A B C T cell count (1 6 ) 3. 2. 1.. * % of Max CFSE ormoxia ypoxia o Stim. Proliferation Index 2.5 2. 1.5 1. * Division Index 2. 1.5 1..5. D E %Ki67+ cells 1 8 6 4 2 % of Cells 8 ormoxia 6 ypoxia 4 2 * Annexin V - Annexin V + Annexin V + 7AAD - 7AAD - 7AAD + Supplementary Figure 1
Supplementary Figure 1. ypoxia impairs proliferation and survival of human peripheral blood T cells (PB-Ts). PB-Ts were activated with OKT3/a-CD28 Abs in either normoxia () or hypoxia (). (A) Cell counts of PB-Ts at 72 hrs after activation. Dashed line indicates cell counts of plated cells. =6; *: p=.7 (paired Student s t-test). (B) CFSE dilution of CFSE-labeled PB- Ts at 72 hrs. (C) Quantitative analysis of the CFSE dilution in (B). The proliferation and division indexes were calculated using Flowjo. =6; *: p=.1; : p=.3 (paired Student s t-test). (D) Expression of Ki67 in PB-Ts at 72 hrs. =4; : p<.1 (paired Student s t-test). (E) Annexin- V and 7-AAD staining of PB-Ts at 72 hrs. =6; : p<.1; *: p=.1; : p=.12 (twoway AOVA with Bonferroni post-hoc analysis). Error bars indicate standard deviatio.
A B C PB-Ts CCR7 21% 56% 35% 11% 13% 1%.5% 53.5% 22% 15% 59% 13% 58% 5% CD45RA CD45RO 1% 18% CD45RA % of Total Cells 8 6 4 2 CD45RA + CD45RA - CD45RA - CCR7 - CCR7 + CCR7 - PB-Ts % of Cells 8 6 4 2 CD4 CD8 PB-Ts T EM D T EM E T EM F T EM 2% 53% 1% 31% 2% 64% % 56% CD4 CD4 CD4 72% 38% 4% 41% 3% 65% 1% 33% % 44% 15% 43% 13% 38% 6% 44% 4% 51% CD8 CD8 CD8 41% 25% CD27 4% 2% 19% 3% CD62L 6% 44% 1% 44% CD28 CD45RO CD25 Supplementary Figure 2
Supplementary Figure 2. Phenotypic analysis of PB-Ts and ex vivo expanded human effectormemory T cells ( ). (A) Expression of CD45RA and CCR7 on PB-Ts (top) and (bottom). (B) Percentage of CD45RA + CCR7 +, CD45RA - CCR7 + and CD45RA - CCR7 - cells in PB-T and populatio. (C) Percentage of CD4 + and CD8 + cells in PB-T, and FACS-sorted T EM populatio. =3 (D-F) Expression of memory-related surface markers CD27, CD28, CD45RO, CD62L and CD25 on CD4 + or CD8 + FACS-sorted T EM and cells. =3.
BCL2 BIP3 BCL2L1 (to ACTB).3.2.1. (to ACTB) 1.5 1..5. * (to ACTB) 2. 1.5 1..5. FAS FASLG TP53 (to ACTB).4.3.2.1. (to ACTB).6.4.2. (to ACTB).4.3.2.1. BAX BAK BAD (to ACTB).8.6.4.2. (to ACTB).15.1.5. (to ACTB).4.3.2.1. Supplementary Figure 3
Supplementary Figure 3. Apoptosis gene expression profile. Expression of 3 anti-apoptotic (BCL2, BIP3 and BCL2L1) and 6 pro-apoptotic genes (FAS, FASLG, TP53, BAX, BAK and BAD) in that were activated with OKT3/a-CD28 Abs in either normoxia () or hypoxia () for 24 hrs. =4, : p=.76 for BCL2; *: p=.269 for BIP3; : p=.24 for FAS (paired Student s t-test).
