VNTR . VNTR. VNTR. (Original Article) PCR-RFLP ( ETR-B, ETR-C, ETR-D, ETR-E, ETR-F : 7 .VNTR : : (Atypical Mycobacteria)

Similar documents
MIRU-VNTR.. (HGI) HunterGaston Discriminatory Index MIRU-VNTR :

Polymorphism of Variable-Number Tandem Repeats at Multiple Loci in Mycobacterium tuberculosis

Molecular Epidemiology of Tuberculosis. Kathy DeRiemer, PhD, MPH School of Medicine University of California, Davis

Emergence of New Forms of Totally Drug-Resistant Tuberculosis Bacilli

International Tuberculosis Research Center, Changwon, Republic of Korea

Received 12 June 2002/Returned for modification 31 July 2002/Accepted 2 September 2002

Isolation of non tuberculous mycobacteria among tuberculosis patients during a five year. period in Croatia

TB Updates for the Physician Rochester, Minnesota June 19, 2009

Molecular epidemiology of Mycobacterium tuberculosis in East Lancashire 2001e2009

Molecular Typing of Mycobacterium tuberculosis Based on Variable Number of Tandem DNA Repeats Used Alone and in Association with Spoligotyping

NON-TUBERCULOUS MYCOBACTERIAL (NTM) INFECTIONS ISOLATED FROM BIRMINGHAM HEARTLANDS HOSPITAL: A CASE NOTES REVIEW.

Genetic diversity of Mycobacterium tuberculosis isolates from Beijing, China assessed by Spoligotyping, LSPs and VNTR profiles

JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 1999, p Vol. 37, No. 8. Copyright 1999, American Society for Microbiology. All Rights Reserved.

Optimal Combination of VNTR Typing for Discrimination of Isolated Mycobacterium tuberculosis in Korea

DOWNLOAD OR READ : NONTUBERCULOUS MYCOBACTERIA NTM PDF EBOOK EPUB MOBI

Nontuberculous Mycobacteria (NTM)

Received 6 July 2006/Returned for modification 13 October 2006/Accepted 13 December 2006

New genomic typing method MLST

Tuberculosis Genotyping in British Columbia

Appendix C. Recommendations for Counting Reported Tuberculosis Cases (Revised July 1997)

Estimates for the mutation rates of spoligotypes and VNTR types of Mycobacterium tuberculosis

Real-time molecular epidemiology of tuberculosis by direct genotyping. of smear-positive clinical specimens

Molecular Epidemiology of Tuberculosis: Current Insights

Received 11 June 2004/Returned for modification 13 August 2004/Accepted 15 September 2004

Update on MALDI-TOF Validation

Prevalence of Haarlem I and Beijing types of Mycobacterium tuberculosis strains in Iranian and Afghan MDR-TB patients

Gene polymorphism of BCG vaccine strain using in Iran

Genotypic characteristics of Mycobacterium tuberculosis isolated from household contacts of tuberculosis patients in the Philippines

Evaluation of the Rapid MGIT TBc Identification Test for Culture Confirmation of Mycobacterium tuberculosis Complex Strain Detection

Appendix B. Recommendations for Counting Reported Tuberculosis Cases (Revised July 1997)

OUT-TB Web. Ontario Universal Typing of Tuberculosis: Surveillance and Communication System

Utility of New 24-Locus Variable-Number Tandem-Repeat Typing for Discriminating Mycobacterium tuberculosis Clinical Isolates Collected in Bulgaria

Appendix B. Recommendations for Counting Reported Tuberculosis Cases (Revised July 1997)

PATTERNS OF DRUG RESISTANCE AND RFLP ANALYSIS OF MYCOBACTERIUM TUBERCULOSIS STRAINS ISOLATED FROM RECURRENT TUBERCULOSIS PATIENTS IN SRI LANKA

Molecular Characterization of Mycobacterium tuberculosis H37Rv/Ra Variants: Distinguishing the Mycobacterial Laboratory Strain

Received 27 August 2010; received in revised form 9 November 2010; accepted 16 November 2010

M. tuberculosis as seen from M. avium.

Species Identification of Neglected Nontuberculous Mycobacteria in a Developing Country

Medical Bacteriology- Lecture 10. Mycobacterium. Actinomycetes. Nocardia

A Finer Snapshot of Circulating Mycobacterium tuberculosis Genotypes in Guadeloupe, Martinique, and French Guiana

Received 29 June 2009/Returned for modification 7 September 2009/Accepted 11 October 2009

AFB Identification Texas Approach

Received 2 March 2007/Returned for modification 17 April 2007/Accepted 18 May 2007

TB trends and TB genotyping

Research Article Proposal of a Screening MIRU-VNTR Panel for the Preliminary Genotyping of Mycobacterium bovis in Mexico

Evaluation of the discriminatory power of variable number of tandem repeat. (VNTR) typing of Mycobacterium bovis isolates from southern Africa

Clonal Expansion of a Globally Disseminated Lineage of Mycobacterium tuberculosis with Low IS6110 Copy Numbers

Nontuberculous mycobacteria isolated from pulmonary specimens between 2004 and 2009: causative agent or not?

