hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

Similar documents
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

SUPPLEMENTARY INFORMATION

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

SUPPLEMENTARY INFORMATION

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

SUPPLEMENTARY INFORMATION

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Supplementary Materials for

A. Generation and characterization of Ras-expressing autophagycompetent

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

Supplementary Figures

SUPPLEMENTARY FIGURE LEGENDS

Supplementary Figure 1

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

SUPPLEMENTARY FIGURES AND TABLE

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Materials for

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Expanded View Figures

SUPPLEMENTARY INFORMATION

Tel: ; Fax: ;

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis

Supplementary Figure S1 Supplementary Figure S2

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

SUPPLEMENTARY INFORMATION

Supplementary Materials for

Supplementary Materials for

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Information

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

Supplementary Figure 1 Maschalidi et al.

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

SUPPLEMENTARY INFORMATION

Supplementary Fig. 1

SUPPLEMENTARY INFORMATION

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplementary Materials

supplementary information

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

Supplementary Materials for

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation

Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity

RayBio KinaseSTAR TM Akt Activity Assay Kit

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Supplemental Material:

Plasma exposure levels from individual mice 4 hours post IP administration at the

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow

Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

SUPPLEMENTARY INFORMATION

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

AP VP DLP H&E. p-akt DLP

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-

Essential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in

Supplementary Table 1

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin

Supplementary Figure 1

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-

Supplementary Figures

a! b! c! Supplementary Fig. 1! Diameter (μm) S1P (LogM) U (LogM) enos! β-actin! Nogo-B! MLEC! nnos! β-actin!

Supplementary Materials for

Loss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization.

Anti-Lamin B1/LMNB1 Picoband Antibody

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Transcription:

SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed in mammalian cell and was used as immunogen. M, protein ladder. (B) Purified GRP78-His protein and MCF7 whole cell lysate were resolved on SDS-PAGE and immunoblotted with (0.5 ug/ml) that was pre-incubated with 100 ug/ml bovine serum albumin (BSA) or GRP78-His. GRP78-His completely blocked the binding of to GRP78 on the immunoblot. (C) Breast carcinoma cell MCF7 was treated with 300 nm thapsigargin or DMSO for 16 hours and the whole cell lysates were immunoblotted using (signal in red) and antibody against HSP70 (signal in green). The same membrane was used for both antibodies. only recognized GRP78, which was significantly induced after thapsigargin treatment. (D) in immunoblot assays recognized the GRP78 protein band in mouse embryo fibroblast (MEF) lysates prepared from the Grp78 floxed/floxed mice. The GRP78 band was absent in the c78f/f MEFs where the Grp78 alleles were deleted by treatment of the MEFs with adenovirus expressing the cre-recombinase. The blot was re-probed with anti beta-actin antibody to confirm equivalent protein loading in both lanes. These results also show that only immunoreacted with GRP78 in mouse protein lysates, confirming its specificity. (E) Scatchard assay to determine the affinity of to GRP78. Fig. S2. induces GRP78 endocytosis through clathrin mediated pathway. (A) MCF7 cells were glucose starved for 3 days and then treated with 50 ug/ml for 1 hour at 37 C. Cells were fixed with paraformaldehyde and permeabilized with Triton X-100, followed by co-staining with and clathrin antibody. Co-localization of

GRP78/ and clathrin is shown. (B) Glucose starved MCF7 cells were incubated with 50 ug/ml at 4 C for an hour, followed by staining with EphB4 antibody on ice without fixation and permeabilization. Plasma membrane localization of GRP78 is shown. Cells were also treated with or the combination of and 2ug/mL or 5 ug/ml chlorpromazine for 1 hour at 37 C, followed by the same staining procedure described above. treatment significantly reduced the surface GRP78, whereas the endocytosis inhibitor chlorpromazine restored surface GRP78. Nuclei were counterstained with DAPI. Scale bar, 20 Fig. S3. induces apoptosis of tumor cells in vitro. (A) HT29 cells were glucose starved and treated with or control IgG for 5 days, and the cell viability was analyzed with clonogenic assay. Representative pictures and statistical analysis (normalized to PBS treated cells) are shown. treated cells had significantly less colony formed. Treated cells were also analyzed with M30-CytoDEATH (B) and Caspase activity assay (C). Experiments were performed at least in triplicate. Asterisk and double asterisks indicate P < 0.05 and P < 0.02 respectively, as determined by an unpaired 2-tail student T-test. Fig. S4. Surface GRP78 Forms Complex with PI3K. (A) Flag tagged GRP78 without KDEL was over-expressed in 293T cells, followed by surface protein biotinylation and immunoprecipitation (IP). The interaction of surface GRP78 with p85, but not EphB2, Erk1/2, or beta-actin was detected. In the bottom panel, biotinylated surface GRP78 could also be detected with fluorochrome-conjugated streptavidin. (B) The interaction of endogenous surface GRP78 with p85 was detected in 293T cells treated with thapsigargin. Same biotin-ip system was used as in (A).

