Effect of Fusarium tricinctum on Growth of Soybean and a Molecular-based Method of Identification

Plant Health Research Effect of Fusarium tricinctum on Growth of Soybean and a Molecular-based Method of Identification Periasamy Chitrampalam and Berlin D. Nelson Jr., Department of Plant Pathology, North Dakota State University, Fargo 58108 4 August 2014. 15 August 2014. ABSTRACT Chitrampalam, P., and Nelson, B. D., Jr. 2014. Effect of Fusarium tricinctum on growth of soybean and a molecular-based method of identification. Plant Health Progress doi:10.1094/php-rs-14-0014 Infection of soybean seedlings by Fusarium tricinctum and effects of isolates on growth and yield were evaluated in laboratory and field experiments in Fargo, North Dakota. Twenty one isolates from soybean roots collected in the field-infected cortical root tissue of soybean seedlings within 40 h at 23 C. In two field experiments conducted in 2012 and 2013, selected isolates significantly reduced emergence by 38 to 59% at three weeks after planting compared with noninoculated control. In 2013, isolates 91-1-8 and 91-319-3 significantly reduced plant height, number of plants with trifoliate leaves, and root biomass, but the reduction was significantly greater with isolate 91-1-8. Percent yield reduction with isolate 91-1-8 was significantly higher (90%) than with isolate 91-319-3 (31%) compared with noninoculated control. Primers specific for F. tricinctum were developed, and the presence of the pathogen in roots was verified in PCR. The problems associated with identification of F. tricinctum are discussed and a method for verifying identification of this species is suggested to aid identification of this pathogen from field samples. Results indicate F. tricinctum may have an important role in soybean root health in the northern soybean production area. INTRODUCTION Soybean (Glycine max (L.) Merr.) is an important crop in North Dakota, USA, with 1.9 million ha in 2012 (www.nass.usda.gov/nd). Root-infecting pathogens are major problems in this northern soybean production area. Fusarium root rot is one of the major soybean diseases with U.S. losses estimated at 10.66 million bushels in 2010 (17). Fusarium oxysporum and F. solani species complexes were reported to be the primary Fusarium species causing root rot in many soybeanproducing states (2,3,10). However, a number of other Fusarium species have also been associated with root rot, although the role of those species in causing disease and losses in soybean is not entirely understood. Fusarium avenaceum, F. equiseti, F. graminearum, F. proliferatum, F. pseudograminearum, F. redolens, F. semitectum, F. sporotrichioides, and F. tricinctum are some of the Fusarium species that have been found associated with soybean roots (2,18). Fusarium species are usually identified based on spore morphology, such as the size and shape of the macro and microconida, and other phenotypic characteristics, such as presence and locations of chlamydospores (intercalary or terminal) (8,12). However, identification of very closely related Fusarium species, such as members of F. avenaceum, F. acuminatum, and the F. tricinctum species complex, is difficult based on spore morphology (6). Furthermore, some Fusarium species have similar colony morphology (8,16) and also isolates within a single Fusarium species can be variable in both appearance and conidial morphology (6), which further highlights the limitation associated with morphological characters-based Corresponding author: B. D. Nelson. Email: berlin.nelson@ndsu.edu doi:10.1094/ PHP-RS-14-0014 2014 The American Phytopathological Society identification. Moreover, Fusarium isolates that were studied during three quarters of the 20th century were misidentified initially based on morphological criteria (5). Likewise, Fusarium species that are identified newly based on phylogenetic approach are also very difficult to identify based on conventional morphological criteria (1). Taken together, identification of Fusarium spp. based on morphological traits alone may result in misidentification. A molecular methods-based approach is very useful in identifying and differentiating the closely related Fusarium