Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan in the absence or presence of Syk inhibitor piceatannol or Raf inhibitor GW5074. Expression is normalized to GAPDH and set at 1 in zymosan-stimulated cells. Data are presented as mean ± s.d. of at least two independent experiments. 1
Supplementary Figure 2 Supplementary Figure 2 Role of Raf-1 in Dectin-1-mediated cytokine expression : silencing of Raf-1 with three different sirnas. Raf-1 expression in DCs was silenced by RNA interference using three different sirnas directed against Raf-1. Silencing was confirmed at the mrna level by (a) quantitative real-time PCR, or at the protein level by (b) staining and flow cytometry. (c) Quantitative real-time PCR of indicated mrnas in curdlan-stimulated DCs after Raf-1 silencing by RNA interference with three different sirnas. Expression is normalized to GAPDH and set at 1 in curdlan-stimulated cells. Data are representative of two (a,b) independent experiments or presented as mean ± s.d. of two (c) independent experiments. *, P < 0.05. 2
Supplementary Figure 3 Supplementary Figure 3 Dectin-1-mediated cytokine expression requires Syk activation and activation of Src and Pak kinases to control cytokine expression. Quantitative real-time PCR for indicated mrnas in curdlan-stimulated DCs in the absence or presence of Src inhibitor PP2, Rho family GTPases/Pak inhibitor toxin B (txb) or a combination of PP2 and txb. Expression is normalized to GAPDH and set at 1 in curdlan-stimulated cells. Data are presented as mean ± s.d. of at least two independent experiments. 3
Supplementary Figure 4 Supplementary Figure 4 Dectin-1-induced Raf-1 signaling leads to phosphorylation of NF-κB subunit p65. p65 phosphorylation at serines S276 or S536 determined by ELISA in nuclear extracts of curdlan-stimulated DCs after Raf-1 silencing by RNA interference (sirna). Data are presented as mean ± s.d. of two independent experiments. 4
Supplementary Figure 5 Supplementary Figure 5 Dectin-1-induced Raf-1 signaling leads to acetylation on Lys310 of all active p65. (a) p65 acetylation (Ac) determined by ELISA using anti-acetyl-lysine in nuclear extracts of curdlan-stimulated DCs after Raf-1 silencing by RNA interference (sirna). (b) Level of p65 acetylation determined by ELISA in nuclear extracts of curdlan-stimulated DCs in the absence or presence of Raf inhibitor GW5074, before and after removal of all K310Ac-p65-containing protein complexes by immunoprecipitation with anti-acetyl-p65(lys310) (K310Ac-p65 preclearing). Data are presented as mean ± s.d. of two independent experiments. 5
Supplementary Figure 6 Supplementary Figure 6 Role of Raf-1 in Candida albicans-mediated cytokine expression. (a) Raf-1 phosphorylation at serine S338 determined by flow cytometry in unstimulated or C. albicansstimulated DCs in the absence or presence of blocking dectin-1 or DC-SIGN antibodies or a combination of both. Data are representative of four independent experiments. (b) Quantitative realtime PCR of indicated mrnas in C. albicans stimulaed DCs in the absence or presence of blocking dectin-1 or DC-SIGN antibodies, Syk inhibitor piceatannol, Raf inhibitor GW5074 or CBP-p300 HAT activity inhibitor anacardic acid (AA). Expression is normalized to GAPDH and set at 1 in C. albicans-stimulated cells. Data are presented as mean ± s.d. of at least two independent experiments. 6
Supplementary Figure 7 Supplementary Figure 7 Model of Raf-1 signaling dictates T helper cell differentiation. Flow diagram of Dectin-1-induced signaling, leading to NF-κB activation and expression of T H 1- and T H - 17-polarizing cytokines. The Syk signaling pathway induces NF-κB subunits p65 and c-rel as well as NIK-dependent RelB. Both p65 and RelB activity are controlled by the second signaling pathway via Raf-1. Raf-1 activation by Pak and Src kinases leads to phosphorylation of p65 at Ser276, which has distinct effects on NF-κB activation: phosphorylated p65 represses active RelB by forming inactive p65-relb dimers which allows IL-12p40 and IL-1β expression, whereas acetylation of p65 increases its DNA binding and transactivation activity, which modulates IL12p40, IL12p35, IL23p19 and IL6 transcription. 7
