Designer Affinity Reagents. Brian Kay

Similar documents
Designer Affinity Reagents. Reagents. Types of Affinity. M13 Bacteriophage. 900 nm x 10 nm. Brian Kay Src SH3 domain.

Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity.

Effects of Second Messengers

Department of Chemistry, University of Washington, Seattle, Washington 98195, United States *S Supporting Information

Lysosomes and endocytic pathways 9/27/2012 Phyllis Hanson

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.

Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system

Signaling Through Immune System Receptors (Ch. 7)

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Lecture 7: Signaling Through Lymphocyte Receptors

Antigen Recognition by T cells

Structural biology of viruses

Introduction 1/3. The protagonist of our story: the prokaryotic ribosome

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.

Protein tyrosine kinase signaling

7.012 Quiz 3 Answers

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.

Signal-Transduction Cascades - 2. The Phosphoinositide Cascade

Molecular Biology (BIOL 4320) Exam #2 May 3, 2004

The Tissue Engineer s Toolkit

Supplements. Figure S1. B Phalloidin Alexa488

Signaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research

Cell Signaling part 2

Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors

Signal Transduction: Information Metabolism. Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire

Chapter 18. Viral Genetics. AP Biology

Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department

Determination Differentiation. determinated precursor specialized cell

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

RNA (Ribonucleic acid)

Identification of Oral Bioavailable, Type2 Inhibitors of Discoidin Domain-containing Receptor 1/2 (DDR1/DDR2) using Back-to-Front X-Ray FBDD

Phospho-AKT Sampler Kit

Cell Cycle, Mitosis, and Microtubules. LS1A Final Exam Review Friday 1/12/07. Processes occurring during cell cycle

Growth and Differentiation Phosphorylation Sampler Kit

Origin of oncogenes? Oncogenes and Proto-oncogenes. Jekyll and Hyde. Oncogene hypothesis. Retroviral oncogenes and cell proto-oncogenes

7.012 Problem Set 6 Solutions

otherwise known as Cytotoxic T lymphocytes (CTLs)

Computational Biology I LSM5191

Apoptosis Oncogenes. Srbová Martina

Cellular Signaling Pathways. Signaling Overview

Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma

Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).

Nature Methods: doi: /nmeth.4257

Viral Genetics. BIT 220 Chapter 16

Bio 111 Study Guide Chapter 17 From Gene to Protein

How Cells Divide. Chapter 10

SUPPLEMENTARY INFORMATION

Principles of Genetics and Molecular Biology

MCB*4010 Midterm Exam / Winter 2008

Receptor mediated Signal Transduction

Supplemental Information. Lck/Hck/Fgr-Mediated Tyrosine. Phosphorylation Negatively Regulates. TBK1 to Restrain Innate Antiviral Responses

supplementary information

SHORT LINEAR MOTIFS. Holger Dinkel EMBO Practical Course Computational analysis of protein-protein interactions From sequences to networks

Supplemental Data. Wu et al. (2010). Plant Cell /tpc

1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance. 13/10/2017 Sara Redaelli

Life Science 1A Final Exam. January 19, 2006

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Mechanisms of resistance to JAK inhibitors. L. Knoops

AP Biology Protein Structure and Enzymes

Signal transduction by immunoglobulin Fc receptors

Viruses defined acellular organisms genomes nucleic acid replicate inside host cells host metabolic machinery ribosomes

Yong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D

2013 W. H. Freeman and Company. 12 Signal Transduction

SUPPLEMENTARY INFORMATION

Chapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling

Genetics and Cancer Ch 20

Molecular biology :- Cancer genetics lecture 11

KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints

Control of Cell Proliferation by Peptide Growth Factors. Autocrine Growth Factor Production Causes Malignant Transformation?

SUPPLEMENTARY FIGURE S1: nlp-22 is expressed in the RIA interneurons and is secreted. (a) An animal expressing both the RIA specific reporter

Supplementary Figure 1

Discovery and Optimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck

Polyomaviridae. Spring

Signal Transduction Cascades

Moore s law in information technology. exponential growth!

The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein

Fyn is required for oxidative- and hyperosmotic-stress-induced tyrosine phosphorylation of caveolin-1

Signal Transduction Pathways. Part 2

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler

T H E J O U R N A L O F C E L L B I O L O G Y

Cell cycle and Apoptosis. Chalermchai Mitrpant

Supplementary Information

Neurotransmitter Systems II Receptors. Reading: BCP Chapter 6

The unique N-terminal region of SRMS regulates enzymatic activity and phosphorylation of its novel substrate docking protein 1

membrane form secreted form 13 aa 26 aa K K V V K K 3aa

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

Insulin Resistance. Biol 405 Molecular Medicine

Relative activity (%) SC35M

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Capacity of simian immunodeficiency virus strain mac Nef for high-affinity Src homology 3 (SH3) binding revealed by ligand-tailored SH3 domains

Problem Set 8 Key 1 of 8

Biochem 503 Fall Protein Tyr Phosphatases

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer

Nucleotide polymorphisms of pfcrt gene in Thai isolates of Plasmodium falciparum

Transcription:

Designer Affinity Reagents Brian Kay bkay@uic.edu

Types of Affinity Reagents Src SH3 domain Lysozyme Src SH3 domain FN3 monobody Peptide Ligand Antibody Fragment Scaffold