A B C % of Cells 8 6 4 2 % of Max CD4 + CD8 + ormoxia ypoxia o Stim. Division Index 2. 1.5 1..5 * * CD4 CD8 CellTrace Violet. CD4 CD8 D % of Cells 6 4 2 CD4 + ormoxia ypoxia * % of Cells 6 4 2 * CD8 + E ng/ml/1 6 cells 2 15 1 5 ormoxia ypoxia IL-2 IF-γ TF-α F CD4 CD8 CD4 CD8 ormoxia ypoxia Isotype o Stim % of Max * ormoxia ypoxia Annexin V - Annexin V + Annexin V + 7AAD - 7AAD - 7AAD + Annexin V - Annexin V + Annexin V + 7AAD - 7AAD - 7AAD + OKT3/aCD28 CD25 CD69 Supplementary Figure 4
Supplementary Figure 4. ypoxia does not affect CD4/CD8 ratio, cytokine production and expression of activation markers in. were activated with OKT3/a-CD28 Abs in either normoxia () or hypoxia () for 24 hrs. (A) Percentage of CD4 + and CD8 + cells. =4. (B) CellTrace Violet (CTV) dilution of CTV-labeled CD4 + or CD8 + at 72 hrs after activation. =3. (C) The division indexes were calculated using Flowjo. =3; *: p<.1 (two-way AOVA with Bonferroni post-hoc analysis). (D) Annexin-V and 7-AAD staining of CD4 + or CD8 + at 72 hrs after activation. =3. *: p<.5; : p<.1; *: p<.1 (two-way AOVA with Bonferroni post-hoc analysis). (E) Secretion of IL-2, IF-γ and TF-α. =4. (F) Expression of CD25 and CD69 in 24 hrs after activation. =5.
T M B T T M B T B uman PBMCs T T Pan-T cells selection T T T T uman T cells T FACS sorting CCR7 T CM 2% T EM 7% CD45RA T aive 62% T T CM T EM Starting After Sorting #PBMCs # T cells T aive T CM T EM Donor 1 13M 4M 14M 6.8M 3M Donor 2 2M 5M 1.8M 12M 6M Donor 3 3M 55M 16M 5.9M 1.7M Supplementary Figure 5
Supplementary Figure 5. FACS-sorting of T, T CM and T EM from human PBMCs and cell number before and after sorting.
A B % of Cells 1 8 6 4 2 % Specific Lysis 1 5 * * * ormoxic-car.gd2-t ypoxic-car.gd2-t ormoxic-t ypoxic-t CD4 CD8 4:1 2:1 1:1 5:1 CAR.GD2-T:Tumor ratios Supplementary Figure 6
Supplementary Figure 6. ypoxia enhances per-cell cytotoxicity of CAR.GD2-T. (A) CD4 and CD8 composition of CAR.GD2-T co-cultured with LA--1 target cells in hypoxia or normoxia for 48 hrs. =3. (B) LA--1 GFP + cells were labeled with 51 Cr and co-cultured with CAR.GD2-T or non-traduced (T) in normoxia or hypoxia at 4:1, 2:1, 1:1, 5:1 effector:target ratio. The cytotoxic activity of CAR.GD2-T was determined after 6 hrs of co-culture. =3. : p<.1; *: p<.1 (two-way AOVA with Bonferroni post-hoc analysis).
A Cell umber (x1 6 ) 1.5 1..5. 5µM 1µM B Cell umber (x1 6 ) 1.5 1..5. * 5nM 1nM C Cell umber (x1 6 ).8.6.4.2. Ctrl IF1α-Td BAY DMOG D E F G % Live cells 8 6 4 * % KI67 + cells 6 4 2 % of Max Ctrl ormoxia IF1αTd ormoxia o Stim. (to ACTB) x 1-6 2.5 2. 1.5 1..5 2 Ctrl IF1α-Td Ctrl IF1α-Td CellTrace Violet. PB-Ts Supplementary Figure 7
Supplementary Figure 7. IF1α is required and sufficient for enhancing functionality of in hypoxia. (A) Cell counts of stimulated with OKT3/a-CD28 Abs in normoxia () or hypoxia () for 72 hrs with or without the IF1α inhibitor BAY 87-2243 (BAY). =3; : p=.47; : p<.1 (one-way AOVA with Bonferroni post-hoc analysis). (B) Cell counts of stimulated with OKT3/a-CD28 Abs in or for 72 hrs with or without the IF1α activator DMOG. =3; *: p=.2; : p>.5 (one-way AOVA with Bonferroni post-hoc analysis). (C-F) IF1α traduced (IF1α-Td) or mock-traduced (Ctrl) were stimulated with OKT3/a-CD28 Abs in. Total cell counts (C), cell viability (D) and Ki67-expressing cells (E) at 72 hrs post stimulation. =7 for (C, D); : p<.1; *: p=.6; =4 for (E); : p=23 (paired Student s t-test). (F) CellTrace Violet dilution of labeled IF1α-Td or Ctrl at 72 hrs after stimulation. -3. (G) mra expression of EPAS1 (IF2α) in PB-Ts and. Expression level is normalized to ACTB. Error bars indicate standard deviation.