Qian Gao Fudan University

Received 1 March 2001/Returned for modification 23 June 2001/Accepted 3 July 2001

Communicable Disease Control Manual Chapter 4: Tuberculosis

Differentiation of Mycobacterium bovis Isolates from Animals by DNA Typing

The diagnostic value of gyrb RFLP PCR. Mycobacteria in patients with clinical. in Mazandaran

A ten-year evolution of a multidrugresistant tuberculosis (MDR-TB) outbreak in an HIV-negative context, Tunisia ( )

Genetic analysis of Mycobacterium tuberculosis strains isolated in Ural region, Russian Federation, by MIRU-VNTR genotyping

Bayesian modelling of tuberculosis clustering from DNA fingerprint data

Genotyping of Mycobacterium tuberculosis isolates from northwest Iran for determination on the mechanism of transmission

The nature and consequence of genetic variability within Mycobacterium tuberculosis

Mycobacterium tuberculosis and Molecular Epidemiology: An Overview

Received: 05 April 2006 Accepted: 17 July 2006

Andrea Gibson, Timothy Brown, Lucy Baker, and Francis Drobniewski*

for Microbiology Novos programas de Controlo de Qualidade Externo: desenvolvimento e perspectivas 15 and 16 October 2008 Biognóstica - Portugal

Increasing Trend of Isolation of Non-Tuberculous Mycobacteria in a Tertiary University Hospital in South Korea

Molecular Epidemiology of Mycobacterium Tuberculosis Strains in the North West and West of Iran

Laboratory Investigation of a Nosocomial Transmission of Tuberculosis at a District General Hospital

CHAPTER 3: DEFINITION OF TERMS

Transmission of multidrug-resistant tuberculosis in a low-incidence setting, Switzerland, 2006 to 2012

Review Article Nontuberculous Mycobacteria Isolation from Clinical and Environmental Samples in Iran: Twenty Years of Surveillance

Multi-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis

Global TB Burden, 2016 estimates

Molecular typing for surveillance of multidrug-resistant tuberculosis in the EU/EEA

Medical Bacteriology- lecture 13. Mycobacterium Actinomycetes

THE INTRODUCTION OF 3+1 IMPORTANT METHOD FOR THE ISOLATION OF ENVIRONMENTAL MYCOBACTERIA FROM DRINKING WATERS

A Two-Step Strategy for Molecular Typing of Multidrug-Resistant Mycobacterium tuberculosis Clinical Isolates from Poland

Molecular typing for surveillance of multidrug-resistant tuberculosis in the EU/EEA

Comparison of mechanical disruption techniques for the rapid inactivation of

Molecular epidemiology of multidrug-resistant strains of Mycobacterium tuberculosis

PCR-Based Method To Differentiate the Subspecies of the Mycobacterium tuberculosis Complex on the Basis of Genomic Deletions

Usefulness of Spoligotyping To Discriminate IS6110 Low-Copy- Number Mycobacterium tuberculosis Complex Strains Cultured in Denmark

Mycobacteriology William H. Benjamin, Jr.

Epidemiological studies on tuberculosis control and respiratory viruses Sloot, R.

Frances Morgan, PhD October 21, Comprehensive Care of Patients with Tuberculosis and Their Contacts October 19 22, 2015 Wichita, KS

Predictive Power of ETRE Polymorphism and Katg463 Mutation to INH-Resistance of M.tuberculosis

Review. Molecular epidemiology of nontuberculous mycobacteria. Future Microbiology. For reprint orders, please contact:

Received 6 July 2006/Returned for modification 18 August 2006/Accepted 12 September 2006

Molecular Epidemiology of Tuberculosis

Molecular tests for rapid detection of rifampicin and isoniazid resistance in Mycobacterium tuberculosis.

imedpub Journals

A study on pre-xdr & XDR tuberculosis & their prevalent genotypes in clinical isolates of Mycobacterium tuberculosis in north India