species (5). Sequencing of the internal transcribed spacer (ITS) regions of the nuclear ribosomal DNA, and part of translation elongation factor 1-alpha (EF1-α) and β-tubulin genes (13,14), and querying of these sequences against public databases such as NCBI-GenBank and FUSARIUM-ID, have been widely used to identify and differentiate Fusarium spp. However, of the two public databases, only FUSARIUM-ID database contains vouchered and well-characterized sequences for several Fusarium spp. (5), and therefore, querying of EF1-α sequence from unknown Fusarium isolates against FUSARIUM-ID is the best approach for identification of Fusarium isolates in question (5). Between 1991 and 1992, a survey of Fusarium species in soybean roots from the Red River Valley (RRV) of North Dakota and adjacent Minnesota was conducted. The RRV is an area of approximately 35,000 mi 2 with fertile lacustrine soils where numerous crops are grown and which was the principal soybean production region at that time. Only part of the data from that two-year survey was published (11), but the results showed that the four most prevalent Fusarium spp. in soybean roots in the RRV were F. oxysporum (57% of isolates), F. solani (21%), F. equiseti (14%), and F. acuminatum (4%). The other species isolated from roots were all less than 2% of the total isolations: F. sporotrichioides, F. proliferatum, F. subglutans, and F. graminearum. Information from the survey concluded that F. solani was an important pathogen in the area, and further research PLANT HEALTH PROGRESS Vol. 15, No. 3, 2014 Page 124

was conducted on that pathogen (10). All of the Fusarium isolates from the survey were identified using classical morphological identification criteria and then stored. Isolates of Fusarium species recovered were grown on irradiated carnation leaf pieces and then stored dry at 80 C for long-term storage (4). There are a number of recent publications suggesting that F. tricinctum could be an important soybean pathogen. In 2010, Meyer et al. (9) reported F. tricinctum causing root rot in Minnesota, Zhang et al. (18) showed pathogenicity on various soybean cultivars, and Rupe et al. (15) recovered the fungus from soybean seeds and seedlings. Diaz Arias et al. (2) reported low levels of F. tricinctum from soybean roots collected between 2007 and 2009 in Iowa. Because of this information and the fact that F. acuminatum and F. tricinctum are difficult to separate using morphological traits, a reassessment of the identification and pathogenicity of isolates of F. acuminatum from the 1991-1992 survey was initiated. IDENTIFICATION OF FUSARIUM TRICINCTUM Growth and pure culture of isolates. Twenty-one isolates previously identified as F. acuminatum were recovered from 80 C cryogenic storage by placing carnation leaf pieces on potato dextrose agar (PDA; Becton Dickinson & Co., Hunt Valley, MD) and incubating at 23 C. Nineteen of the isolates were obtained in the 1991 survey and two were isolated from soybean in 1995 (11). The isolate designations were as follows: 91-1-8, 91-1-12, 91-52-2, 91-85-4, 91-106-1, 91-132-5, 91-132-8, 91-164-2, 91-164-3, 91-167-4, 91-181-2, 91-181-2A, 91-181-2B, 91-181-2C, 91-248-3, 91-292-1, 91-310-5, 91-311-2, 91-319-3, 95-16-1, and 95-74-1. Following growth for 3 to 4 days under florescent lights all isolates were single-spored using macroconida to verify pure cultures. Pure cultures of each isolate were grown for 7 to 9 days on double-autoclaved, hydrated barely kernels placed on a 5-day-old culture on PDA. Infested barley kernels were collected, placed in sterile vials, and stored at 80 C. Growth of the fungus for experiments was initiated from the frozen infested barley kernels. DNA extraction, PCR, and sequencing. Twenty-one putative F. acuminatum isolates were cultured on PDA for 10 days, mycelia were collected, and DNA was extracted using Qiagen DNeasy plant mini kit by following the manufacturer s protocol (Qiagen, Valencia, CA). The final DNA concentration was adjusted to 10 ng/µl for polymerase chain reaction amplification (PCR). The internal transcribed spacer (ITS) regions of the nuclear ribosomal DNA, and part of the elongation factor 1-alpha (EF1-α) were PCR amplified