The genetics of heterochromatin in metazoa 1 Hermann Joseph Muller 1946 Nobel Prize in Medicine: "for the discovery of the production of mutations by means of X-ray irradiation" 3 4
The true meaning of "red eye reduction": White wild-type White mutant 12.14 5 7 12.14 Gene behavior can change depending on where on the chromosome the gene lies. = position effect (bar is the most commonly used example) Position effect variegation (PEV): cell-to-cell variability of expression of a gene that has been relocated to a new position in the genome. Epigenetic phenomenon: Stable change in expression without change in sequence! 6 8
2 genes: Su(var)2-5 Enhancer of PEV Su(var)3-9 Suppressor of PEV 9 10 11 12
HP1 (Sarah Elgin) (heterochromatin protein 1) Identified in a BIOCHEMICAL scheme to discover proteins that are associated with heterochromatin. biochemistry genetics HP1 = Su(var)2-5 Conserved in humans and in mice (both in terms of sequence and intranuclear location!). Why does HP1 go to places that HP1 goes to? 13 15 Biochemical epistasis (T. Jenuwein) Overexpression of mouse Su(var)3-9 leads to a MASSIVE redistribution of HP1 in the nucleus of mouse cells. 14 16
Who would have thunk it? NCBI: Su(var)3-9 contains a domain (the SET domain) that is somewhat similar to, ahem, RUBISCO methyltransferase. Su(var)3-9 is a HISTONE methyltransferase. Calling David Duchovny and Gillian Anderson Su(var)3-9 was given this name because it was the 9 th gene isolated on the 3 rd chromosome in a screen for Su(var)s. It methylates lysine 9 in histone H3. This was discovered 18 years after it was named. 17 19 Histone methylation And finally HP1 preferentially BINDS histone H3 methylated on lysine 9. That s why Su(var)3-9 determines localization of HP1 to heterochromatin (it methylates histones in heterochromatin). At least in fission yeast, and perhaps in worms, this has to do with RNAi. 18 20
21 22 HP1 HP1 = HP1 HP1 = HP1 HP1 = HP1 HP1 HP1 HP1 23 24
Remembrance of things past: chromatin as an epigenetic vehicle Analogy Fission yeast, flies, mammals. Budding yeast. 25 27 Homology (orthologs of heterochomatin proteins in fission yeast, insects, and humans) Nature, October 10, 2002 The polycomb group protein EZH2 is involved in progression of prostate cancer Varambally et al. Prostate cancer is a leading cause of cancer-related death in males and is second only to lung cancer. Although effective surgical and radiation treatments exist for clinically localized prostate cancer, metastatic prostate cancer remains essentially incurable. Here we show, through gene expression profiling, that the polycomb group protein enhancer of zeste homolog 2 (EZH2) is overexpressed in hormone-refractory, metastatic prostate cancer. Dysregulated expression of EZH2 may be involved in the progression of prostate cancer, as well as being a marker that distinguishes indolent prostate cancer from those at risk of lethal progression. 26 28
From egg to embryo? 29 Homeotic mutations (W. Bateson) Genetics Allele Heterozygous Homozygous Not that there has merely been a change, but that something has been changed into the likeness of something else. 31 wt antennapedia 30 32
Do you have any idea who I think I am?!! 1. Segment identity is determined by transcription factors. 2. They act on target genes only transiently. Then they go away, and the activity of their targets is maintained by large complexes: Polycomb represses genes, and Trithorax activates them. 3. Nobody knew how Polycomb and Trithorax do this. 33 35 The segmentation hierarchy 34 How Polycomb and Trithorax work 36
extra sex combs enhancer of zeste E(z) does it Posted September 13, 2002 CELL immediate early publication Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A., and Pirrotta, V. Drosophila Enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell. Published online September 13, 2002. 10.1016/S0092867402009753 Müller, J., Hart, C.M., Francis, N.J., Vargas, M.L., Sengupta, A., Wild, B., Miller, E.L., O'Connor, M.B., Kingston, R.E., and Simon, J.A. Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell. Published online September 13, 2002. 10.1016/S0092867402009765 37 38 Influential ideas are always simple. Since natural phenomena need not be simple, we master them, if at all, by formulating simple ideas and exploring their limitations. Al Hershey 39 40
stimulus + + Regulation of genes occurs via the interaction of transacting factors (proteins) with cis-acting sequences near the genes themselves. 41 Bicoid is the anterior morphogen 43 44 42
Boyer and Young Cell Sept. 23, 2005 What democracy, I mean, gene regulation, is really like Trans-acting factors do not distribute in the nucleus based on the primary sequence of the genome: some factors fail to bind most genes that have sequences waiting for them, and other factors bind a large number of genes that do NOT have sequences for them Even when a factor binds next to a gene, many times, nothing happens; the same factor bound to two different genes can exert diametrically opposite effects Most genes in the human genome are under considerable regulatory influence from entities other than simple trans-acting factors; these entities include noncoding RNA and modified histones 45 46 David Allis: the histone code 47 Fischle, Wang, Allis COCB 2003
1963-2000 2000 - Henry et al. (11/1/2003) Genes Dev. 17: 2648. 51 Genetic information Lac operator gaattgtgagcggataacaattt
Genetic information Genetic information +? -