Supplementary Information Supplementary Figure 1 1
Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or hcas9-2a-mcherry gene targeting. Schematic representation of the EGFP gene correction by Cas9-mediated homologous recombination (HR). The mutant EGFP gene harbors an insertion of a 35bp fragment containing a translational stop codon. The repair donor (tgfp) has a 5 truncated EGFP coding sequence. A guided RNA (grna-s35 or gs35) was designed to target the 35bp insertion. For EGFP gene correction, gs35 and tgfp were co-transfected with hcas9 or its derivative hcas9-mcherry into a mutated EGFP integrated cell line. Once the HR-mediated repair occurs, the expression of the EGFP can be detected. The upper right figure shows fluorescence microscopy of the mutant EGFP reporter cells at 4 days after transfection. Inset shows that no GFP+ cells are observed under fluorescence microscopy in the absence of hcas9. Lower panels: FACS analysis of the efficiency of hcas9 and hcas9-2a-mcherry mediated EGFP gene correction in mutated EGFP HEK293 cell line. hcas9-2a-mcherry shows similar efficiency of EGFP gene correction as wild-type hcas9. We used this hcas9-2a-mcherry (also named hcas9-mcherry) in the majority of the subsequent experiments in order to evaluate the efficiency of transfection. (b,c) No significant reduction of virus expression in control experiments with only grna but not hcas9 supplementary to Fig. 1b,c. (b) Fluorescence microscopy images of EGFP reporter lentivirus expression with only individual grnas used, which were the same as those shown in Figure 1. Insets show bright field images of HEK293 cells. (c) The bar graph represents the average of MFI (mean fluorescence intensity) from triplicates of Supplementary Fig. 1b. (d-i) HEK293A cells were pretreated with hcas9-mcherry and grnas for 20~24 hours, and then were challenged by either lentivirus (d,f,h) for 4 days or foreign plasmid (e,g,i) for 2 days with EGFP reporter. (d,e) Fluorescence microscopy images of EGFP reporter expression from lentivirus (d) or foreign plasmid (e) with only individual grnas used, which were the same as those shown in Figure 1. Insets show bright field images of HEK293 cells. (f,g) Decreased EGFP expressions of infected lentivirus (f) or foreign plasmid (g) were measured by flow-cytometric analysis. The bar graph represents the average of MFI (mean fluorescence intensity) from triplicates. (h,i) Confocal images represent the reduction of EGFP expression from lentivirus (h) or foreign plasmid (i) by gmock and gegfp-t1 guided hcas9-mcherry. GFP expression of EGFP reporter (left lane), RFP expression of hcas9-mcherry (middle lane) and overlapped image with nucleic DAPI staining (right lane) were shown with scale bar as 50 microns. 2
Supplementary Figure 2 3
Supplementary Figure 2. Specificity of the CRISPR/Cas9 mediated disruption or excision of infectious lentivirus or pre-integrated proviruses The CRISPR/Cas9 system can direct targeted disruption of infectious or pre-integrated lentiviruses with targeting specificity. (a,b) Antiviral specificity of the CRISPR/Cas9 system directed disruption of infectious lentivirus. Multiple grnas can independently disrupt two types of lentivirus, which shared the same LTR sequences but different fluorescence reporter genes. When working together with hcas9, each grna specifically targets its cognate region. (a) Expression of Lenti-EGFP can be inhibited by the grna targeting EGFP (gegfp-t1 and gegfp-t2) and the common LTR regions (gltr-t1 and gltr-t2), but not the negative controls (gempty and gmock) or mcherry (gmcherry-t1 and gmcherry-t2). (b) Expression of Lenti-mCherry can be inhibited by the grna targeting mcherry and common LTR regions but not