Characterization of Mycobacterium tuberculosis isolates from Hebei, China: genotypes and drug susceptibility phenotypes

Evaluation of the Microscopic-Observation. Drug-Susceptibility Assay Drugs Concentration for Detection Of Multidrug-Resistant Tuberculosis

Effect of oral exposure of Mycobacterium avium intracellular on the protective immunity induced by BCG

Mycobacteriosisok. Somoskövi Ákos

School of Veterinary Medicine, University College Dublin (UCD), Dublin 4, Ireland

TB Control in Finland - the role of THL

National Survey of Drug-Resistant Tuberculosis in China Dr. Yanlin Zhao

The performance of interferon-gamma release assay in nontuberculous mycobacterial diseases: a retrospective study in China

Molecular epidemiology of tuberculosis: methodology and applications

Geographical distribution and clinical relevance of nontuberculous mycobacteria in Croatia

Characteristics of Mycobacterium

Transcription:

90 11 3 (Original Article) 4 3 2 1 1. 2. 3. 4. (Non- Tuberculosis Mycobacterium, NTM) :.. (Variable Number Tandem Repeat, VNTR). VNTR ) 48 : PCR-RFLP ( MPTR-A, ETR-A, ETR-B, ETR-C, ETR-D, ETR-E, ETR-F : 7 VNTR. VNTR 7. VNTR : 42. ( ) PCR 6. :. VNTR..VNTR : : fzheidari@yahoo.com : 89/9/15 : 88/10/19 : 09196210454 : (Atypical Mycobacteria) (Mycobacteria other Than Tuberculosis) MOTT EM (Non-Tuberculosis Mycobacteria) NTM. (Environmental Mycobacteria) : ٣

90 2. ETR DNA 53-79 ETR-A MPTR-A. ETR-C, ETR-B,ETR-D, ETR-E, ETR-F ETR-C, ETR-D, ETR-E, ETR-F. ETR-B.(8 7) VNTR (11) VNTR 7.(9). 48 - ( ). 1387 1386 %4. LJ (Lowenstein Jensen). (40µg/ml) (0/2µg/ml) (2µg/ml) (2µg/ml) (10µg/ml) MDR DNA. MDR hsp65 PRA. - (Heat Shock Protein 65KD PCR Restriction Analysis) 2009 100 1981 40.(1)....(2).(3). VNTR IS6110-RFLP IS6110-RFLP 1990.(14 4). PCR PCR Spoligotyping VNTR VNTR.(15 5) ( ) 11 VNTR.(6) 5 MPTR (Major Polymorphic Tandem Repeats) 6 (MPTR-A, MPTR-B, MPTR-C, MPTR-D, MPTR-E) ETR-A, ETR-B, ETR-C,). ETR(Exact Tandem Repeats) (ETR-D, ETR-E, ETR-F 7 11 (MPTR-A, ETR-A, ETR-B, ETR-C, ETR-D, ETR-E, ETR-F) (Insertion) (Deletion) 15 MPTR.(7) ٤

) PCR.(7) (1 PCR 30 94ºC 5 : 30 53 65ºC 30 94ºC :. 10 72ºC %1/7 PCR. PCR.(7) Hpa II Hph I Ava II 3.(20 19) VNTR 48 Myco. Simiae (ATCC 25275T). Myco. Fortuitum (ATCC 49404). Myco. Chelonae Abscessus (ATCC 19977T). Myco. Chelonae Chelonae (ATCC 35749T). Myco. Intracellular (ATCC 13950T). Myco. Parascrofulaceum (ATCC 19981T). Myco. Malmoens (ATCC 29571T). Myco. Gordonae (ATCC 14470T). Myco. Kansasii (ATCC 12478T). H 37 RV :1 (3'-5') *(bp) PCR (bp) MPTR-A GGTTACCACTTCGATGCGTCTGCC AGCCGCCGAAACCCATC ( 16 15) 343 Frothingham (1995) ETR-A AAATCGGTCCCATCACCTTCTTAT CGAAGCTGGGGTCGCCCGCGATTT ( 3 75)+23 420.Goyal et al (1994) ETR-B GCGAACACCAGGACAGCATCATG GGCATGCCGGTGATCGAGTGG ( 3 57)+8 292 ETR-C ETR-D GTGATGCGCTGCAGAACCTGCAG GGCGTCTTGACCTCCACGAGCT CAGGTCACAACGAGAGGAAGAGC GCGGATCGGCCAGCGACTCCTC ( 4 58)-21 276 ( 3 77)+7 310 Frothingham and Meeker O Connell (1998) ETR-E CTTCGGCGTCGAAGAGAGCCTC CGGAACGCTGGTCACCACCTAAG ( 3 53)-1 224 ETR-F CTCGGTGATGGTCCGGCCGGTCAC GGAAGTGCTCGACAACGCCATGCC ( 3 79)+13 476 ETR-D ETR-E.(7) ETR-F (%58/3) 28 (%41/6) 20 48 (%72/9) 35.. (%27) 13. 52±1 18-85 7 : ( ) MPTR-A, ETR-A, ETR-B, ETR-C, ETR-D, ETR-E, ETR-F. 6334333 : H37RV 6. 4 MPTRA ETR-A ETR-B ETR-C ٥