A B o Stim or o Stim yp OKT3/aCD28 or OKT3/aCD28 yp IF1α MFI 3 2 1 Isotype IF1α S S Act Act C D T o Stim or o Stim yp OKT3/aCD28 or OKT3/aCD28 yp IF1α MFI 2 15 1 T T CM TEM T CM 5 Isotype S S ACT ACT T EM IF1α Supplementary Figure 8
Supplementary Figure 8. Intracellular staining of IF1α in and T cell memory subsets. (A-B) and FACS-sorted T, T CM and T EM (C-D) were utimulated or stimulated with OKT3/a-CD28 Abs in normoxia () or hypoxia () for 24 hrs and stained for intracellular IF1α. =2 for and =3 for T memory subsets.
A Deitometry E 2 15 1 5 o Stim GLUT1 * o Stim OKT3/a-CD28 OKT3/a-CD28 * PB-Ts F B Glucose Coumption (ng) 1 8 6 4 2 73±4.4 o Tx 51±2.5 2DG C Proliferation Index 2.5 2. 1.5 1. o Tx 2DG Oligo G * ormoxia ypoxia D Divison Index 2. 1.5 1..5. * o Tx 2DG Oligo ormoxia ypoxia Cell umber (x1 6 ) 1.5 1..5. o Tx ormoxia ypoxia Oligo % Live cells 8 6 4 2 o Tx ormoxia ypoxia Oligo Supplementary Figure 9
Supplementary Figure 9. display elevated IF1α expression and glycolytic activity. (A) Deitometric analysis of GLUT1 protein in Fig. 5C. =3. *: p<.5; : p<.1; *: p<.5 (two-way AOVA with Bonferroni post-hoc analysis). (B) Glucose coumption of that were untreated (o Tx) or were treated with 1mM 2DG under conditio of normoxia. =3. umbers above the bar indicates mean coumption ± standard deviation. Proliferation index (C) and division index (D) of that were untreated or exposed to 1mM 2DG or 5nM oligomycin (Oligo) after stimulation with OKT3/a-CD28 Abs in or. (E,F) PB-Ts were treated with 5nM oligomycin or left untreated and stimulated with OKT3/a-CD28 Abs in or. Cell counts (E) and cell viability (F) were determined 72 hrs post-activation. =6. : p<.1; : p=.11 (two-way AOVA with Bonferroni post-hoc analysis). (G) CellTrace Violet dilution of labeled PB- T at 72 hrs post-stimulation. =3. Error bars indicate standard deviation.
A C 8 6 4 2 o Stim IF1A OKT3 a-cd28 PB-Ts B ng per 1 6 cells 1 8 6 4 2 o Stim DMSO o Stim OKT3/a-CD28 OKT3/a-CD28 ng per 1 6 cells 1 8 6 4 2 o Stim MG132 * * o Stim OKT3/a-CD28 OKT3/a-CD28 PB-Ts o Stim OKT3 acd28 o Stim OKT3 acd28 PB-Ts ormoxia ypoxia Isotype p-s6 p-mtor Supplementary Figure 1
Supplementary Figure 1. Comparison of IF1A mra, IF1α proteasomal degradation, and mtor activity in PB-Ts and. (A) IF1Α mra expression in PB-Ts and that were utimulated or stimulated with OKT3/a-CD28 Abs in hypoxia () for 24 hrs. Expression was normalized agait the house keeping control 18S RA and then standardized to 1. in utimulated PB-Ts. =3. (B) Quantification of IF1α protein expression by quantitative IF1α ELISA in PB-Ts and that were utimulated or stimulated with OKT3/a-CD28 Abs in the presence of DMSO or 1µM MG132 in normoxia or. =3 for PB-Ts and =4 for ; *: p<.5; : p<.1 (two-way AOVA with Bonferroni post-hoc analysis). (C) Phosphorylation of S6 and mtor in PB-Ts and that were utimulated or stimulated with OKT3/a-CD28 Abs in or for 24 hrs. =3. Error bars indicate standard deviation.
