53 / TP53 Ms Hu ELISA, IHC - P, IP, WB mab70600 p53 (H53C2) Ms Hu ELISA, WB, IHC, IP mab0052-p p53r2 Rb Hu, Ms, Rat WB, IHC, IF... pab80536 PDCD4 (aa1-469) (K4C1) Ms Hu ELISA, IHC - P, WB mab70283 PDCD4 (C-Terminus) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab70157 PDCD4 (C-Terminus) Rb Hu, Ms, Rat IHC - P, WB pab72099 PDCD4 (C-Terminus) Rb Hu, Ms, Rat ELISA, WB, IHC pab80473 PDCD4 (pser457) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab70146 PDCD4 Rb Hu, Ms, Rat IHC - P, WB pab75081 PHLPP1 (N-Terminus) Rb Hu ELISA, WB pab81508 PHLPP2 (C-Terminus) Rb Hu ELISA, WB pab81509 PI 3 Kinase p110 Delta (aa450-550) Rb Hu IHC - P, WB pab72240 PIK3C2A (3E7) Ms Hu ELISA, IHC - P, WB mab71053 PIK3CA (Internal) Goat Hu, Ms, Rat ELISA, IHC - P pab72400 Protor-1 / PRR5 (C-Terminus) Rb Hu, Ms, Rat WB, IHC, IF... pab81287 Protor-1 / PRR5 (C-Terminus) Rb Hu IHC - P, WB pab72514 Protor-2 / PRR5L Rb Hu ELISA, IHC, WB pab0500 Protor-2 / PRR5L Rb Hu, Ms WB, ICC, IF... pab81288 PRR5 (C-Terminus) Rb Hu IHC - P, WB pab72514 PRR5 (C-Terminus) Rb Hu, Ms, Rat WB, IHC, IF... pab81287 PTEN (C-Terminus) Rb Hu, Ms ELISA, WB pab80085 PTEN (N-Terminus) Rb Hu, Ms ELISA, WB, IF pab80388 PDK1 Rb Hu, Ms, Rat... IHC - P, WB pab75233 PDK1 Rb Hu ELISA, IHC - P, WB pab75048 Pyruvate dehydrogenase kinase (PDK1) [Biotin] Rb Hu WB pab50698 Pyruvate dehydrogenase kinase (PDK1) [Biotin] Rb Hu WB pab50692 Pyruvate dehydrogenase kinase (PDK1) [DyLight 488] Rb Hu WB pab50700 p53(h53c2) mab0052 PI3K p110 Delta pab72240 PDK1 pab75233 Immunoprecipitation of p53 mutated forms stably expressed in the p53 null HEp3B cell line: lane 1: Hep3B - lane 2: Hep3B143 lane 3: Hep3B248 - lane 4: Hep3B249. Anti-PI3 kinase p110 Delta IHC staining of human placenta, neutrophils. Immunohistochemistry of formalin-fixed, paraffin-embedded tissue after heatinduced antigen retrieval. Anti-PDK1 western blot staining of lysate from: lane 1: MWM cell, lane 2: HeLa cell, lane 3: rat brain, lane 4: mouse brain, lane 5: Vero cell, lane 6: ESK-4 cell, lane 7: RK-13 cell, lane 8: MDCK cell. www.covalab.com CovalAb - 11 avenue Albert Einstein 69100 VILLEURBANNE - France Tel: +33 (0) 437 654 230 5

Antibodies Pyruvate dehydrogenase kinase (PDK1) [DyLight 488] Rb Hu WB pab50694 Pyruvate dehydrogenase kinase (PDK1) [DyLight 550] Rb Hu WB pab50702 Pyruvate dehydrogenase kinase (PDK1) [DyLight 550] Rb Hu WB pab50696 Pyruvate dehydrogenase kinase (PDK1) [DyLight 650] Rb Hu WB pab50699 Pyruvate dehydrogenase kinase (PDK1) [DyLight 650] Rb Hu WB pab50693 Pyruvate dehydrogenase kinase (PDK1) [HRP] Rb Hu WB pab50701 Pyruvate dehydrogenase kinase (PDK1) Rb Hu, Ms, Rat