Expanded View Figures

Similar documents
Fasting-induced liver GADD45b restrains hepatic fatty acid uptake and improves metabolic health

Fasting-induced liver GADD45b restrains hepatic fatty acid uptake and improves metabolic health

SUPPLEMENTARY INFORMATION

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Figure 1

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Fasting-induced liver GADD45 restrains hepatic fatty acid uptake and improves metabolic health.

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure 1.

Supplementary Materials for

Supplementary Information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

SUPPLEMENTARY INFORMATION

Supplementary Figures

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Pathogenesis of Diabetes Mellitus

SUPPLEMENTARY INFORMATION

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis

perk/erk STAT5B

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

NASH Bench to Bedside

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

Supplementary Table 1.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

CHY2026: General Biochemistry. Lipid Metabolism

Oxidation of Long Chain Fatty Acids

Fatty acids synthesis

Fatty Acid Oxidation and Its Relation with Insulin Resistance and Associated Disorders

Supplementary Figure 1

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals

HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Tissue factor-par2 signaling promotes diet-induced obesity and adipose

Lehninger 5 th ed. Chapter 17

University of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba

Supplementary Information

Table of Contents. Section 1 Glycolysis and Fermentation. Section 2 Aerobic Respiration

Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia

Obesity in aging: Hormonal contribution

University of California, San Diego La Jolla CA 92093

Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1

MILK BIOSYNTHESIS PART 3: FAT

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Mango Modulates Body Fat and Plasma Glucose and Lipids in Mice Fed High Fat Diet

Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

Supplementary Materials for

2.5. AMPK activity

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

Roles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

Successful completion of Phase I clinical trial of AMPK activator O304

SUPPLEMENTARY INFORMATION

Antibodies for Unfolded Protein Response

23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in

PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes

RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice

Lipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Chapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002


Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Biosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Metabolic Programming. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

Chapter 22, Fatty Acid Metabolism CH 3 (CH 2 ) 14 CO 2 R C C O2 CH 2 OH O R. Lipase + 3 H 2 O

FADD is a key regulator of lipid metabolism

number Done by Corrected by Doctor Faisal Al-Khatibe

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Metabolic responses to leptin in obese db/db mice are strain dependent

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes

A liver stress-endocrine nexus promotes metabolic integrity during dietary protein dilution

IMMUNE FUNCTION AND METABOLIC STRESS DUE TO PRECALVING ENERGY LEVEL AND POSTCALVING MASTITIS CHALLENGE IN DAIRY COWS

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance

Transcription:

Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old wild-type (WT; C57Bl/6J) or obese/diabetic monogenic (db/db; BKS.Cg-m +/+ Lepr DB/J; n = 4/group, A D), New Zealand Black (NZB) and polygenic obese/pre-diabetic New Zealand Obese (NZO; n = 4/group; E H), as well as young (i.e. 3 months) and aged (i.e.22 months; n = 5/group; I L), mice were fed ad libitum (fed) or fasted for 24 h (fasted). Blood glucose (BG, A, E, I) and serum acylcarnitine species including free carnitine (C0; B, F, J), acylcarnitine (C2; C, G, K) and short-chain acylcarnitines (SCAC; D, H, L) were measured. Data are mean SEM. n = 4/group. Effect of genotype, *P < 0.05, **P < 0.01, ***P < 0.001. Effect of nutritional state: # P < 0.05, ## P < 0.01, ### P < 0.001. The statistical test used and respective P-value outputs can be found in Appendix Table S1. EV1

EMBO Molecular Medicine Liver GADD45b and metabolism Jessica Fuhrmeister et al A B C D E F G H I J Figure EV2. Systemic GADD45b deletion affects metabolic regulation under conditions of heightened lipid metabolism. A C Male GADD45b +/+ (WT) or GADD45b / (KO) were fed ad libitum (fed) or fasted for 24 h (fasted), and subsequently refed for 24 h(n = 4 6/group). Body weight (A), food intake (B) and physical activity (C) were measured. D J In a distinct cohort, male GADD45b +/+ (WT) or GADD45b / (KO) mice were fasted for 24 h (fasted) (n = 5 8/group) with blood samples taken before and during fasting. Liver mrna expression of Gadd45 family members (D). Body weight (E) before and after fasting and fasted tissue weights (F). Selected liver metabolites (G) as well as blood glucose (H) and serum glycerol (I) and acylcarnitines (J). Data information; Data are mean SEM. Effect of genotype, *P < 0.05, **P < 0.01, ***P < 0.001. Effect of nutritional state: # P < 0.05, ## P < 0.01, ### P < 0.001. The statistical test used and respective P-value outputs can be found in Appendix Table S1. EV2 EMBO Molecular Medicine ª 2016 The Authors