Supplementary Figure 8 Supplementary Figure 8 Silencing of Syk, Raf-1, p65, RelB and NIK in human primary DCs by RNA interference. Indicated proteins were silenced using specific SMARTpools, and non-targeting sirna as a control. Silencing was confirmed at the mrna level by quantitative real-time PCR (a,c,f,h,j), or at the protein level by staining and flow cytometry (b,d,g,i,k) or immunofluorescence staining and microscopy (e,l). In (a,c,f,h,j), expression is normalized to GAPDH and set at 1 in control sirna-treated cells. Data are presented as mean ± s.d. of at least four (a,c,f,h,j) independent experiments or representative of at least two (b,g,i) or four (d,e,k,l) independent experiments. 8
Supplementary Methods RNA interference. The sirnas used were: Raf-1 SMARTpool (M-003601-00); Raf-1 sirna-1 (D-003601-01); Raf-1 sirna-2 (D-003601-02); Raf-1 sirna-3 (D-003601-04); Syk SMARTpool (M-003176-03); p65 SMARTpool (M-003533-02); RelB SMARTpool (M- 004767-02); NIK (MAP3K14) SMARTpool (M-003580-03); non-targeting sirna pool (D- 001206-13), as a control (Dharmacon). Transfection efficiency was determined by flow cytometry of cells transfected with siglo-risc free-sirna (D-001600-01). Dectin-1 expression. Dectin-1 expression was determined by staining with anti-dectin1 (R&D Systems) followed by incubation with FITC-conjugated goat anti-mouse (Jackson Immunoresearch). Analysis was performed on a FACS Calibur (BD Biosciences). Quantitative real-time PCR. mrna was isolated using the mrna capture kit (Roche) and cdna was synthesized with the Reverse transcriptase kit (Promega). PCR amplification was performed with the SYBR green method in an ABI 7900HT sequence detection system (Applied Biosystems). Specific primers for cytokine, chemokine, signaling protein and GAPDH genes were designed using Primer Express 2.0 (Applied Biosystems). The Ct value is defined as the number of PCR cycles where the fluorescence signal exceeds the detection threshold value. For each sample, the normalized amount of target mrna was calculated from the obtained Ct values for both target and GAPDH mrna with Nt = 2 Ct(GAPDH)-Ct(target). The relative mrna expression was obtained by setting Nt in curdlan-stimulated (Dectin-1 triggering alone), LPS- or zymosan-stimulated (simultaneous Dectin-1/TLR triggering) or C. albicans-stimulated (Dectin-1 and DC-SIGN triggering) samples at 1 within one experiment and for each donor. DCs were stimulated for 6 hours with curdlan before lysis. mrna expression was optimal at 6 hours for the majority of cytokines and chemokines genes tested (data not shown). Phosphorylation of Syk and Raf-1. Phosphorylated Syk or Raf-1 was either measured by flow cytometry or detected by immunoblotting after immunoprecipitating Raf-1 from whole cell extracts with anti-raf-1 (Upstate Biotechnology) after 5 or 15 min stimulation, respectively. Phosphorylated Syk was detected with rabbit anti-phospho-syk (Tyr525/526) (Cell Signaling Technology), while phosphorylated Raf-1 was detected with rabbit antiphospho-c-raf (Ser338) (Cell Signaling) or rabbit anti-c-raf (ptyr340, Tyr341) 1
(Calbiochem). For the detection of phosphorylated Syk or Raf-1 by flow cytometry, cells were first fixed in 3% para-formaldehyde for 10 min and permeabilized in 90% methanol at 4 C for 10 min. Primary antibody incubation was followed by incubation with PE-conjugated donkey anti-rabbit (Jackson Immunoreseach). Levels of phosphorylated Syk and Raf-1 were analyzed on a FACS Calibur (BD). Detection of phosphorylated Raf-1 by immunoblotting was performed by primary antibody incubation, followed by incubation with HRP-conjugated swine anti-rabbit (DAKO) and ECL detection (Pierce). Phosphorylation and acetylation of NF-κB p65. Phosphorylated or acetylated p65 was either measured by ELISA after capture of p65 from nuclear extracts using the PathScan Total NF-κB p65 sandwich ELISA kit (Cell Signaling) or detected by immunoblotting. p65 phosphorylated at Ser276 or Ser536 was detected with rabbit anti-phospho-p65(ser276) or - p65(ser536) (both from Cell Signaling). p65 acetylated at Lys310 was detected with rabbit anti-acetyl-nf-κb p65 (Lys310) (Cell Signaling), while oerall acetylation was detected with rabbit anti-acetyl-lysine (Upstate). Nuclear extracts were precleared by incubating