B6.SJL (Ly5.2) mice were obtained from Taconic Farms. Rag1-deficient mice were

Similar documents
Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Materials for

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the

SUPPLEMENTARY INFORMATION

Eosinophils are required. for the maintenance of plasma cells in the bone marrow

SUPPLEMENTARY FIGURES

Supplemental Figure 1. Protein L

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

D CD8 T cell number (x10 6 )

Peli1 negatively regulates T-cell activation and prevents autoimmunity

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

T Cell Differentiation

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Supplemental Figure 1

PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human

Supplementary Figure 1 IL-27 IL

Supplemental Materials

SUPPLEMENTARY FIGURE 1

SUPPLEMENT Supplementary Figure 1: (A) (B)

Supplementary Materials for

Supporting Information

Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ

Nature Immunology: doi: /ni.3412

Tbk1-TKO! DN cells (%)! 15! 10!

Supporting Online Material for

Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

NK1.1 þ CD8 þ T cells escape TGF-b control and contribute to early microbial pathogen response

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplementary Figures

Supplementary. presence of the. (c) mrna expression. Error. in naive or

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supporting Information

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Pair-fed % inkt cells 0.5. EtOH 0.0

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

Supplemental Table I.

Supplementary Table 1. Oligonucleotide primers used in quantitative and qualitative PCRs of this study.

SUPPLEMENTARY METHODS

Supporting Information Table of Contents

CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas

Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells

Supplementary Materials for

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR

Supplementary Figure 1

CELLULAR AND MOLECULAR REQUIREMENTS FOR REJECTION OF B16 MELANOMA IN THE SETTING OF REGULATORY T CELL DEPLETION AND HOMEOSTATIC PROLIFERATION

Pearson r = P (one-tailed) = n = 9

pplementary Figur Supplementary Figure 1. a.

NK cell flow cytometric assay In vivo DC viability and migration assay

Supplementary Figure 1. Ex vivo IFNγ production by Tregs. Nature Medicine doi: /nm % CD127. Empty SSC 98.79% CD25 CD45RA.

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

Supplementary Information

Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Nature Medicine: doi: /nm.2109

Supporting Online Material for

CD40-Activated B Cells Can Efficiently Prime Antigen- Specific Naïve CD8 + T Cells to Generate Effector but Not Memory T cells

Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood

Supplementary Figures

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

SUPPLEMENTARY INFORMATION. Divergent TLR7/9 signaling and type I interferon production distinguish

Supplementary Information. Paired immunoglobulin-like receptor A is an intrinsic, self-limiting

Supplementary Figure 1.

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Supplemental Information. Checkpoint Blockade Immunotherapy. Induces Dynamic Changes. in PD-1 CD8 + Tumor-Infiltrating T Cells

Low Avidity CMV + T Cells accumulate in Old Humans

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

SUPPLEMENTARY FIGURES

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells

SUPPLEMENTARY INFORMATION

IMMUNOLOGICAL MEMORY. CD4 T Follicular Helper Cells. Memory CD8 T Cell Differentiation

B and T lymphocyte attenuator regulates CD8 + T cell intrinsic homeostasis and memory cell generation

Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs.

Supporting Information

Different Competitive Capacities T Cells during Lymphophenia-Driven Proliferation

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

HD1 (FLU) HD2 (EBV) HD2 (FLU)

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Transcription:

Supplementary Methods Mice. B6.SJL (Ly5.2) mice were obtained from Taconic Farms. Rag1-deficient mice were purchased from The Jackson Laboratory. Real-time PCR Total cellular RNA was extracted from the indicated sorted cells supplemented with 10 μg glycogen using Trizol reagent (Invitrogen). RNA samples were treated with RNasefree DNase I (Invitrogen) before reverse-transcription to eliminate contaminating genomic DNA. Total RNA was reverse transcribed using Superscript II reversetranscriptase and oligo(dt) 12-18 primer (Invitrogen). Real-time PCR was performed on a 7300 Real Time PCR system (Applied Biosystems). Analyses were performed using primers (Invitrogen), an internal fluorescent Taqman probe (Biosearch Technologies) specific to ThPOK and HPRT, and Universal PCR Master Mix (Applied Biosystems). The primer and Taqman probe sequences were as follows. ThPOK primers: 5 - AGAAGCCCTTTGCCTGTGA-3 and 5 -TGTGGATCTTCAGCTTGT CATTC-3 ; ThPOK probe: 5 -FAM-TCTGCGGCGTCCGCTTCAC-3 ; HPRT primers: 5 - TGAAGAGCTACTGTAATGATCAGTCAAC-3 and 5 -AGCAAGCTTGCAACC TTAACCA-3 ; HPRT probe: 5 -FAM-TGCTTTCCCTGGTTAAGCAGTACAGCC C- 3. Generation of mixed bone marrow chimeric mice Bone marrow cells from femur and tibia were incubated with anti-cd3-biotin, anti- 1