and sequenced for all twenty-one isolates, and the β-tubulin gene was partially sequenced for two isolates (91-1-8 and 91-319-3) that had been evaluated for pathogenicity on soybean. The primer and PCR conditions for each locus were as described in previous studies (13,14). The amplified PCR products were cleaned with Exo-I and rapid phosphatase (Roche, Inc., Indianapolis, IN) by following the manufacture s protocol and sequenced at Molecular Cloning Laboratories Sequencing facility (MCLAB, San Francisco, CA). The sequences were aligned invoking CLUSTAL W in the program Bioedit v.5 (Ibis Biosciences, Carlsbad, CA). Identification. Sequences from all twenty one isolates were 99-100% identical at the sequenced regions of both ITS and EF1- α. Representative sequences from each locus were deposited in Genbank with the accession number KJ623251 for ITS and KJ623252 and KJ623253 for EF1-α. The blastn query of our isolate sequences (both ITS and EF1-α) with the NCBI-Genbank database resulted in an inconclusive outcome and revealed >99% nucleotide identity for both F. tricinctum and F. acuminatum. In addition a sequence (EF1-α) search with the FUSARIUM-ID database also revealed >99% identity for both species. This could be due to the poor representation of F. tricinctum and F. acuminatum in the FUSARIUM-ID database (5,6). These results highlighted the difficulties in identifying and differentiating F. tricinctum from F. acuminatum using public databases. To avoid misidentification of the isolates in this study based on a nucleotide search with public databases, a pairwise sequence analysis was performed using reference sequences for both species provided in the Fusarium Laboratory Manual (AY188923 and U85533 for ITS and AF405457 and U85567 for β-tubulin for F. acuminatum and F. tricinctum, respectively) (8). Results revealed that our isolates were 96-100% identical to F. tricinctum and 81-86% identical to F. acuminatum with both ITS and β- tubulin sequences, and therefore, we concluded all of our isolates were F. tricinctum. The pair wise sequence analysis with the reference sequences of F. tricinctum and F. acuminatum is the best strategy at present to identify these two Fusarium species. INFECTION OF SEEDLINGS WITH FUSARIUM TRICINCTUM Seed of the soybean cultivar Barnes was surface disinfected with 0.615% of sodium hypochloride for 30 sec and placed 1 cm deep in autoclaved vermiculite in Cone-tainers (type SC10 super cell, 164-ml volume; Stuewe & Sons, Inc., Corvallis, OR). They were incubated in a Percival 35LL growth chamber (Perecival, Boone, IA) under 12-h fluorescent light at 23 C for 7 days. Plants were then inoculated with a 1-ml suspension of conidia (at 5 10 5 spores/ml of sterile distilled water) placed around the base of the plant near the taproot. To prepare the conidial suspension, conidia (primarily macroconidia) were washed off of 4- to 5-day old cultures of the isolates growing on PDA under a 12-h light-dark cycle at room temperature. Inoculated plants were placed back in the growth chamber. Two isolates (91-1-8 and 91-1-12) were used initially, and the inoculated roots were examined at 12 to 48 h post-inoculation to determine if penetration of root had occurred and also to establish an average time for fungus to penetrate roots after inoculation. Once the approximate time of penetrations by hyphae was determined, the other isolates were examined prior to and after that time period. Most isolates were examined at 24, 30, 36, and 40 h post inoculation. Three inoculated plants were observed for each time period. The experiments were repeated to verify penetration and establishment of hyphae in root tissue. Three lateral roots approximately 1 cm in length were excised from a plant and placed in lactophenol for 2 to 4 days to clear the tissue. The root pieces were then stained in 0.1% analine blue in lactophenol on a hot plate at 70 C for 1 to 3 min. The root samples were then destained in lactophenol until the tissue was sufficiently clear of stain to observe the fungal hyphae. Root samples were cut several times longitudinally with a sharp scalpel and root pieces were placed in 50% glycerol on glass slides with the epidermis facing