the other sequences. Scale bar in fluorescent microscopy images: 500 microns. (c,d) Multiple grnas can independently disrupt or excise two types of fluorescent provirus from integrated HEK293 cells. The copy numbers of EGFP and mcherry provirus cell lines are shown in Fig. 2b. The high copy number EGFP integrated line was used in this experiment. When working together with hcas9 protein, each grna specifically targets its cognate region but not nonspecific sequences. (c) Expression of the EGFP provirus can be disrupted by hcas9 co-transfected with the grna targeting EGFP (gegfp-t1 and gegfp-t2) and common LTR regions (gltr-t1 and gltr-t2), but not the negative controls (gempty and gmock) or mcherry (gmcherry-t1 and gmcherry-t2). (d) Expression of mcherry provirus can be inhibited by the grna targeting mcherry and common LTR regions but not the others. Scale bar in fluorescent microscopy images: 200 microns. 4
Supplementary Figure 3 Supplementary Figure 3. CRISPR/Cas9 directed reduction of HIV-1 provirus in latently infected T cell lines and disruption against lentiviral infection by stable expression of hcas9/grnas in human cells (a) FACS analysis of EGFP expression from two types of J-Lat lentivirus T cell lines. Treatment with grna against HIV-1 LTR-U3-T1 and hcas9 resulted in a 6~7 fold increase of the GFP negative population in A2 and 10.6 J-Lat cells after reactivation by PMA + TNF-α. (b) DNA sequencing analysis of the disruption of the EGFP reporter virus from the provirus integration sites. The indel mutations and proviral excisions were only detected from the cells treated with gu3-t1 but not other controls. 5
(c-g) The CRISPR/Cas9 system stably expresses in HEK293 cells by piggybac-mediated transposon integration to perform antiviral activity. (c) hcas9-mcherry and grnas were cloned into piggybac transposon elements with a puromycin selection marker. The coding sequence of hcas9 is linked to mcherry and puromycin by 2A sequences and the expression is driven by the CMV promoter. The single or double grna expression cassettes are driven by the U6 promoter and put in the opposite orientation to that of hcas9. PB-ITR: piggybac inverted terminal repeat sequence. (d) Schematic illustration of the experimental design. Stable expression of hcas9-mcherry-grna HEK293 cells was established by co-transfection of PB-hCas9-mCherry-gRNA with PiggyBac transposase for 24 hours. After puromycin selection for two weeks, mcherry positive cells were split into two groups, some underwent single cell sorting by flow cytometry and others were unsorted. Then the cells were challenged by lenti-egfp for 4 days. The efficiency of targeted disruption was analyzed by fluorescent microscopy or determined by FACS. (e) Fluorescence microscopy images of unsorted cells with knock-in hcas9-mcherry and grnas for targeted disruption of infected lentivirus. Insets: bright field images of transduced 293A-hCas9-gRNA cells. Scale bars, 200 microns. (f,g) Decreased expressions of EGFP lentivirus from hcas9-mcherry-grna 293 cells were measured by FACS analysis. (f) Overlay histograms depicting gempty as non-targeting control in the first panel. Numbers in each panel represent the percentage of GFP-positive cells. (g) FACS analysis of EGFP expression by different type of knock-in hcas9-tandem grnas. The EGFP expressions from the treatment of hcas9-gegfp-t1 were further decreased by combination with either EGFP coding region grna (gegfp-t1-gegfp-t3) or non-coding region gltr-t2 (gegfp-t1-gltr-t2), but not with the gegfp-t1-gmock. Overlay histogram depicts gempty as non-targeting control in the first panel. Numbers in each panel represent the percentage of GFP-positive cells. 6
Supplementary Figure 4 7