CD4-biotin, and anti-cd8-biotin antibodies (ebioscience) followed by anti-biotin MACS beads (Milteneyi). After T cell depletion, 3 x 10 6 bone marrow cells from each of the indicated donors were injected intravenously into sublethally irradiated Rag1 deficient hosts (600 rad). Mice were infected 8-12 weeks after reconstitution. 2

Supplementary Reference S1. Beere, H. M., and D. R. Green. Stress management- heat shock protein-70 and the regulation of apoptosis. 2001. Trends Cell Biol 11: 6-10 S2. Panaretou, B., Siligardi, G., Meyer, P., Maloney, A., Sullivan, J. K., Singh, S., Millson, S. H., Clarke, P. A., Naaby-Hansen, S., Stein, R., Cramer, R., Mollapour, M., Workman, P., Piper, P. W., Pearl, L. H., Prodromou, C. 2002. Activation of the ATPase activity of hsp90 by the stress-regulated cochaperone aha1. Mol Cell 10: 1307-1318 S3. Ohtsu, M., Sakai, N., Fujita, H., Kashiwagi, M., Gasa, S., Shimizu, S., Eguchi, Y., Tsujimoto, Y., Sakiyama, Y., Kobayashi, K., Kuzumaki, N. 1997. Inhibition of apoptosis by the actin-regulatory protein gelsolin. Embo J 16: 4650-4656. S4. de Souza-Pinto, N. C., Maynard, S., Hashiguchi, K., Hu, J., Muftuoglu, M., Bohr, V. 2009. The Recombination Protein Rad52 Cooperates with the Excision Repair Protein Ogg1 for the Repair of Oxidative Lesions in Mammalian Cells. Mol Cell Biol. S5. Potts, P. R., Porteus, M. H., Yu, H. 2006. Human SMC5/6 complex promotes sister chromatid homologous recombination by recruiting the SMC1/3 cohesin complex to double-strand breaks. Embo J 25: 3377-3388 3

CD4+ day46 +LCMV day 20 day 8 CD44 low CD8+ N.D. 0 20 40 60 80 100 Normalized ThPOK Supplementary Figure 1. ThPOK mrna levels increase in polyclonal Ag-specific CD8 T cells after LCMV infection. B6 mice were infected with LCMV. D b /GP33 tetramer-positive CD8 T cells in infected mice at the indicated time-points, and CD44 low CD8 T cells or CD4 T cells in naïve mice were purified using FACS sorting. ThPOK mrna expression levels were assessed by real-time quantitative PCR (normalized to HPRT). The ThPOK mrna level in CD4 T cells was defined as 100. N.D., none detected.

7002 4923 ThPOK/GFP Supplementary Figure 2. Downregulation of ThPOK expression levels in activated CD4 + T cells. hpok expression levels in naïve CD4 T cells (black line) and activated CD44 hi CD4 T cells (blue ine) in ThPOK wt/gfp mice infected with LCMV 8 days post-infection were analyzed by flow cytometry. Numbers in the histograms are mean fluorescent intensity of gfp in naïve CD4 + T cells (black) and ctivated CD44 hi CD4 + T cells (blue). Results are representative of three independent experiments.

TCRβ+ CD8+CD4-T 95 3.5 Vα2 CD4 92 CD8 CD8+CD4-CD44 low T CD8 CD44 CD8+CD4-CD44 hi T 1.6 73 ThPOK/GFP Supplementary Figure 3. ThPOK expression in naïve T cells of ThPOK gfp/gfp mice. ThPOK expression levels in CD44 hi CD4 - and CD44 low CD4 - T cells of naïve ThPOK gfp/gfp mice were analyzed by flow cytometry. Numbers in the dot plots are the percentages. Results are representative of three independent experiments.