up or down and then covered with a glass cover slip. Roots from noninoculated root tissue were first examined as controls. Root samples were examined with a LeitzWetzlar epifluorescence or an American Optical One-Ten microscope with camera attachments at 400 to 1,000. Roots were scanned for hyphae within the tissue, and the presence or absence of hyphae were recorded. Hyphae within tissue were photographed for selected specimens. THE EFFECT OF FUSARIUM TRICINCTUM ON SOYBEAN Inoculum preparation. Three isolates of F. tricinctum, 91-1-8, 91-1-12, and 91-319-3, were tested in two field experiments between 2012 and 2013. Inoculum for each isolate was prepared PLANT HEALTH PROGRESS Vol. 15, No. 3, 2014 Page 125

using barley grains as the substrate. Barley grains were soaked in water in a steam table pan (51 cm long 30 cm wide 15 cm deep; Culinex, Fargo, ND) for four hours with the pan ¼ full of grain. The excess water was drained off, and the container was covered with two layers of heavy aluminum foil (Western Plastics, Temecula, CA) and then autoclaved for 1 h and autoclaved again after 24 h. A 100-ml spore suspension of F. tricinctum prepared from a week-old culture on PDA was added and mixed into the cooled grains. The infested grain was incubated at room temperature for three weeks, with occasional mixing of the grains to facilitate colonization. Design of field experiments. Soybean plants were grown in 5- liter plastic pots (24-cm diameter; Nursery Supplies, Portland, OR) using pasteurized Glyndon sandy loam soil. To infest soil with isolates of F. tricinctum, each pot was first filled with 2 liters of pasteurized Glyndon sandy loam soil, and then another 2 liters of pasteurized Glyndon sandy loam soil mixed with 340 g of fresh F. tricinctum inoculum. Two noninoculated control treatments were prepared in 2012: a control with autoclaved barley grains and a control with no grains added to soil. In 2013, treatments were compared with a control with no added barley grains. Ten and fifteen Barnes soybean seeds were planted in each pot in 2012 and 2013, respectively. The soil in each pot was watered with the same amount of water to promote seed germination, and pots were maintained in a greenhouse for one week. Pots were then transferred to a field site on the North Dakota State University Experiment Station in Fargo, ND. The pots were buried 25 cm deep in the ground with a portion of the bottom of the container removed to facilitate root growth into the surrounding soil. In 2012 isolates 91-1-8 and 91-1-12 were evaluated to determine if they caused seedling disease and evidence of root rot. In 2013, isolates 91-1-8 and 91-319-3 were evaluated for seedling disease and effect on growth of plants. We were unable to recover isolate 91-1-12 during 2013 because some cultures were lost due to the malfunction of an 80 C ultrafreezer. All treatments in both years were arranged in a randomized complete block design with four replications in 2012 and ten replications in 2013 (one pot a replication). Soil moisture and temperature were monitored using WatchDog recorders (Spectrum Technologies, Plainfield, IL). Plants in the field were grown under dry land conditions, however, supplemental water was added during the first two weeks in the field only if dry soil conditions occurred that might affect seedling establishment. In 2013, plants were thinned at four weeks after planting and five plants were left in each pot. Based on soil testing results, appropriate amounts of fertilizers were added to each pot at the time of planting to insure sufficient nutrients recommended for soybean cultivation. Data collection. In 2012, the data recorded were emergence (number of live seedlings) at three weeks after planting and an estimate of the discoloration of the root tissue of surviving plants at R6 growth stage, about 8 weeks after planting. In 2013, emergence and data on average plant height and yield was recorded. The numbers of live plants with trifoliate leaves were also recorded at 4 weeks after planting, and the percent plants with trifoliate leaves was calculated for each replication by number of plants with trifoliate leaves / total number of plants observed and