WB pab50211 Rheb (Internal) Rb Hu, Ms, Rat IHC - P, WB pab75117 Rheb (N-Terminus) Rb Hu, Ms, Rat ELISA, WB pab80082 Rheb Rb Hu, Ms, Rat IHC - P, WB pab72847 Rheb Rb Hu, Ms, Rat WB, IHC, IF pab80596 RICTOR (1F3) Ms Hu IHC - P, IP, WB mab71077 RICTOR (C-Terminus) Goat Hu, Ca, Ms ELISA, IHC - P pab74051 RPS6 (C-Terminus) Rb Hu, Ms, Rat IF, IHC - P, WB... pab73900 RPS6 (pser235) Rb Hu, Ms, Rat IHC - P, WB pab72108 RPS6KB1 / S6K (C-Terminus) Rb Hu, Ms, Rat IHC - P, IP, WB pab70130 RPS6KB1 / S6K (C-Terminus) Goat Hu, Ms, Rat ELISA, IHC - P, WB pab73148 RPS6KB1 / S6K (C-Terminus) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74280 RPS6KB1 / S6K (Internal) Rb Hu, Ms, Rat IF, IHC - P, WB... pab74275 RPS6KB1 / S6K (Internal) Rb Hu, Ms, Rat ELISA, IHC - P, WB pab74363 RPS6KB1 / S6K (pser411) Rb Hu, Ms, Rat IHC - P, WB pab71965 RPTOR / Raptor (aa900-950) Rb Hu, Ms IHC - P, WB pab74797 RPTOR / Raptor (N-Terminus) Rb Hu, Ms ICC, IHC - P, WB pab72900 RPTOR / Raptor Rb Hu, Ms ICC, IHC - P, WB pab72901 RPTOR / Raptor Rb Hu IHC - P, WB pab72114 Serine / threonine-protein Phosphatase 2A (PP2A) Ms Hu, Ms IP, WB mab50072 SGK1 (1C4) Ms Hu IF, IHC - P, WB... mab70910 SGK1 (3C4) Ms Hu IF, IHC - P, WB... mab70911 SGK1 (3E3) Ms Hu IF, IHC - P, WB... mab70909 SGK1 (3G8) Ms Hu IF, IHC - P, WB... mab70912 SGK1 (aa419-431) Rb Hu ELISA, IHC - P, WB pab70167 SGK1 (C-Terminus) Rb Hu, Ms, Rat WB, IHC, IF pab81299 SIN1 (aa100-150) Rb Hu, Ms, Rat IHC - P, WB pab73961 SIN1 (Internal) Rb Hu, Ms, Rat IHC - P, WB pab73206 SIN1 (N-Terminus) Rb Hu, Ms, Rat IHC - P, WB pab73207 PDK1 pab50211 Rheb pab80596 RPTOR pab72114 Anti-PDK1 western blot staining of human heart lysate. Anti-Rheb IF staining of mouse brain cells. Anti-RPTOR IHC staining of human kidney. Immunohistochemistry of formalin-fixed, paraffinembedded tissue after heat-induced antigen retrieval. www.covalab.com CovalAb - 11 avenue Albert Einstein 69100 VILLEURBANNE - France Tel: +33 (0) 437 654 230 6

Antibodies TSC1 pab73745 VPS43 pab50333 Yorkie homolog pab0848-p Anti-TSC1 IHC staining of human heart. Immunohistochemistry of formalin-fixed, paraffinembedded tissue after heat-induced antigen retrieval. Anti-VPS34 western blot staining of HepG2 cell lysate. Anti-YAP1 homolog staining of HeLa cells expressing YAP1. SIN1 / MAPKAP1 (N-Terminus) Rb Hu, Ms, Rat WB, IHC, IF pab80667 SIN1 / MAPKAP1 Rb Hu, Ms, Rat ELISA, WB, IHC pab80481 THEM4 / CTMP (Internal) Rb Hu, Ms, Rat IHC, IHC - P, WB pab73519 THEM4 / CTPM Rb Hu, Ms, Rat WB, IHC, IF pab80905 TSC1 (C-Terminus) Rb Hu, Ms ELISA, WB pab80083 TSC1 (C-Terminus) Rb Hu, Ms IHC - P, WB pab73744 TSC1 (C-Terminus) Goat