M13 Bacteriophage 900 nm x 10 nm

Affinity Selection Process

The Fibronectin Type III Domain as a Scaffold Only 94 aa (vs. 250 aa for antibody fragment) Easier to work with than antibody fragments (more stable, express at higher levels in bacteria) Can bind targets inside cells Used by Shohei Koide, Dario Neri, Dane Wittrup, and Rihe Liu as a scaffold for affinity reagent generation Also called monobody

Construction of a Phage-displayed Library of FN3 Monobodies Immunoglobulin-like fold: monobody Small: 94 amino acids Stable: T m = 90ºC BC loop FG loop Expected diversity NNK (5 residues) NNK (5 residues) 1X10 13 (20 10 ) Actual diversity 1.3X10 10 85 electroporations were used to produce 2.8 x 10 10 transformants, 46% of which (1.3 x 10 10 ) have both loops mutated.

Construction of Phage Library by Kunkel Mutagenesis WT-gIII Phagemid DNA Phagemid DNA M13-K07 helper Uracilated ssdna E.coli CJ236 (F dut - ung - ) Phage particle with uracilated DNA Bacterial colonies E. coli TG1 (F dut + ung + ) x x x Heteroduplex x x x Synthesis of heteroduplex dsdna Annealing of mutagenic oligos

Src Family PxxP linker Y SH3 SH2 Kinase domain Create biosensors for members of the Src family of protein tyrosine kinases (54-81% similarity) Fabricate and test biosensors of Src family member activation in living cells SFKs Fgr Fyn Yes Src Lyn Hck Lck Blk

Identification of Lyn SH3 Domain Binders Phage ELISA Phage ELISA OD405nm

Both TA1 and TA8 Are Highly Selective for the Lyn SH3 Domain TA1 TA8

Construction of Secondary Libraries with a Mega-primer Generated by Error-prone and/or Asymmetric PCR 11

Two Variants Bind more than 130-fold Tighter than the Original Clone TA8 2H7 3C12 K D = 6.2 µm K D = 28 nm K D = 47 nm BC loop FG loop WT-TA8: WD APNTQHG YY VT TRPSISK PI 2H7: WD IRNTAHG YY VT TRPKIGL PI 3C12: WD ISNTSHG YY VT TRPKIGL PI The K D s of 2H7 and 3C12 for SH3 domains of Hck and Btk > 3 µm. 12

Successful Pull-down of Lyn from Cells with the Improved FN3 Monobody 13

Abs 405nm Isolated Monobodies Preferentially Bind to the Fyn SH3 Domain in the Src Family

Out of 150 Human SH3 Domains, the G9 Monobody Only Binds Fyn A. B. C. D. Dots lining the bottom and the right side of the membranes are histagged ligands, which are used for the purpose of alignment

ITC Experiments to Determine the Affinity of G9 Monobody to Three SH3 Domains Fyn SH3 Fgr SH3 Yes SH3 K D s: 166 nm ±6 nm N= 0.89 ΔH= 2.22x10 4 cal/mole ΔS= 43.37 Joule/ºK

The SH3 Domain of Src becomes Accessible upon Activation PxxP linker Y SH3 SH2 Kinase domain Inactive Active An affinity reagent that bind to SH3 domain can be used to monitor activation.

Pull-down of Activated Src Akash Gulyani Klaus Hahn (UNC-CH)

Fluorescently labeled Monobody Responds to Src Binding 19

Sensing Src Activation Merocyanine SH3 domain Kinase domain SH2 domain Src kinase

Ratio Imaging Akash Gulyani Klaus Hahn (UNC-CH)

Biosensor Experiments Inject cells with biosensor proteins and monitor changes in fluorescence.

PDGF Induced Dorsal Ruffling Platelet-derived Growth Factor (PDGF) stimulation induces actin-based dorsal protrusions in fibroblasts. Dorsal ruffles are precursors to macropinosomes. Video removed Src activity is previously known to be required for dorsal ruffle formation and macropinocytosis.

Src activation Followed with the Biosensor Video removed Sites of white, red, and yellow coloration are interpreted as sites of Src activation.

Negative Control Video removed Injection of a fluorescent monobody (point mutant) that does NOT bind the Src SH3 domain.

Results of Preliminary Screening External Set 1: Human Proteins Target Full name/function FN3 Hits USP11 Ubiquitin carboxyl-terminal hydrolase 11 GTP-binding protein SAR1a Yes SAR1A Heat shock protein 90kDa beta HSP90B1 member 1 CTBP2 C-terminal-binding protein 2 Yes Phospholipase A-2-activating Yes PLAA protein Ribosomal protein S6 kinase, RPS6KA3 90kDa, polypeptide 3 mitogen-activated protein kinase Yes MAP2K5 kinase 5 CTBP1 C-terminal-binding protein 1 Yes CDK2 Cyclin-dependent kinase 2 Yes MAPK8 mitogen-activated protein kinase 8 Yes SF3A1 Splicing factor 3 subunit 1 Yes COPS5 constitutive photomorphogenic homolog subunit 5 Yes Targets Prepared by the Structural Genomics Consortium (SGC)

27

Acknowledgements Renhua Huang Chris Vinci Kevin Gorman Kritika Pershad Funding: NIH U54, Common Fund