multiplied by 100. In 2013, the height of the five plants in each replication was recorded immediately after thinning and averaged. At the time of thinning, three plants were arbitrarily chosen in each replication and the entire plant (above ground and roots) was collected to determine the root weight, and presence of F. tricinctum in roots. The roots from all three plants were separated from stems, washed carefully in running tap water to remove soil, damped dry with paper towels, cut into small pieces and placed in a 50-ml falcon tube and lyophilized for 48 h. The root biomass was recorded after lyophilization, and the samples were stored at 4 C until evaluated for presence of F. tricinctum. At the time of harvest in 2013, the total number of plants in each pot was recorded, and all the plants were cut off at the soil line, placed in cloth bags, and dried for a week at 32 C. The total plant dry weight, pod weight, seed weight, and the number of seeds were recorded for each replication, and the data was expressed as weight or number per plant for the analysis. Statistical analysis. Analysis of variance was performed for each data set using either the Statistical Analysis System (SAS Institute Inc., Cary, NC) or the Sigmastat software package (Systat Software Inc., San Jose, CA), and least significant differences were calculated following significant F tests. For emergence, the number of living plants was analyzed, but in the results emergence is expressed as a percentage of the total seeds planted. The data on root discoloration in 2012 was transformed with arcsine for the analysis, but in the results, the percentage of root discoloration is presented. INFECTION OF SEEDLINGS All isolates infected soybean seedlings as mycelium were observed in root cortical tissue (Fig. 1), but never in the noninoculated controls. Most infection was observed in tissue around 36 h following inoculation, but the exact time for penetration of the epidermis was not determined. Hyphae appeared to directly infect through the epidermal cell wall. Germination of conidia was usually apparent in about 12 h, and growth of mycelium over the root was abundant by 24 h. Some isolates (91-16-1, 91-85-4, 91-132-5, 91-167-4, 91-181-2A, and 91-181-2C) did not appear to be aggressive colonizers of roots as it was difficult to locate internal mycelium even though there was abundant growth on the surface of the root. There was no evidence of lesions on the root tissue within 72 h of inoculation when the experiments were terminated. FIGURE 1 Stained hyphae (arrows) of Fusarium tricinctum in cortical tissue of Barnes soybean seedling roots approximately 40 h after inoculation. The image is focused on the epidermal cells thus hyphae appeared blurred as they are in the cortex tissue. PLANT HEALTH PROGRESS Vol. 15, No. 3, 2014 Page 126

FUSARIUM TRICINCTUM AFFECTED SEEDLING EMERGENCE, ROOT HEALTH, PLANT GROWTH AND YIELD. In 2012, both isolates 91-1-8 and 91-1-12 of F. tricinctum caused a significant (P = 0.05) reduction in emergence at three weeks after planting (Table 1) with emergence ranging from 50 to 55% compared with 80 and 88% in the controls. At the R6 growth stage, the roots in treatments with the two isolates were strongly discolored compared with the controls (Table 1). The roots were light to dark brown, and there was evidence of rotted sections compared with the healthy white to light colored roots of the controls (Fig. 2). In 2013, both F. tricinctum isolates, 91-1-8 and 91-319-3, significantly reduced emergence compared with the noninoculated control. At three weeks after planting emergence was 63, 37, and 90% for 91-1-8, 91-319-3 and the noninoculated control, respectively (Table 2). The analysis of plant height and the percent of emerged plants with trifoliate leaves at four weeks after planting revealed that in the treatment with isolate 91-1-8 only 3% of the plants had trifoliate leaves with an average plant height of 7.3 cm (Table 2). On the contrary, with isolate 91-319-3, 70% of the plants had trifoliate leaves with an average plant height of 8 cm. In the noninoculated control 96% of the emerged plants had trifoliate leaves with an average plant height of 11.8 cm which