A B uman IF1α 3 UTR GCTTTTTCTTAATTTCATTCCTTTTTTTGGACACTGGTGGCTCATTACCTAAAGCAGTCTATTTATATTTT CTACATCTAATTTTAGAAGCCTGGCTACAATACTGCACAAACTTGGTTAGTTCAATTTTGATCCCCTTTCT ACTTAATTTACATTAATGCTCTTTTTTAGTATGTTCTTTAATGCTGGATCACAGACAGCTCATTTTCTCAG TTTTTTGGTATTTAAACCATTGCATTGCAGTAGCATCATTTTAAAAAATGCACCTTTTTATTTATTTATTT TTGGCTAGGGAGTTTATCCCTTTTTCGAATTATTTTTAAGAAGATGCCAATATAATTTTTGTAAGAAGGCA GTAACCTTTCATCATGATCATAGGCAGTTGAAAAATTTTTACACCTTTTTTTTCACATTTTACATAAATAA TAATGCTTTGCCAGCAGTACGTGGTAGCCACAATTGCACAATATATTTTCTTAAAAAATACCAGCAGTTAC TCATGGAATATATTCTGCGTTTATAAAACTAGTTTTTAAGAAGAAATTTTTTTTGGCCTATGAAATTGTTA AACCTGGAACATGACATTGTTAATCATATAATAATGATTCTTAAATGCTGTATGGTTTATTATTTAAATGG GTAAAGCCATTTACATAATATAGAAAGATATGCATATATCTAGAAGGTATGTGGCATTTATTTGGATAAAA TTCTCAATTCAGAGAAATCATCTGATGTTTCTATAGTCACTTTGCCAGCTCAAAAGAAAACAATACCCTAT GTAGTTGTGGAAGTTTATGCTAATATTGTGTAACTGATATTAAACCTAAATGTTCTGCCTACCCTGTTGGT ATAAAGATATTTTGAGCAGACTGTAAACAAGAAAAAAAAAATCATGCATTCTTAGCAAAATTGCCTAGTAT GTTAATTTGCTCAAAATACAATGTTTGATTTTATGCACTTTGTCGCTATTAACATCCTTTTTTTCATGTAG ATTTCAATAATTGAGTAATTTTAGAAGCATTATTTTAGGAATATATAGTTGTCACAGTAAATATCTTGTTT TTTCTATGTACATTGTACAAATTTTTCATTCCTTTTGCTCTTTGTGGTTGGATCTAACACTAACTGTATTG TTTTGTTACATCAAATAAACATCTTCTGTGGACCAGGCAAAAAAAAAAAAAAAAAAAAAAA C 3 UTR: Ctrl IF1α IF1α ΔARE MFI: 5927 MFI: 5445 MFI: 571 34% 33% 35% MFI: 4688 MFI: 1842 MFI: 3829 GFP MFI (1 4 ) 8 6 4 2 * * 3'UTR: Ctrl IF1α IF1a ΔARE +2DG 34% 15% 26% : o Tx 2-DG GFP Supplementary Figure 11
Supplementary Figure 11. Regulation of IF1α expression by 3 UTR (A) Sequence of the human IF1A mra 3 UTR. Yellow highlights pentamer AREs and red and blue highlight two coecutive nonamer AREs. ARE, AU-rich element. (B) were cultured with IL-2 with or without 1mM 2DG for 48 hrs and subsequently trafected with reporter cotructs containing different 3 UTR sequences by nucleofection. Expression of GFP reporter was measured 8 hrs post nucleofection. =3. *: p<.5 (Paired student s t-test).
A D G CCR7 4 3 2 1 GAPD mra Mock GAPD-Td Mock GAPD-Td 36% 27% 22% 13% 33% 4% 6% 5% 1% 31% 13% 23% 41% 18% 48% 16% CD45RA B CD4 CD8 Relative Inteity E Mock Glucose Coumption (ng per 24hrs) Donor 1 Donor 2 GAPD Td 1 8 6 4 2 * Mock GAPD Td 1 2.51 1 1.98 GAPD CD3ζ Mock GAPD-Td C F % KI67+ T cells 5 4 3 2 1 8 6 4 2 o Stim IF1A o Stim OKT3/a-CD28 OKT3/a-CD28 T GAPD-Td Mock GAPD-Td % of Ki67 + Cells 1 8 6 4 2 P1 - P1 + Mock CAR.GD2-T GAPD CAR.GD2-T Supplementary Figure 12
Supplementary Figure 12. The expression of IF1α in T cell memory subsets is tralationally regulated by GAPD. Mock-traduced (mock) or GAPD-traduced (GAPD-Td) were stimulated with OKT3/a-CD28 Abs stimulated in normoxia () or hypoxia (). GAPD mra (A) and protein (B) expression of mock or GAPD-Td cells determined by qpcr and western blot, respectively. =3 for mra and =2 for protein. (C) Detection of IF1α mra expression in mock or GAPD-Td 72 hrs after stimulation. =3. (D) Expression of CD45RA and CCR7 on CD4 + and CD8 + mock or GAPD-TD cells. =3. (E) Glucose coumption at 24 hrs post-stimulation. =3; *p=.194; p=.17 (two-way AOVA with post-hoc analysis). (F) Percentage of Ki67 + mock-traduced or GAPD-traduced at 72 hrs post-stimulation. =3; : p<.1 (two-way AOVA with post-hoc analysis). (G) In vivo proliferation of CAR.GD2-T co-traduced with GAPD or mock vector in normoxic (P1 - ) or hypoxic (P1 + ) tumor area. : p=.25 (Two-way AOVA with Bonferroni post-hoc analysis). Error bars indicate standard deviation.