Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained

Similar documents
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

Supplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c)

SUPPLEMENTARY INFORMATION

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Figures

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

a b c Esophageal eosinophilia

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Interferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Ex vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2*

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Protocols for the Induction and Evaluation of Systemic Anaphylaxis in Mice

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

Supplemental Figure Legends

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

SUPPLEMENTARY INFORMATION

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

Supplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells

SUPPLEMENTARY METHODS

Supplementary Information

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Nature Medicine: doi: /nm.3922

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1

SUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells

Title. CitationCancer science, 109(4): Issue Date Doc URL. Rights(URL)

Canberra, Australia). CD11c-DTR-OVA-GFP (B6.CD11c-OVA), B6.luc + and. Cancer Research Center, Germany). B6 or BALB/c.FoxP3-DTR-GFP mice were

Supporting Information Table of Contents

SUPPLEMENTARY MATERIAL

Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice

Supporting Information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Nature Medicine doi: /nm.3957

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

Supplementary Materials for

SUPPLEMENTARY FIGURES

Supplementary Figure 1.

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

Role of Tyk-2 in Th9 and Th17 cells in allergic asthma

SUPPORTING INFORMATIONS

Supplementary Data Table of Contents:

Supplementary Information:

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.

Supporting Information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary Figures

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

In vitro bactericidal assay Fig. S8 Gentamicin protection assay Phagocytosis assay

SUPPLEMENTARY INFORMATION

Supplementary Figures

Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Supplementary Figures

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.

SUPPLEMENTARY INFORMATION

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

SUPPLEMENTARY INFORMATION. CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative. breast cancer patients

ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1

Rapid antigen-specific T cell enrichment (Rapid ARTE)

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

SUPPLEMENTARY INFORMATION

Eosinophils are required. for the maintenance of plasma cells in the bone marrow

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

B6/COLODR/SPL/11C/83/LAP/#2.006 B6/COLODR/SPL/11C/86/LAP/#2.016 CD11C B6/COLODR/SPL/11C/80/LAP/#2.011 CD11C

Supplementary table I. Real-time primers used in the study. The fold change was obtained by

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

Supplementary material page 1/10

SUPPLEMENTARY INFORMATION

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Combined Rho-kinase inhibition and immunogenic cell death triggers and propagates immunity against cancer

Supplementary Materials and Methods

Supporting Information

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23

Immunotoxicology in Food and Ingredient Safety Assessment: Approaches and Case Studies

ice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS.

Transcription:

1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained jejunum sections ( 200 magnification; scale bar, 100 µm). (b) Length of villi or crypt and ratio of villi/crypt in jejunum (n = 4). (c) Intestinal permeability was measured by plasma FITC-dextran concentrations in naïve and tenth OVA-challenged mice (n = 5-7). * P < 0.05, ** P < 0.01. Tukey s test was performed for comparisons. (d) mrna expression of several cytokines in the colon of naïve mice. The data are presented as the ratio to WT (n = 4). (e) Serotonin content in the colon of naïve mice (n = 4). (f) Maximum temperature drop after 5 min antigen (DNP: DNP-BSA 500 ng) injection in IgE-α-DNP sensitized mice (n = 5 each). Data are presented as mean ± SEM. 1

12 13 14 15 16 17 18 Supplementary Figure 2. High dosage of OVA induces comparable diarrhea incidence between Balb/c WT and H-PGDS -/-. (a) Diarrhea occurrence of 1, 10 and 50 mg OVA challenged WT mice (n = 6, 8, 9, respectively). (b) Diarrhea occurrence of 10 mg OVA challenged WT and H-PGDS -/- mice (n = 9 each). Data are represented as the percentage over the number of OVA challenges. 2

19 20 21 22 23 24 25 26 27 28 Supplementary Figure 3. H-PGDS deficiency increases mast cell infiltration into colonic lamina propria in response to OVA regardless mice strain. (a) Mean number of mast cells per high power field (HPF) in each tissue of naïve and 1 day before OVA challenge (n = 4-5). (b) The percentage of CD4 + or CD8 + T cells, B220 + B cells, CD11c + cells and c-kit + /FcεRI + mast cells in the colonic lamina propria after the tenth OVA-challenged mice (n = 4). (c) Mean number of mast cells per high power field (HPF) in each tissue of Balb/c mice at tenth 1 mg OVA challenge (n = 4-5). Data are presented as mean ± SEM. * P < 0.05. Tukey s test was performed for comparisons. 29 3

30 31 32 33 34 35 36 37 Supplementary Figure 4. H-PGDS deficiency does not increase the expression of Th2 cytokines. mrna expression of IL-4 (a) and IL-13 (c) in the colon following the tenth saline or OVA challenge (n = 4). IL-4 (b), IL-13 (d) content in the colon following the tenth OVA challenge (n = 4). There was no statistical significance in mrna expression of IL-4 between tenth OVA challenged WT and H-PGDS -/- mice (P = 0.1572). Data are presented as mean ± SEM. * P < 0.05. Tukey s test was performed for comparisons. 38 4

39 40 41 42 Supplementary Figure 5. Kit W-sh/W-sh mice exhibits scratching behavior in response to OVA. Scratch score was monitored in Kit W-sh/W-sh mice (n = 7). Data are presented as mean ± SEM. 43 5

44 45 46 47 48 49 50 51 52 53 54 55 Supplementary Figure 6. Single transfer of BMMCs is insufficient to cause food allergic manifestations. (a) Experimental outline. Kit W-sh/W-sh mice were reconstituted with BMMC by single injection. Feces score (b) and systemic score (c) were monitored in Kit W-sh/W-sh mice reconstituted with BMMCs derived from WT or H-PGDS -/- by single injection (n = 5 each). (d) Representative pictures of CAE-stained colon sections following the tenth OVA challenge in mice ( 200 magnification; scale bar, 50 µm). Almost all CAE-positive mast cells were localized in the submucosal region and muscle (square, 400 magnification). (e) Mean number of mast cells per HPF in the colon of mice following the tenth OVA challenge (n = 5). There was no difference in the number between both lines of mice. Data are presented as mean ± SEM. 6

56 57 58 59 60 61 62 63 Supplementary Figure 7. H-PGDS deficiency does not affect the content of mast cell growth factors in colon. (a) The mrna expression of SCF, TNF-α, SDF-1α, IL-9 and MMP-9 in the tenth OVA-challenged colon (n = 4-5). Data are presented as the ratio to WT and as mean ± SEM. ** P < 0.01. Tukey s test was performed for comparisons. (b) Image of gelatin zymogram of pro-mmp-9 (105 kda) and active (act)-mmp-9 (95 and 88 kda) in the tenth OVA-challenged colon of 3 independent mice. Standard (Std) indicates mouse MMP-9 recombinant protein. 64 7

65 66 67 68 69 70 71 72 73 Supplementary Figure 8. H-PGDS deficiency does not affect mast cell maturation and function. (a) The proliferation rate of BMMCs (n = 4). (b) The percentage of c-kit + /FcεRI + cells in 2-, 4-, and 6-week-old BMMCs (n = 4). (b) The degranulation rate of sensitized BMMCs stimulated by DNP-HSA (10 ng ml -1 ) or ionomycin (0.5 µm). (d) The amount of cystenyl leukotrienes (cys-lts) released from sensitized BMMCs stimulated by DNP-HSA (10 ng ml -1 ) (n = 4). Data are presented as mean ± SEM. ** P < 0.01. Tukey s test was performed for comparisons. 74 8

75 76 77 78 79 80 Supplementary Figure 9. CXCR4 antagonism attenuates systemic score in H-PGDS -/- mice. AMD3100 (300 µg/mouse) was administered to mice intraperitoneally before each OVA challenges. Systemic scores were monitored (n = 5 10). Data are presented as mean ± SEM. * P < 0.05. Mann Whitney U test was performed for comparisons. 81 9