was significantly greater than plant heights in the presence of F. tricinctum (Table 2, Fig. 3). Root biomass was also significantly reduced with both isolates compared with noninoculated control (Table 2). Plant weight, pod weight, seed weight, and number of seeds were also significantly reduced with both isolates compared with noninoculated control in 2013. However, isolate 91-1-8 was more aggressive than isolate 91-319-3, and the percent yield reduction (based on seed weight) with isolate 91-1-8 was significantly higher (90%) than with isolate 91-219-3 (31%) compared with noninoculated control (Table 2). These results not only revealed the effect of F. tricinctum on soybean seedlings but also on soybean yield. The results are consistent with a previous study from Ontario, Canada which revealed a 33% reduction in emergence by F. tricinctum on some cultivars of soybean (18). FIGURE 2 Roots of soybean infected with Fusarium tricinctum (left) compared with roots not infected (right) showing the brown discoloration of the infected roots. FUSARIUM TRICINTUM SPECIFIC AMPLIFICATION IN PCR Primer design and optimization for F. tricinctum specificity in PCR. To specifically identify F. tricinctum from soybean roots by PCR, a F. tricinctum-specific primer was designed based on the gene sequence encoding enniatins. Enniatins are a type of mycotoxin produced by F. avenaceum, F. tricinctum, and F. poae (7). Sequences of the gene encoding enniatins from F. tricinctum and F. avenaceum were obtained from the NCBI database and TABLE 1 Effect of Fusarium tricinctum on emergence and root health of Barnes soybean in the field in 2012. Treatments % emergence at 3 weeks x % root discoloration at R6 growth stage y F. tricinctum 91-1-8 55a 40a F. tricinctum 91-1-12 50a 43a Control, no grains 80b 2b Control, with grains 88b 2b x Mean percent emergence based on number of living plants compared to the total seed planted. y Mean percent discoloration of the root system based on brown to light brown roots compared to the white roots of the control plants. Values within a column followed by the same letter are not significantly different (P = 0.05). FIGURE 3 Soybean growth at V5 stage from a field experiment in 2013. Treatments from left: noninoculated control; F. tricinctum isolate 91-1-8; and F. tricinctum isolate 91-319-3. PLANT HEALTH PROGRESS Vol. 15, No. 3, 2014 Page 127

TABLE 2 Effect of Fusarium tricinctum on seedling emergence, plant height, and yield in soybean under field conditions in 2013. Treatments % seedling emergence 2 weeks 3 weeks Plant height (cm) x % germinated plants with trifoliate leaves Root biomass (g) y Plant weight (g) Yield/plant z Pod weight (g) Seed weight (g) Number of seed F. tricinctum 91-1-8 63a 65a 7.3a 3.1a 0.18a 4.1a 2.9a 1.8a 12.5a F. tricinctum 91-319-3 37b 45b 8.0a 70.1b 0.12a 22.2b 18.3b 12.1b 76.2b Non-inoculated control 90c 90c 11.8b 95.6c 0.32b 31.3c 27.0c 17.5c 126.0c x The plant height was taken immediately after thinning, and each replication contained five plants, and the values from five plants were averaged for each replication. y Three plants were randomly collected from each treatment at the time of thinning, and the roots were lyophilized and weighed. z The plant weight, pod weight, seed weight, and number of seeds were obtained for each replication and calculated per plant [Total weight (g) or number of grains/total number of plants observed]. Columns with different letters are significantly different according to Holm-Sidak test (P < 0.01). aligned using Bioedit. The primer pair (EnaRTF1: 5 AGTTCCTCGTGATGTCCTCGAGAT3, and EnaRTR2: 5 GGTAGGGAAGTATTGAACGACC3 ) was designed based on the variable region of the gene to specifically amplify the DNA region only from F. tricinctum. The specificity of the primer for F. tricinctum was validated by testing this primer with DNA from F. oxysporum and F. solani in PCR. PCR was conducted as described previously with the following PCR conditions: 95 C for 5 min, followed by 35 cycles; 95 C for 30 sec, 55 C for 30 sec, and 72 C for 30 sec, with final extension at 72 C for 5 min. The amplified PCR products (6 µl) were run on a 1% agarose gel by electrophoresis and visualized under UV