A B C D E F G H I J K Figure EV3. Liver-restricted GADD45b manipulation affects systemic metabolic homoeostasis. A D Albumin (A), Cluster of differentiation 31 (B), desmin (C) and EGF-like module-containing mucin-like hormone receptor-like 1 (D) mrna expression were measured from fractionated parenchymal hepatocytes (Hepas) as well as non-parenchymal cells (NP) from C57Bl/6J mice fed ad libitum (fed) or fasted for 24 h (fasted) (n = 3/group). E Male C57Bl/6J mice with (AAV-G45b mir) or without (AAV-NC mir) liver/hepatocyte-restricted GADD45b silencing were fed or fasted for 24 h(n = 6/group). Liver Gadd45b mrna expression was measured. F H Male GADD45b +/+ (WT) or GADD45b / (KO) mice fasted for 24 h (fasted) with (AD-G45b OE) or without (AD-NC) liver-restricted Gadd45b over-expression (n = 7 8/group). Liver mrna expression of Gadd45b (F). Serum non-esterified fatty acids (G) and triglycerides (H) were measured. I K Male C57Bl/6J mice with (AAV-G45b mir) or without (AAV-NC mir) liver/hepatocyte-restricted GADD45b silencing were chronically fed a normal-fat diet (NFD) or high -fat diet (HFD) and were sacrificed in the ad libitum fed state (n = 6 8/group). Body (I), liver (J) and perigonadal white adipose tissue (K) masses. Data information: Data are mean SEM. Effect of genotype, *P < 0.05, **P < 0.01, ***P < 0.001. Effect of nutritional state: # P < 0.05, ## P < 0.01, ### P < 0.001. The statistical test used and respective P-value outputs can be found in Appendix Table S1. EV3

EMBO Molecular Medicine Liver GADD45b and metabolism Jessica Fuhrmeister et al A B C D E Figure EV4. Liver GADD45b expression modulates metabolic control in type 2 diabetes. A D Male 12-weeks-old wild-type (WT; C57Bl/6J) or obese/diabetic (db/db; BKS.Cg-m +/+ Lepr DB/J) mice with (AD-G45b OE) or without (AD-NC) liver-restricted GADD45b over-expression were fasted for 24 h(n = 4 6/group). Liver mrna expression of Gadd45b (A). Body mass (B), the change in body mass during the experiment (C) and liver mass (D). Data are mean SEM. Effect of genotype, *P < 0.05, **P < 0.01, ***P < 0.001. Effect of viral manipulation state: # P < 0.05, ## P < 0.01, ### P < 0.001. E Fasting HOMA-IR in correlation with liver GADD45B mrna expression in men as in Fig 5 (n = 37). Inserts show r 2 values and P-values from Spearman s correlation test. Data information: The statistical test used and respective P-value outputs can be found in Appendix Table S1. EV4 EMBO Molecular Medicine ª 2016 The Authors

A B C D E Figure EV5. Liver GADD45b controls liver fatty acid handling by cytosolic FABP1 retention. A, B Male 12-weeks-old wild-type (WT; C57Bl/6J) or obese/diabetic (db/db; BKS.Cg-m +/+ Lepr DB/J) mice with (Ad-G45b OE) or without (Ad-NC) prior liver-restricted GADD45b over-expression were fasted and insulin was injected with livers harvested shortly thereafter and subsequently liver proteins were subjected to immunoblotting for insulin signalling proteins including phosphoprotein kinase B (PKB/Akt; A) and glycogen synthase kinase beta (GSK3b; B). Inserts show representative blots (n = 6/group). C, D Representative immunoblots (C) and relative abundance quantifications (D; n = 6) of proteins and phosphoproteins including light chain 3 isoform B (LC3B), S6 kinase 1 (S6K1), p42/44 mitogen activated protein kinase (ERK1/2), eukaryotic initiation factor 2 alpha (eif2a), glucose regulated protein 78 (GRP78/HSPA5), fatty acid transport protein 2 (FATP2/SLC27A2), cluster determinant 36 (CD36/FAT) and fatty acid binding protein 1 (FABP1) from fasted GADD45b +/+ (WT) or GADD45b / (KO) mice. E Representative immunoblots of HNF4a (nuclear marker), BCKDE1A (mitochondrial marker), NTCP (microsomal marker) and ARG1 (cytosolic marker) from liver whole tissue lysate (W) as well as fractionated organelles/intraceuular structures including nuclei (N), mitochondria (MT), microsomes (MS) and cytoplasm (C), from GADD45b +/+ (WT) and GADD45b / (KO) mice. Data information: Data are mean SEM. The statistical test used and respective P-value outputs can be found in Appendix Table S1. EV5

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback