SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima Zahir, Qiuhong Jiang, Helen Miliotis, Stephanie Heyraud, Xianwang Meng, Baoxia Dong, Gang Xie, Frank Qiu, Zhenyue Hao, Christopher A. McCulloch, Ed Keystone, Alan C. Peterson, Katherine A. Siminovitch. Nature Genetics: doi:1.138/ng.94 1
upplemental Figure 1 A Wild-type allele BamHI 5 -probe SmaI 5.8kb 12 13 BamHI 14 15 4.9kb 3 -probe XhoI B R CGG Targeting vector SmaI 12 13 pgk-neo BamHI * 14 15 DTA W TGG Targeted allele BamHI SmaI 12 13 pgk-neo BamHI * 14 15 C.4 D Pep mrna.2 Pep mrna Lymph Nodes Spleen Thymus TGF- Nature Genetics: doi:1.138/ng.94
Supplementary Figure 1. Generation of Pep knock-in mice (A) Schematic showing the Pep targeting vector. The targeting vector was constructed by introducing a neomycin selection cassette flanked by two lox P sites in the intron between exons 13 and 14 (i.e. between nucleotides 1369266 and 13692435) upstream of a modified (C1967T) Pep allele. The lox P sites are 28 bp downstream of exon 13 and 1961 bp upstream of exon 14, with a total of 146 bp new DNA introduced into the targeted intron. This vector was electroporated into C57BL/6 embryonic stem cells and clones containing the mutant allele then identified by PCR and Southern blotting. Following transfection with a Cre recombinase expression vector to remove the neo cassette, ES clones containing the C1967T allele were injected into C57BL/6 blastocysts using the eight-cell laser injection method to generate chimeric mice carrying the targeted allele. Successful germline transmission were confirmed by Southern blotting analysis of PepR+/- mice. DTA: Diphtheria toxin A chain gene. = FRT (Flippase Recognition Target) sites; * = C1967T/R mutation; = Exon; = 3 probe;. = 5 probe. (B) Sequence analysis of Pep transcripts from PCR-amplified T cells of Pep knockin mice and wild-type littermates. (C) qrt-pcr analysis showing relative levels of Pep and Pep in unstimulated lymph nodes, spleen and thymus (left panel) and in unstimulated and anti-cd3 or TGFβ-stimulated thymocytes (right panel) from wild-type and Pep mice. Values are expressed relative to GAPDH control and represent means (±SEM) of three independent experiments. (D) Relative expression levels of the two Pep alleles as determined in genomic DNA and cdnas from thymic and lymph node cells from a Pep619R/ heterozygote mouse. Normalized allelic (C/T) expression ratios, calculated as described in Methods, are shown below each panel. These data are representative of three independent experiments. Nature Genetics: doi:1.138/ng.94 3
Supplemental Figure 2 A CD4 B Cell number CD8 1 4 5 9 6.7 88 1 3 1 2 1 1 1 1.6 1.8 1 4 36 38 1 3 1 2 1 1 1 25 23 1 4 21 24 1 3 1 2 1 1 1 13 12 1 1 1 1 2 1 3 1 4 1 1 1 1 2 1 3 1 4 8 6 4 2 8 6 CD3ε Thymus Lymph Node Spleen C CD4 Cell number CD4 E OT-II TCR 1 4 1 3 54 32 71 14 1 2 1 1 1 12 2 14 2 1 4 64 1 75 1 1 3 1 2 1 1 2 15 17 7 1 1 1 1 1 2 1 3 1 4 1 1 1 1 2 1 3 1 4 CD8 25 2 15 1 5 1 1 1 1 2 1 3 1 4 1 4 1 3 1 2 1 1 4.4 7.5 3 2 53 62 1 OT-II (KJ1-26) 4.7 CD8 Thymus Lymph node 1 1 1 1 2 1 3 1 4 4. 6.8 4.3 1 1 1 1 1 2 1 3 1 4 1 1 1 1 2 1 3 1 4 Thymus D 3 H thymidine incorporation(x1 2 ) 15 15 1 1 3 H thymidine incorporation(x1 2 ) 5 5 P<.5.1.5 1.5/.5 2.5+1 CD3 ( g/ml) P<.5 Naïve CD3/CD28 8 16 P<.5 7 12 8 4 3 H thymidine incorporation (x1 3 ) P<.5 Memory 6 5 4 3 2 1 3 H thymidine incorporation(x1 3 ) 16 16 14 14 12 12 1 1 8 6 4 2 8 6 4 2 P<.1 2 2ug Ova peptide ( g/well) 1. 2.5 Ova peptide( g/well) 4 2 1 1 1 1 2 1 3 1 4 1 1 1 1 2 1 3 1 4 TCRβ Nature Genetics: doi:1.138/ng.94