transilluminator (Ultra- Violet Products Ltd, Cambridge, UK). The amplified PCR products were cleaned and sequenced as described earlier. Results revealed that the primer designed for F. tricinctum in this study was species specific and yielded the expected product size of 200 bp in PCR with DNA of both F. tricinctum isolates (Fig. 4) used in the 2013 field study. However, the primer failed to yield a product in PCR with DNA from F. solani, F. oxysporum, and soybean, confirming the specificity of these primers to F. tricinctum on soybean plants (Fig. 4). Furthermore, DNA from F. solani and F. oxysporum yielded a product with the ITS primers (ITS1 and ITS4) in PCR (data not shown) suggesting the negative amplification with the F. tricinctum-specific primer was not associated with a defect in the DNA, but exclusively due to the specificity of primers to F. tricinctum. The cross reactivity of the primers designed in this study was not verified against F. avenaceum and F. acuminatum because verified isolates from these two species were not available. F. tricinctum-specific PCR amplification from soybean roots. DNA was extracted from lyophilized soybean roots (30 g) collected from all treatment at the time of thinning in 2013 using the Qiagen Dneasy Plant Mini Kit. PCR amplification was conducted with F. tricinctum-specific primers as described earlier. DNA from soybean roots inoculated with 91-1-8 and 91-319-3 yielded the expected product size of about 200 bp in PCR (Fig. 5A). However, DNA from soybean roots collected from the noninoculated control did not yield a product in PCR with the F. tricinctum-specific primer (Fig. 5A). Furthermore, DNA from all treatments including the noninoculated control yielded a product with the soybean-specific primers (soyactinf1: 5 CATGCAATCCTTCGTCTTGA3 and soyactinr1: 5 GAGCTGGTCTCGGATGTCTC3 ) in PCR (Fig. 5B). The positive PCR amplification with DNA from soybean roots collected from both F. tricinctum treatments and the negative amplification with DNA from noninoculated soybean roots not only demonstrated the ability of F. tricinctum to colonize soybean FIGURE 4 Specificity of a Fusarium tricinctum and soybean specific primer in PCR. DNA was extracted from pure culture of both F. tricinctum isolates and also from roots and leaves of soybean. PCR was performed with a F. tricinctum specific primer (A) and with a soybean specific primer (B) separately. On the gel: M, 100 bp DNA marker; 1, F. tricinctum 91-1-8; 2, F. tricinctum 91-319-3; 3, F. solani I; 4, F. solani II; 5, F. oxysporum; 6, Soybean root; 7, Soybean leaf (only in B); and N, negative water control. FIGURE 5 PCR amplification of F. tricinctum from inoculated soybean roots collected from a microplot experiment. Roots were collected from each treatment, processed and used for DNA extraction (refer to data collection section for complete details). Two PCR amplifications were performed for each sample with F. tricinctum (A) and soybean actin specific primers (B) separately. On the gel: M, 100 bp DNA marker; 1 and 2, soybean root DNA from replication plots R1 & R2 inoculated with F. tricinctum 91-1-8; 3 and 4, soybean root DNA from replication plots R1 & R2 inoculated with F. tricinctum 91-319-3; 5 and 6, soybean root DNA from non-inoculated control replication plots R1 & R2; and N, negative water control. PLANT HEALTH PROGRESS Vol. 15, No. 3, 2014 Page 128

roots, but also supports the conclusion that F. tricinctum can have a negative effect on soybean growth and yield. Considering the primer designed in this study yielded the product with DNA extracted from a pure culture of F. tricinctum and also with DNA extracted from soybean roots which contain a mixture of both soybean DNA and fungal DNA, the primer pair developed in this study could be useful not only for molecular diagnosis of F. tricinctum, but also for quantifying F. tricinctum biomass at different growth stages of soybean using qpcr. Such research is currently in progress. To our knowledge, this is the first study to show the effect of F. tricinctum on soybean from seedling emergence to harvest. Considering that F. tricinctum is one of the more common Fusarium species found in soybean roots in the