with rabbit anti-acetyl-nf-κb p65 (Lys310) coated on protein A/G-PLUS agarose beads (Santa Cruz) to remove all Lys310-acetylated p65 protein. p65-relb dimerization. p65-relb dimerization was either determined by ELISA after capture of p65 from nuclear extracts using the PathScan Total NF-κB p65 sandwich ELISA kit (Cell Signaling) or detected by immunoblotting after immunoprecipitating RelB or p65 from nuclear extracts with anti-relb or anti-p65 (both from Cell Signaling). Associated RelB, p65 or p50 were detected with rabbit anti-relb, rabbit anti-p65 or rabbit anti-p50 (all from Cell Signaling). To determine the role of p65 phosphorylation at Ser276 in p65-relb dimerization, either non-phosphorylated or Ser276-phosphorylated GST-p65(1-305) was incubated for 2 hr with nuclear extracts from DCs, in the absence or presence of a p65-derived peptide containing the phosphorylated Ser276 sequence (Phospho-NF-κB (Ser276) blocking peptide; Cell Signaling). GST-p65 and bound proteins were captured using anti-gst-coated wells (Pierce). Associated RelB was detected with rabbit anti-relb (Cell Signaling). GST-p65. GST-p65(1-305) expressed in E. coli DH5α was purified with the B-PER GST purification kit (Pierce) according to the manufacturer s instructions. In vitro kinase reactions were carried out using 100 ng purified GST-p65 and 1 µg recombinant PKA (Active Motif) 2
for 30 min at 30 C. Phosphorylation of GST-p65 at Ser276 was verified as described for cellular p65. Immunofluorescence staining. DCs were stimulated, fixed with 4% para-formaldehyde, then permeabilized with 0.2% (vol/vol) Triton X-100 in PBS, and stained with anti-relb, anti-nik (both from Cell Signaling) or anti-raf-1 (Upstate). Incubation of Alexa Fluor 594- or Alexa Fluor 488-conjugated goat anti-rabbit (Molecular Probes) was follwed by staining of nuclei with Hoechst (Molecular Probes). RelB localization and Raf-1 or NIK expression were determined with a Nikon eclipse E800 microscope. Chromatin immunoprecipitation (ChIP) assay. ChIP assays were performed to determine occupancy of transcriptional regulatory regions of cytokine and chemokine genes by NF-κB and RNAPII, using the ChIP-IT enzymatic kit (Active Motif), as recommended by the manufacturer. Briefly, cells were fixed with 1% para-formaldehyde and nuclei were isolated. Chromatin DNA was fragmented by enzymatic shearing for 10 min at 37 C. After preclearing of lysates using salmon sperm-saturated protein G-agarose beads, protein-dna complexes were immunoprecipitated overnight at 4 C. Input and immunoprecipitated DNA was purified after reversal of crosslinks. Real-time PCR reactions were then performed using the following primers: NF-κB IL10 enhancer: forward 5 AGAGCACAGTGTCCATCCCC 3, reverse 5 AAACCGGATTAAGCGCCC 3 ; NF-κB IL12p35 promoter: forward 5 GAGTACTCAGCCCGCCAGG 3, reverse 5 CCTCTTTGCAGGAGACGGC 3 ; NF-κB IL12p40 promoter: forward 5 TCTTGAAATTCCCCCAGAAGG 3, reverse 5 GGACGGAGAGTCCAATGGC 3 ; NF-κB site 1 IL23p19 promoter: forward 5 CATCCCAGGCCTCTAGCC 3, reverse 5 GGTTTGGTTCCCTCAGTTGTTC 3 ; NF-κB IL6 promoter: forward 5 ACGACCTAAGCTGCACTTTTCC 3, reverse 5 TTGTGTCTTGCCATGCTAAAGG 3 ; NF-κB IL1b promoter: forward 5 CTGTGTGTCTTCCACTTTGTCCC 3, reverse 5 TGCATTGTTTTCCTGACAATCG 3 ; NF-κB CCL17 promoter: forward 5 GTTTCTGGCCCTAGTAACCGG 3, reverse 5 CCACTCCCAAGTTTCTCTCGC 3 ; 3
NF-κB/CCL22 promoter: forward 5 AACCAAGTCCCAGAGACACCC 3, reverse 5 AGTGGAGAAATTCTCTTTGGCG 3 ; +1/IL1b promoter: forward 5 GAAAGCCATAAAAACAGCGAGG 3, reverse 5 AGCCTGTTGTGCCTTGTGC 3 ; +1/CCL17 promoter: forward 5 TTTGCAGCTGTAGAAACTGAGGC 3, reverse 5 CTCTCCCATCAGCAGGCG 3 ; +1/CCL22 promoter: forward 5 AGCCAGCACCTTAAATAGCAGG 3, reverse 5 CAAGGAGGACGAGGACAACC 3. The NF-κB IL12p40 primer set spans the transcription initiation site (+1) of the IL12p40 gene as well, which was used to determine recruitment of RNA polymerase II to the promoter. In addition, an amplification was performed with primers spanning genomic DNA at cytogenetic location 12 p13.3 (included in the ChIP-IT kit), as a negative control. To normalize for DNA input, a sample for each condition was taken along which had not undergone immunoprecipitation with a specific antibody ( input DNA ); the results are expressed as the % input DNA. 4