82 Supplementary Table 83 Supplementary Table 1. Sequences of the primers used for real-time RT-PCR Target Forward primer Reverse primer IL-1β TGACGTTCCCATTAGACAGC TGGGGAAGGCATTAGAAACA IL-4 ATGCCTGGATTCATCGATAAG GCTCAGTACTACGAGTAATCC IL-9 ATCTGAAGGATGATCCACCGTC TCTGTGTGGCATTGGTCAGC IL-13 CTGAGCAACATCACACAAGACC TTGCAATTGGAGATGTTGGTCAG TNF-α AGCCTGTAGCCCACGTCGTAG GTAGACAAGGTACAACCCATCG CCL-2 AATGCTAACGCCACCGAGAG CCTTGTTCTGCTCCTCATAGTCC SCF CCTTAGGAATGACAGCAGTAGCA GCCAATTACAAGCGAAATGAGAG SDF-1α CTGCATCAGTGACGGTAAACC CAGCCGTGCAACAATCTGAAG 5-LO ACCAAACCCCTGGAGAGAGTA GCGATACCAAACACCTCAGAC LTA 4 H ATTTGTGGACGGTTGTTTGG CATAGGGGATGGAGGAATAGG MMP-9 CATTTCGACGACGACGAGT AGTGGTGCAGGCAGAGTAGG 18S rrna GACTCAACACGGGAAACCTCAC CACCCACGGAATCGAGAAAG 5-LO, 5-lipoxygenase; LTA 4 H, Leukotriene A 4 hydrolase; MMP, matrix metalloproteinase. 10

84 Supplementary Methods 85 FITC-dextran permeability assay 86 Intestinal permeability was assessed by luminal enteral administration of FITC-dextran 87 40 kda (TdBCons). All mice were subjected to gavage with FITC-dextran (20 mg/mouse) and 88 whole blood was obtained by cardiac puncture after 4 h. The plasma was collected and the 89 absorption was measured at 488 nm using a fluorometer. Dilutions of FITC-dextran in PBS were 90 used as a standard curve. 91 92 Degranulation assay 93 Six-week-old BMMCs (1 10 6 ) were sensitized with DNP-IgE (100 ng ml -1 ) for 24 h 94 and then stimulated with DNP-HSA (3-10 ng ml -1 ) or ionomycin (0.5 µm) for 30 min at 37 C. A 95 p-nitrophenyl N-acetyl-β-D-glucosamide solution (3.5 mg ml -1, 100 µl) was added to the 96 supernatant (50 µl) of the BMMCs. After 90 min incubation at 37 C, glycine solutions (400 mm, 97 50 µl) were added and the absorbance was measured at 405 nm. 98 99 Flow cytometry 100 Inflamed colon tissues were digested by collagenase IA (Wako) and dispase (Roche) for 101 45 min at 37 C in RPMI containing 10% FBS. The collected cells were washed with PBS and 11

102 stained with the following antibodies (Biolegend) in PBS containing 5% FBS and 0.5% NaN 3 103 for 30 min at 4 C: Alexa Fluor 488 anti-mouse CD45 (30-F11), PE anti-mouse CD4 (GK1.5), 104 Alex Fluor 647 anti-mouse CD8 (53-6.7), PE anti-mouse B220 (RA3-6B2), Alex Fluor 647 105 anti-mouse CD11c (N418), PE anti-mouse CD117 (2B8), and Alex Fluor647 anti-mouse FcεRI 106 (MAR-1). Each antigen-positive cell among live leukocytes (CD45-positive and 7-AAD 107 negative) was analyzed on a BD Accuri C6 (BD Bioscience). 108 For analysis of BMMC maturation, the cells (1 10 6 ) were stained with FITC 109 anti-cd117 and PE anti-fcεri antibodies as described above. Cells double-positive for both 110 antigens were defined as mature BMMCs. 111 112 Passive systemic anaphylaxis 113 Mouse monoclonal IgE anti-dinitrophenyl (DNP) antibody (3 µg in 100 µl saline) was 114 administrated intravenously by the tail vein. After 24h, DNP-BSA (500 ng in saline) was injected 115 into the tail vein and body temperature was measured using a rectal thermometer (Physitemp 116 Instruments Inc, BAT-12) 5 min after antigen challenge. 12