Supplementary Figure 2. Increased positive selection and peripheral T cell activation in Pep mice (A & B) Representative flow cytometric plots (A) showing CD4 and CD8 staining patterns for thymocytes, lymph node cells and splenocytes from 3 month old wild-type () and Pep mice. Numbers within each quadrant indicate percentages of total cells. The thymocyte samples from these mice were also co-stained for CD3ε or TCRβ and their staining profiles shown in (B) by representative histograms. (C) Representative flow cytometric analyses of thymocytes and peripheral lymph node T cells from 2 month old OT-II TCR wild-type and Pep mice is shown in the upper two panels. Numbers indicate percentages of stained cells in each quadrant. Histograms in the third panel show KJI-26 (OT-II TCR) staining of gated CD4 + cells. Numbers indicate percentages of CD4 + cells showing high level expression of the OT-II TCR. A representative flow cytometric analysis of thymocytes from 2 month old male H-Y TCR wildtype and Pep mice is shown in the bottom panel. Numbers indicate percentages of cells in each quadrant. Results representative of three independent experiments are shown. (D) CD4 + naïve (CD44 hi CD62 low ) and memory (CD44 lo CD62 hi ) T cells purified from 2-3 month old C57BL/6 or C57BL/6 OT-II TCR wild-type and Pep spleen were stimulated for 48 hours with the indicated concentrations (μg/ml) of anti-cd3 antibody, anti-cd3/cd28 antibodies or Ova peptide and proliferative responses determined after a 16 h [ 3 H] thymidine pulse. Values represent means (± SEM) of triplicate cultures and are representative of 5 independent experiments. (E) CD4 + naïve and memory T cells purified from 2-3 month old wild-type an Pep spleen were stimulated for 2 min with anti-cd3 antibody and the cells then fixed, permeabilized, stained with anti-phospho Zap7 or anti-phospho-erk antibodies and assessed by flow cytometry. Plots are representative of 5 independent experiments. Nature Genetics: doi:1.138/ng.94 5
Supplemental Figure 3 A B22 1 4 1 3 1 2 1 1 1 1 4 1 3 1 2 1 1 1 1 4 1 3 1 2 1 1 3.3 28 5.15 IgM IgD 29. 27.5 5.31 B CD11b 1 4 1 3 83.2 1 2 1 1 1 1 4 1 3 8.2 1 2 CD11c + 8.77 8.98 1 1 1 1 1 1 1 2 1 3 1 4 1 1 1 1 1 2 1 3 1 4 1 1 1 1 2 1 3 1 4 CD8 CD5 Nature Genetics: doi:1.138/ng.94
Supplementary Figure 3. B and dendritic cell development are normal in Pep mice (A) Representative flow cytometric analyses of lymph node cells from 2 month old wild-type or Pep mice showing IgM, IgD or CD5 relative to B22 staining. Numbers indicate percentages of IgM hi, IgD hi or CD5 hi B22 + cells. (B) Representative flow cytometry plot of splenic cells from 2 month old wild-type mice or Pep littermates stained for CD11c, CD11b and CD8α. Gated fractions represent CD11b + and CD8α hi CD11c + subsets with the percentage of total cells shown within each gate. Data shown are representative of 8 independent experiments. Nature Genetics: doi:1.138/ng.94 7
Supplemental Figure 4 P<.1 P<.1 P<.1 P<.5 Lyp level (%) CC TT CC TT CC TT CC TT Naïve Memory Naïve Memory T-cells B-cells Nature Genetics: doi:1.138/ng.94
Supplementary Figure 4. Lyp levels are reduced in naïve and memory T and B cells in subjects homozygous for the risk allele. PBMCs from 11 healthy control subjects homozygous for the non-risk (CC) or risk (TT) PTPN22/Lyp genotypes were stained with antibodies to Lyp and to either CD4, CD45RA, CD45RO or CD2 and CD27. Graph shows MFIs of Lyp staining in naïve (CD45RA + ) and memory/effector (CD45RO + ) CD4 + T cells and in CD27 - (naïve) and CD27 + (effector/memory) CD2 + B cells. Nature Genetics: doi:1.138/ng.94 9
Supplementary Table 1. Sequences of primers used for PCR assays. PCR assay Primer Sequences (5-3 ) a. Screening the targeted PTPN22 allele 5 arm Forward 5 arm Reverse 3 arm Forward 3 arm Reverse CTCTGATAATCACCTTGGAAGAGAGG ATTCGCAGCGCATCGCCTTCTATCG CTACTTCCATTTGTCACGTCCTGCACG GTTTCCATACAGGTACAGGAAGTGC b. Genotyping of the murine PTPN22 gene variant 5-3 Forward 5-3 Reverse Extension GCTTGGCTGGACGTAAACTC TTGCTTCTCAAGTGCTGGAA CTGTACTCACCGGCTTCCTC c. Genotyping of the human PTPN22 gene variant 5-3 Forward 5-3 Reverse Extension ACGTTGGATGAACTGTACTCACCAGCTTCC ACGTTGGATGAGATGATGAAATCCCCCCTC AATAAATGATTCAGGTGTCC d. qpcr of the murine PTPN22 gene 5-3 Forward 5-3 Reverse TGGAGTTTGAAATGGGAAAGA ACTTGGCCTTCAGAGTCCTG 1 Nature Genetics: doi:1.138/ng.94