Supplementary Figure 4. Cas9 and dcas9-krab establishes intracellular defense against retrovirus, adenovirus and HIV-1 in human cells (a-d) Retroviruses can cause tumor growth (ex. Rous sarcoma virus). In order to test whether the CRISPR/Cas9 system can function against viruses other than lentiviruses, we examined the antiviral activity of the CRISPR/Cas9 system against retroviral infections. (a) Eight grnas were designed and used with hcas9 to target corresponding regions on the EGFP retroviral reporter, including gegfp-t1 to -T6 against coding region of EGFP, and gretro-ltr-t1 and -T2 to target the long-terminal repeat (LTR) region of the retrovirus. (b) Schematic illustration showing the design of the experiment. HEK293 cells were pretreated with hcas9-mcherry and grnas for 20~24 hours, and then challenged by retroviruses with the EGFP reporter. FACS analysis was implemented 4 days after infection of EGFP retrovirus. (c) Fluorescence microscopy images of transduced 293 cells containing grnas to guide hcas9-mcherry to target and disrupt infected retrovirus. gempty is used as the empty target grna vector and gmock is used as a non-targeting mock grna. Six grnas were designed to target against the EGFP coding region, two grnas against retrovirus LTR, and the other two grnas against HIV-1 lentivirus LTR, but not the retrovirus LTR as the control. Inset shows bright field images of transduced HEK293 cells. Scale bar, 500 microns. (d,e) Decreased infected EGFP retroviral expressions were measured by FACS analysis. (d) Overlay histogram depicts gempty as a non-targeting control in the first panel. The dashed blue line in the first panel indicates the untreated HEK293 cells. Numbers in each panel represent the percentage of GFP-positive cells. (e) The bar graph represents the average of MFI from triplicates. (f-j) Adenoviruses are non-enveloped viruses composed of a nucleocapsid and a double-stranded linear DNA viral genome. Adenovirus infections most commonly can cause illness in the respiratory system. In order to examine the antiviral efficiency of CRISPR/Cas9 against this DNA virus, helper-dependent adenovirus 35 (HdAd35) was used as a model. (f) Five grnas were designed and used with hcas9 to target corresponding regions on the HdAd35 with Venus reporter, including gvenus-t1 to -T5 against the coding region of Venus coding sequence on HdAd35. (g) Schematic illustration showing the design of the experiment. HEK293 cells were pretreated with hcas9-mcherry and grnas for 20~24 hours, and then challenged by HdAd35 with Venus reporter. FACS analysis was implemented 2 days after infection of HdAd35-Venus. (h) Fluorescence microscopy images of transduced 293 cells containing grnas used to guide hcas9-mcherry to target and disrupt infected HdAd35. Five grnas were designed to target against the Venus coding region. Insets: bright field images of transduced HEK293 cells. Scale bar, 500 microns. (i,j) Decreased infected Venus expressions from HdAd35 were measured by 8
FACS analysis. (i) Overlay histogram depicts gempty as a non-targeting control in the first panel. Dashed blue line: untreated HEK293 cells. Numbers in each panel represent the percentage of Venus-positive cells. (j) The bar graph represents the average of MFI from triplicates. (k-m) Inactivated form of Cas9 fused with a transcriptional repressor, KRAB (dcas9-krab) can repress HIV-1 expression in 293T.CD4.CCR5 cells. (k) A model of repression of HIV-1 expression by dcas9-krab. (l,m) Decreased EGFP expressions of pseudo-type VSV.G-HIV-1 NL4-3- E-GFP (l) and wild-type HIV-1 NL43-GFP (m) reporter viruses were measured by FACS analysis. 9