Fig. S5. Surface GRP78 level in cancer cell lines. (A) Cancer cells were grown in complete medium or glucose depleted medium for 3 days and then subjected to cell surface biotinylation. The biotinylated surface GRP78 was enriched with streptavdin beads, resolved on SDS-PAGE, and detected with. (B) The band intensity on immunoblot was quantified with Odyssey and the ratio of surface GRP78 in total GRP78 is shown. Fig. S6. treatment of xenograft tumor leads to reduced vessel density and mtor signaling. treated A549 tumors were analyzed with CD31 antibody (A) and phosphorylated mtor (pmtor) antibody (B)s. Nuclei were counterstained with DAPI (blue). Asterisk and double asterisks indicate P < 0.02, and P < 0.001 respectively, as determined by an unpaired 2-tail student T-test. Fig. S7. shows no toxicity to normal organs in tumor xenograft study. H&E staining pictures of the major mice organs in A549 xenograft study shows no apparent toxicity Fig. S8. Inhibition of primary tumor growth and metastasis by in 4T1 orthotopic model. (A) Pictures of primary 4T1 tumor in fat pad #4 (top) and metastasis in contralateral fat pad #9 (bottom) after 7 days of treatment. Tumor is demarcated by black line and #4 pad is indicated by black arrow. (B) Pictures of primary 4T1 tumor (demarcated with white dotted line) in fat pad #4 (indicated by white arrows) and metastasis (demarcated with red dotted line) in contralateral fat pad #9 (indicated by red arrows) after 14 days of treatment. Two representative pictures were shown for each group. inhibited primary tumor growth and secondary metastasis to #9 fat pads. (C) H&E staining and immunohistochemical staining of ps6 in 4T1 primary tumors harvested from mice treated with control IgG and

on day 14. Compared to the tumor from control IgG treated mouse, tumor from treated mouse is much smaller. ps6 staining (middle panel) is also much weaker in. Quantification data are presented as mean ± SEM (n=4). Signals were quantified with Image J. Double asterisks indicate P < 0.01. Fig. S9. inhibits the growth of hormone refractory mouse prostate cancer cell CE1 in vivo. The anti-tumor activity of was tested in the xenograft tumor model of a PTEN deficient, hormone refractory mouse prostate cancer cell CE1. The study was performed as described in Figure 2A. Asterisk indicates P < 0.05, as determined by an unpaired 2-tail student T-test.

A M GRP78-His B Sample GRP78-His (10 ng) MCF7 lysate (10 ug) Blocking protein BSA GRP78-His BSA GRP78-His GRP78 Liu_FigS1 -actin 36 28 D KDa 175 78 f/f c78 f/f C 250 130 MCF7 DMSO Tg 80 58 46 30 GRP78 β-actin 35 GRP78 HSP70 E B/F 0.35 0.30 0.25 0.20 0.15 0.10 0.05 kd=1.7 nm -actin 0.00 0 200 400 600 Bound, pm

Liu_FigS2 A Clathrin DAPI /Clathrin/DAPI B EphB4 DAPI /EphB4/DAPI, 37C, 1 hour Chlorpromazine, 5 ug/ml, 37C, 1 hour Chlorpromazine, 2 ug/ml, 37C, 1 hour, 4C, 1 hour

Liu_FigS3 A PBS Ctrl IgG 1.2 Relative colony number 1.0 0.8 0.6 0.4 0.2 * 0.0 Ctrl IgG B 10 5 C 3 Ctrl IgG M30-FITC 10 4 10 3-10 3 Treatment Apoptotic cell percentage (%) 42.7 ± 5.3 Ctrl IgG 24.5 ± 4.8 0 50K 100K 150K 200K 250K FSC-A Caspase activity 2 1 0 ** ** Caspase 8 Caspase 9

A B IP Liu_FigS4 130 43 43 130 p85 GRP78 EphB2 Erk1/2 -actin 130 43 43 Sum p85 Actin GRP78 GRP78 p85 Biotin -actin Biotin 43 34

A Liu_FigS5 Whole cell lysate (5 ug) Surface protein fraction (42 ug input) Cell HT29 A549 MCF7 H249 HT29 A549 MCF7 H249 Glucose + + + + + + + + 75 GRP78 43 -actin B Surface GRP78 vs. total GRP78 (%) 10 9 8 7 6 5 4 3 2 1 6.5 8.4 7.1 8.9 4.9 9.4 1.6 4.6 0 Glucose + + + + Cell HT29 A549 MCF7 H249

A CD31 DAPI Liu_FigS6 Ctrl IgG * 0 20 CD31 Coverage (%) B pmtor (Ser2448) DAPI Ctrl IgG ** 0 50 100 pmtor positive area (%)

Ctrl IgG Liu_FigS7 Kidney Liver Heart Lung

Liu_FigS8 A 4T1, day 7, Ctrl IgG 4T1, day 7, Ctrl IgG Contralateral metastasis #9 fat pad Primary tumor #4 fat pad B 4T1 tumor in fat pads (day 14) Control Control #9 #4 #9 #4 C H&E ps6(s235/s236) ** 0 20 40 ps6 positive area (%)

Liu_FigS9 300 CE1 Tumor size (mm 3 ) 250 200 150 100 Ctrl IgG * 50 0 0 5 10 15 20 25 Days of treatment