North Dakota and northern Minnesota soybean production area (11), F. tricinctum should be considered as having an important role in soybean root health in this area. Furthermore, the identification method suggested in this study and also the F. tricinctum-specific primers designed in this study would be helpful in identifying and diagnosing this pathogen in soybean fields. ACKNOWLEDGMENTS The authors thank the North Dakota Soybean Council, the North Central Soybean Research Program, and the United Soybean Board for supporting this research. Thanks also to Tracy Christianson for help in this project. LITERATURE CITED 1. Aoki, T., O Donnell, K., Homma, Y., and Lattanzi, A. R. 2003. Suddendeath syndrome of soybean is caused by two morphologically and phylogenetically distinct species within the Fusarium solani species complex F. virguliforme in North America and F. tucumaniae in South America. Mycologia 95:660-684. 2. Diaz Arias, M. M., Munkvold, G. P., Ellis, M. L., and Leandro, L. F. S. 2013. Distribution and frequency of Fusarium species associated with soybean roots in Iowa. Plant Dis. 97:1557-1562. 3. Diaz Arias, M. M., Leandro, L. F., and Munkvold, G. P. 2013. Aggressiveness of Fusarium species and impact of root infection on growth and yield of soybeans. Phytopathology 103:822-832. 4. Fisher, N. L., Burgess, L. W., Toussoun, T. A., and Nelson, P. E. 1982. Carnation leaves as a substrate and for preserving cultures of Fusarium species. Phytopathology 72:151-153. 5. Gieser, D. M., Jimenez-Gasco, M. M., Kang, S., Makalowska, I., Veeraraghavan, N., Ward, T., Zhang, N., Kuldau, G. A., and O Donnell, K. 2004. FUSARIUM-ID v.1.0: A DNA sequence database for identifying Fusarium. E. J. Plant Pathol. 110:473-479. 6. Harrow, S. A., Farrokhi-Nejad, R., Pitman, A. R., Scott, I. A. W., Bentley, A., Hide, C., and Cromey, M. G. 2010. Characterization of New Zealand Fusarium populations using a polyphasic approach differentiates the F. avenaceum/f. acuminatum/f. tricinctum species complex in cereal and grassland systems. Fungal Biol. 114:293-311. 7. Kulki, T. 2008. Detection of Fusarium tricinctum from cereal grain using PCR assay. J. Appl. Genet. 305-311. 8. Leslie, J. F., and Summerell, B. A. 2006. The Fusarium Laboratory Manual. Blackwell, Oxford. 9. Meyer, P. W., Clancey, M. S., Brose, I. E., and Kurle, J. E. 2010. First report of Fusarium root rot caused by Fusarium tricinctum in Minnesota. (Abst.) Phytopathology 100:S188. 10. Nelson, B. D., Hansen, J. M., Windels, C. E., and Helms, T. C. 1997. Reaction of soybean cultivars to isolates of Fusarium solani from the Red River Valley. Plant Dis. 81:664-668. 11. Nelson, B. D., and Windels, C. E. 1992. Pathogenicity of Fusarium spp. on soybean the Red River Valley. (Abstr.) Phytopathology 82:994. 12. Nelson, P. E., Dignani, M. C., and Anaissie, E. J. 1994. Taxonomy, biology, and clinical aspects of Fusarium species. Clin. Microbio. Rev. 7:479-504. 13. O Donnell, K. 2000. Molecular phylogeny of the Nectria haematococca- Fusarium solani species complex. Mycologia 92:919-938. 14. O Donnell, K., Sutton, D. A., Fothergill, A., McCarthy, D., Rinaldi, M. G., Brandt, M. E., Zhang, N., and Geiser, D. M. 2008. Molecular Phylogenetic diversity, multilocus haplotype nomenclature, and in vitro antifungal resistance within the Fusarium solani species complex. J. Clin. Micorbiol. 46:2477-2490. 15. Rupe, J., Rothrock, C., and Avanzato, M. 2010. Characterization of Pythium and Fusarium species associated with soybean seeds and seedlings. (Abstr.) Phytopathology 100:S111. 16. Turner, A. S., Lees, A. K., Rezanoor, H. N., and Nicholson, P. 1998. Refinement of PCR-detection of Fusarium avenaceum and evidence from DNA marker studies for phenetic relatedness to Fusarium tricinctum. Plant Pathology 47:278-288. 17. Wrather, J. A. 2010. Soybean disease loss estimates for the United States, 1996 2010. Missouri Agric. Res. Sta., Delta Research Center. http://aes.missouri.edu/delta/research/soyloss.stm 18. Zhang, J. X., Xue, A. G., Zhang, H. J., Nagasawa, A. E., and Tambong, J. T. 2010. Response of soybean cultivars to root rot caused by Fusarium species. Can. J. Plant Sci. 90:767-776. PLANT HEALTH PROGRESS Vol. 15, No. 3, 2014 Page 129