90 2 48 VNTR 2 42 (3 ) 3 PCR 6 ) VNTR.(1 ).( PCR MPTR-A, ETR-A, ETR-B, ETR-C, ETR-D, ETR-E, ETR-F 64255362 ) 52121332.(3. 30/3 54/7 2 (%95/8) 46 48. (%4/2) 36 (%8/3) 4 MDR (%16/6) 8 2. MDR (%75) (%27) 13 hsp65 PRA.(2 ) (%73) :2 hsp65 PRA 3 3 7 18 8 1 4 1 3 48 VNTR :3 ETR-F ETR-E ETR-D ETR-C ETR-B ETR-A MPTR-A 3 4 1-2 4 6 1 - - 1 4 - - 6 2 - - - - - - - 3 - - - - - - - 4-3 1 4 2 3 6 5 6 3 3 4 2 3 6 6-3 1 - - - - 7 - - 1-2 4 6 8-3 3 5 2-6 9 6 3 1 4 1 3-10 6 3 1-2 3-11 - - 3 4 1 - - 12 - - - - - - 6 13 ٦

- - - - - - - 14-3 - - - - 6 15 3 3 1 4-2 6 16-2 - 5 2 4-17 - 3 3 4 1 - - 18 - - - - - - - 19 3 3 3 - - 3-20 1 3 1 4 2 3 7 21 - - - - 2 - - 22 6 - - - 2 - - 23 - - - - - - 6 24 - - 4 2 - - 25 - - - - - - - 26 - - - 4 - - - 27-3 - 4-4 6 28 - - - - 2 - - 29 - - 3 4 - - - 30-3 1-2 - 6 31-3 - - 2-5 32 - - - - - 3 6 33 - - 4-2 - - 34 2 1 4-2 3 6 35 3 1-4 3 3-36 3 3 3-1 2 6 37-2 3 4 2-6 38-3 1 4 2 - - 39-5 3 - - - 6 40-3 5 2 2 3-41 - 3-4 - - - 42-3 3 4 - - - 43 - - 5 4 - - - 44-5 5 4-4 6 45 - - 5-2 - - 46 - - - - - - - 47 3-3 4-2 6 48 ٧

90 2 Myco. Simiae ETR-C, ETR-A, ETR-E :1 Myco. Simiae (100 bp Ladder) DNA :M :N Myco. Simiae :1-10 ٨

5 (BCG).(7) VNTR 2007-2008 MPTR ETR ETR-A.(17) MPTR ETR VNTR VNTR. M. ulceranse VNTR 2005 Ablordey.. 9 19.(18) M. ulceranse 2007 Hilty VNTR 34. 2 1.(6) Agy99. M. ulceranse ٩..(10) 1908.(2) Duvall. ) (.(12) VNTR MPTR ETR Meeker-O.(16 13) VNTR 1998 Frothingham ( ) 11. 5 H 37 RV VNTR 6 (MPTR-A, MPTR-B, MPTR-C, MPTR-E, MPTR-F) (ETR-A, ETR-B, ETR-C, ETR-D, ETR-E, ETR-F) ETR 6 MPTR 5. (Inserting) (Deletion) 25 23 22 BCG