A CD28 CD27 KLRG1 CD127 CD62L CCR7 B CD28 CD27 KLRG1 CD127 CD62L CCR7 C CD28 CD27 KLRG1 CD127 CD62L CCR7 Supplementary Figure 4. Surface phenotypes of control and ThPOK-mutant naïve, effector, and memory T cells. A, The expression levels of representative surface molecules on naïve CD44 low ThPOK hd/hd and ThPOK wt/wt T cells in the spleen. B, The expression pattern of epresentative surface markers on effector ThPOK hd/hd and ThPOK wt/wt T cells in the spleen days after LCMV infection. C, The surface phenotype of memory ThPOK hd/hd and ThPOK wt/wt 14 T cells in the spleen. The expression levels were analyzed more than 90 days post-infection. esults are representative of two independent experiments.

A number per spleen (x 10-3 ) 10 1 p=0.54 0.1 ThPOK wt/wt ThPOK hd/hd B 100 p=0.016 10 p=0.004 % thy1.1+ 1 0.1 p=0.18 0.01 4 5 6 7 8 days post infection Supplementary Figure 5. The kinetics of expansion of ThPOK hd/hd and ThPOK wt/wt T cells fter primary infection. A, Four days after LCMV infection, the percentages of CD8 T cells were nalyzed in total spleen cells. The percentages of T cells (Thy1.1) among CD8 T cells in the pleen were determined after enrichment of CD8 T cells. The absolute numbers of T cells are hown. B, The percentages of ThPOK hd/hd (open circles) and ThPOK wt/wt (closed circles) T cells in blood are shown on 5, 6, and 7 days post-infection.

A 60 p=0.02 % reduction 40 20 0 B6 vs B6 ThPOK wt/hd vs B6 B C number per spleen (x 10-6 ) 40 30 20 10 ThPOK wt/wt p=0.0116 ThPOK wt/hd number per spleen (x 10-6 ) 40 30 20 10 ThPOK wt/wt p=0.0014 ThPOK wt/gfp Supplementary Figure 6. Polyclonal ThPOK wt/hd Ag-specific CD8 T cells, ThPOK wt/hd T cells, nd ThPOK wt/gfp T cells show a mild impairment in accumulation. A, Sublethally irradiated Rag1 -deficient mice were reconstituted with a 1:1 mixture of T cell-depleted bone marrow cells from either Ly5.1 B6 and Ly5.2 B6 mice, or from Ly5.1 B6 and Ly5.2 ThPOK wt/hd mice. Ten to twelve weeks later, he distribution of CD8 T cells in peripheral blood of the chimeras was checked using congenic markers. he distribution among GP33-specific CD8 T cells in peripheral blood was analyzed 8 days after LCMV nfection. The percentages of reduction signify a relative reduction of Ly5.2 + BM-derived cells among P33-specific CD8 T cells 8 days after infection. B, The absolute numbers of transferred ThPOK wt/hd T cells and ThPOK wt/wt T cells in the spleen 8 days after LCMV infection. C, The absolute numbers of transferred ThPOK wt/gfp T cells and ThPOK wt/w t T cells in the spleen 8 days ost-infection.

gene name fold change known function reference Heat shock protein 1B -24.48 DNA repair/anti apoptotic Heat shock protein 1A -15.06 DNA repair/anti apoptotic Integrin alpha 4-3.95 cell adhesion Integrin alpha 6-2.59 cell adhesion AHA1-1.90 response to stimulus CD160 antigen +1.90 receptor activity/negative signaling Alcam -1.80 cell adhesion gelsolin -1.72 barbed-end actin filament capping/anti apoptotic Rad52-1.53 DNA repair S4 Smc6-1.52 DNA repair S5 S1 S1 S2 ref. 21 S3 Supplementary Table 1. Gene expression in ThPOK hd/hd T cells versus ThPOK wt/wt T cells during the memory phase. Genes encoding products involved in survival or immune responses are listed among genes whose expression levels differ more than 1.5 fold between the two groups.