Hu, Ms, Rat ELISA, IHC - P, WB pab73166 TSC1 Rb Hu, Ms, Rat WB, ICC, IF... pab80315 TSC1 Rb Hu, Ms, Rat ICC, IHC - P, WB pab73745 TSC2 (C-Terminus) Rb Hu, Ms ELISA, WB pab80084 TSC2 (N-Terminus) Rb Hu, Ms WB, ICC, IF... pab80316 TSC2 / Tuberin (C-Terminus) Rb Hu, Ms IHC - P, WB pab73746 TSC2 / Tuberin (N-Terminus) Rb Hu, Ms ICC, IHC - P, WB pab73747 TSC2 / Tuberin (pser664) Rb Hu IF, IHC - P pab74899 TSC2 / Tuberin (pthr1462) Rb Hu IF, IHC - P pab74900 TSC2 / Tuberin (pser1798) Rb Hu ELISA, IHC - P, WB pab73749 VPS34 Rb Hu, Ms, Rat... WB pab50333 VPS34 [Biotin] Rb Hu WB pab51579 VPS34 [DyLight 488] Rb Hu WB pab51581 VPS34 [DyLight 550] Rb Hu WB pab51583 VPS34 [DyLight 650] Rb Hu WB pab51580 VPS34 [HRP] Rb Hu WB pab51582 XIAP (C-Terminus) Rb Hu, Ms IHC - P, WB pab74231 XIAP Rb Hu ICC, IF, IHC - P pab73363 XIAP Rb Hu WB pab51048 Yorkie homolog (YAP1) (2F12) Ms Hu IF, IHC - P, WB... mab70705 YAP1 (2H1) Ms Hu IF, IHC - P, WB... mab70706 YAP1 Rb Hu IHC - P, WB, IP pab50282 YAP1 [Biotin] Rb Hu IHC - P, IP, WB pab51306 YAP1 [DyLight 488] Rb Hu IHC - P, IP, WB pab51308 YAP1 [DyLight 550] Rb Hu IHC - P, IP, WB pab51310 YAP1 [DyLight 650] Rb Hu IHC - P, IP, WB pab51307 YAP1 [HRP] Rb Hu IHC - P, IP, WB pab51309 YAP1 Rb Hu WB, IHC, IF pab0848-p www.covalab.com CovalAb - 11 avenue Albert Einstein 69100 VILLEURBANNE - France Tel: +33 (0) 437 654 230 7

Custom Services Custom Polyclonal Antibodies Development Anti-Protein Anti-Peptide Anti-Post-Translational Modification Custom Monoclonal Antibodies Development Monoclonal Antibody Production In vivo In vitro Expertise Advices for projects design and optimisation of R&D processes Customised technical troubleshooting support Active follow-up of projects Peptide Synthesis Antibody Purification Biomolecule Labelling Development of Immunoaffinity Supports (columns) Functionalisation of Solid Phases (microtitration plates) From Research to Discovery Our range of products constantly increases, but if you don t find the antibody you re looking for in our catalog, we can develop it for you. Our services allow you to create a custom antibody that meets your needs. So contact us by phone at +33 (0) 437 654 230 or submit your enquiries at: enquiries@covalab.com. CovalAb 11 avenue Albert Einstein 69100 VILLEURBANNE - FRANCE Tel: +33 (0) 437 654 230 - Fax: +33 (0) 437 289 416 Emails: for order: orders@covalab.com - for information: enquiries@covalab.com www.covalab.com

PI3K/AKT/mTOR Signaling Pathway in Cancer Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326 44 51 F BE +32 (0)2 503 03 27 6851 TE Huissen E info@bio-connect.nl The Netherlands W www.bio-connect.nl