Supplementary Figure 5 Supplementary Figure 5. Full western blot images (a) Full western blot of the selected portion shown in Figure 3e. (b) Full western blot of the selected portion shown in Figure 4d. 10
Supplementary Table 1: grna against fluorescent reporter sequence Number Name Target Sequence 1 gegfp-t1 GTCGCCACCATGGTGAGCAAGGG 2 gegfp-t2 GAGCTGGACGGCGACGTAAACGG 3 gegfp-t3 GGCGAGGGCGATGCCACCTACGG 4 gegfp-t4 GGAGCGCACCATCTTCTTCAAGG 5 gegfp-t5 GGGCGAGGAGCTGTTCACCGGGG 6 gegfp-t6 GGCCACAAGTTCAGCGTGTCCGG 7 gs35 (gmock) GCGCGAAGCTTAGGGATAACAGG 8 gmch-t1 GCCCTTCACCATGGTGAGCAAGG 9 gmch-t2 GGCCACGAGTTCGAGATCGAGGG 10 gretro-ltr-t1 GCAGTTCCTGCCCCGGCTCAGGG 11 gretro-ltr-t2 GAGCCCACAACCCCTCACTCGGG 12 gvenus-t1 GGGCGAGGAGCTGTTCACCGGGG 13 gvenus-t2 GTCGCCACCATGGTGAGCAAGGG 14 gvenus-t3 GAGCTGGACGGCGACGTAAACGG 15 gvenus-t4 GGCGAGGGCGATGCCACCTACGG 16 gvenus-t5 GGAGCGCACCATCTTCTTCAAGG
Supplementary Table 2: grna against HIV genome sequence Number Name Position* Target Sequence (inclulding PAM) 1 gu3-t1 78 GATTGGCAGAACTACACACCAGG 2 gu3-t2 221 GCATGGGATGGAGGACCCGGAGG 3 gu3-t3 380 GTGTGGCCTGGGCGGGACTGGGG 4 gltr-t1 (R region) 464 GGTTAGACCAGATCTGAGCCTGG 5 gltr-t2 (R region) 485 GGGAGCTCTCTGGCTAACTAGGG 6 gu5-t1 562 GCCCGTCTGTTGTGTGACTCTGG 7 gltr-t3 (U5 region) 627 GATTTTCCACACTGACTAAAAGG 8 gp17-t1 798 GAGAGCGTCGGTATTAAGCGGGG 9 gp17-t2 952 GAAGGCTGTAGACAAATACTGGG 10 gp24-t1 1254 GGTAAAAGTAGTAGAAGAGAAGG 11 gp24-t2 1465 GGCCAGATGAGAGAACCAAGGGG 12 gp24-t3 1822 GAAATGATGACAGCATGTCAGGG 13 gpol-t1 2374 GATGGAAACCAAAAATGATAGGG 14 gpol-t2 3164 GAGACAACATCTGTTGAGGTGGG 15 gpol-t3 4348 GTGATAAATGTCAGCTAAAAGGG 16 gvif-t1 5263 GGAGAAAGAGACTGGCATTTGGG 17 gvif-t2 5463 GGTAGGATCTCTACAGTACTTGG 18 genv-t1 6238 GTATCAGCACTTGTGGAGATGGG 19 genv-t2 6322 GTGGGTCACAGTCTATTATGGGG 20 genv-t3 7333 GCACAGTTTTAATTGTGGAGGGG 21 grev-t1 8368 GACCCACCTCCCAATCCCGAGGG 22 grev-t2 8558 GTGGAACTTCTGGGACGCAGGGG *The position is based on the sequence number of HIV-NL4-3
Supplementary Table 3: Off-target analysis of CRISPR-gRNA against HIV-LTR in human stable cell lines Top 5 exonic off-target sites to gltr-t1 (GGTTAGACCAGATCTGAGCC TGG) Off-target ratio* Sequence Mismatches UCSC gene Locus Gene Forward primer Reverse primer HEK-293 1 GGTAAGACCAGATCTGAGGGAGG 3MMs [4:19:20] NM_021633 chr1:-202863285 KLHL12 ctgctccacttcaaaaagctc tgggcatgaggatttaccac 0/12 2 GGTTACACCAGAACGGAGCCAGG 3MMs [6:13:15] NM_012465 chr10:+98125173 TLL2 agctttggggatgacagtga gggccacattggaagaaga 0/12 3 GGTTAGAGCAGTTCTGGGCCGGG 3MMs [8:12:17] NM_001144997 chr12:+56094008 ITGA7 tggggagagggctagaaaga gggaggggacatccagagta 0/11 4 TGGTAGACCACATCTGAGGCTAG 4MMs [1:3:11:19] NM_001010977 chr13:+103338581 METTL21C gccaaggctaaggaatccag ttgtgaaaggcattttgttgg 0/9 5 GGTTGGCCCAGCTCTGAGGCTGG 4MMs [5:7:12:19] NM_001161498 chr14:+69994721 PLEKHD1 agcaggtggctctggaatct gtgtgccaagcttcttccag 0/12 Top 5 exonic off-target sites to gltr-t2 ( GGGAGCTCTCTGGCTAACTA GGG) Off-target ratio* Sequence Mismatches UCSC gene Locus Gene Forward primer Reverse primer HEK-293 hpsc 1 GGGAACTGTTTGGCTAACAAGAG 4MMs [5:8:10:19] NM_001136265 chr1:+19233225 IFFO2 tctgggtttcactgggattg cctcgaggaaacggaaaatc 0/23 0/31 2 GTGTGCTCTGTGGCTAATTAAAG 4MMs [2:4:10:18] NM_052896 chr1:-34102240 CSMD2 caggaggctgctgagtgtg cgttcttgatggaaccagga 0/12 0/29 3 GGGATCACACTGGCTAACAAAGG 4MMs [5:7:9:19] NR_031700 chr12:+79813206 SYT1 ggcaaaacgaaaccaatagaaa tgaggtactccgagtcagattca 0/29 0/31 4 GGGATCTCTCAGGCTCACAACGG 4MMs [5:11:16:19] NR_038900 chr21:+41756651 DSCAM ataggatggggagggaacaa ttgcttgaatttgggaggtg 0/11 0/30 5 GGGAGCTCGCTGGCTGCCCATGG 4MMs [9:16:17:19] NM_005392 chr9:+96435980 PHF2 ttgtgcaggagtttgtgcag ctgagctgaggcctgctgta 0/21 0/26 *Off-target ratio is calculated by the in/del sequence analysis of anti-hiv CRISPR/Cas9 stable cell clones with top 5 sequence similarity to exonic off-target sites in human genome