90 2 MPTR. ETR VNTR. MPTR ETR. 48 VNTR 7 MPTR-A, ETR-A, ETR-E, ETR-D, ETR-C, ETR-B, ETR-F PCR. MPTR ETR 3 2 4 References: 1. Hartmans S, Bont AM. The Genus Mycobacterium Nonmedical. In the Prokaryotes. Dwrkin M, editor. New York: Springer; 2006. p. 889-918 (Vol 3). 2. Katoch VM. Infection Due to Non-Tuberculous Mycobacteria. Indian J Med Res 2004;120:290-304. 3. AI-Mahruqi SH, Van Ingen J, Busaidys-AI, Boeree MJ, AI-Zadjalis, Patel A, et al. Clinical Relevance of Non Tuberculous Mycobacteria. Oman Emery Infect Dis 2009;15:292-294. 4. Mostrom P, Gordon M, Sola C, Ridell M. Methods Used In The Molecular Epidemiology of Tuberculosis. J Clin Microbiol 2002;8(11):694-704. 5. Doroudchi M, Kremer K, Basiri EA. IS6110- RFLP and Spoligotyping of Mycobacterium Tuberculosis Isolates in Iran. J Infect Dis 2000;32:663-668. 6. Hilty M, Kaser M, Zinsstag J, Stinear T, Pluschke G. Analysis of the Mycobacterium Ulcerans Genome Sequence Reveals New Loci for Variable Number Tandem Repeats (VNTR) Typing. Microbiol 2007;153:1483-1487. 7. Frothingham R, Meeker O, Connell W. Genetic Diversity In The Mycobacterium Tuberculosis Complex Based On Variable Number of Tandem DNA Repeats. J Clin Microbiol 1998;144:1189-1196. 8. Skuce RA, McCorry TP, McCarroll JF, Roring SM, Scott AN, Brittain D, et al. Discrimination of Mycobacterium Tuberculosis Complex Bacteria Using Novel VNTR-PCR Targets. J Clin Microbiol 2002;148:519-528. 9. Stragier P, Ablordey A, Meyers WM, Portaels F. Genotyping Mycobacterium Ulcerans and Mycobacterium Marinum by Using Mycobacterial Interspersed Repetitive Units. J Bacteriol 2005;187:1639-47. 10. Demort M, Chaulet P. Treatment of Tuberculosis: Guidelines For National Programmes. Geneva: WHO; 1997. p. 218-251. 11. Hidarei F, Farnia P, Nowroozi J, Majd A, Tajeddin E, Masjedi MR, Velayati AA. The Rapid Identification Atypical Mycobacterium Pulmonary in Tuberculosis Patients: Avaluation of QUB3232 Locus Using the VNTR Method. J Zanjan University 2009;17(67):29-40. [Full Text in Persian] 12. Sriyabhaya N, Wonswatana S. Pulmonary Infection Caused by Atypical Mycobacteria: A Report of 24 Cases in Thailand. Rev Infect Dis 1981;3:1085-1089. 13. Portaels F, Stragier P, Ablordey A, Meyers WM. Genotyping Mycobacterium Ulcerans and Mycobacterium Marinum by Using Mycobacterium Interspersed Repetitive Units. J Bacter 2005;187(5):1639-1647. ١٠

14. Farnia P, Masjedi MR, Varahram M, Mirsaeidi M, Ahmadi M, et al. The Recent-Transmission of Mycobacterium Tuberculosis Strains Among Iranian and Afghan Relapse Cases: A DNA- Fingerprinting Using RFLP and Spoligityping. BMC Infect Dis 2008;8:109. 15. Kam K, Yip CW, Tse W, et al. Optimization of Variable Tandem Repeat Typing Set for Diferentiating Mycobacterium Tuberculosis Strains in the Beijing Family. FEMS Microbiol Lett 2006;256:258-65. 16. Mazars E, Lesjean S, Banuls AL, et al. High-Resolution Minisatellite-Based Typing as a Portable Approach to Global Analysis of Mycobacterium Tuberculosis Molecular Epidemiology. Proc Natl Acad Sci USA 2001;98:1901-6. 17. Tajeddin E, Farnia P, Nowroozi J, Masjedi MR, Velayati AA. Evaluation of Genetic Pattern of Mycobacterium Tuberculosis Separated of Iranian and Afgan TB Patients: Using the VNTR Typing Method. J Kurdestan University 2008;31:53-61. [Full Text in Persian] 18. Ablordey A, Swings J, Hubans C, Chemlal K, Locht C, Portaels F, Supply Ph. Multilocus Variable-Number Tandem Repeat Typing of Mycobacterium Ulcerans. J Clin Microbial 2005;43(4):1546-1551. 19. Kim H, Kim SH, Shim TS, et al. PCR Restriction Fragment Length Polymorphism Analysis (PRA)-Algorithm Targeting 644 bp Heat Shock Protein 65(hsp65) Gene for Gifferentiation of Mycobacterium Spp. J Microbiol Methods 2005;62:199-209. 20. Hafner B, Haag H, Geiss HK, Nolte O. Different Molecular Methods for the Identification of Rarely Isolated Non- Tuberculous Mycobacteria and Description of New hsp65 Fragment Length Polymorphism Patterns. Mol Cell Probes 2004;18:59-65. ١١