Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental information Figure S1. Generation of the single domain antiody (sda), heavy chain antiody (HCA), and conventional immunogloulin G (IgG). Figure S2. Generation of CEACAM6-overexpressing clones of OEC-M1 cells. Figure S3. CEACAM6 does not significantly influence OSCC cell growth. Figure S4. Knockdown of CEACAM6 suppresses OSCC metastasis. Figure S5. CEACAM6 regulates actin-cytoskeleton rearrangement and cell adhesion aility. Figure S6. MGAT5 shrna suppresses L-PHA inding and CEACAM6-induced cell migration. Figure S7. Knockdown of MGAT4A does not change the molecular weight of CEACAM6 in oral squamous cell carcinoma (OSCC) cells. Figure S8. The 9A6 antiody does not recognize CEACAM6 in cultured OSCC cells Figure S9. CEACAM6 promotes OSCC cell migration through EGFR. Figure S10. TMU sda does not significantly suppress the migration aility of CEACAM6 shrna-transduced cells. Figure S11. A proposed model depicting the role of glycosylated CEACAM6 in OSCC. Figure S12. Galectin-3 (Gal-3) is involved in the CEACAM6/EGFR complex. Figure S13. The shrna target sequence and sirna sequence.
VHH VH1 VL1 CH1 CL1 VH1 VL1 CH1 CL1 VHH VHH CH2 CH2 CH3 CH3 Fc CH2 CH2 CH3 CH3 sda Conventional IgG HCA sda sda mfc2 puc57 pcdna3.1 c (kda) TMU sda (kda) TMU HCA 63 22 48 14 Figure S1. Generation of the single domain antiody (sda), heavy chain antiody (HCA), and conventional immunogloulin G (IgG). a. Schematic representations of the single domain antiody (sda), heavy chain antiody (HCA), and conventional immunogloulin G (IgG).. The TMU sda comprises variale regions of the llama HCA. It was cloned and expressed in acterial systems. The TMU sda was sucloned into a mammalian expression vector with a mouse Fc2 fragment. c. The TMU sda and HCA were expressed and purified. SDS-PAGE showed >95% purity. CH1-3: Constant domains of heavy chain; VH: Variale domains of heavy chain; Fc:fragment crystallisale region; VH: Variale domains of heavy chain; VL: Variale domain of light chain; CL: Constant region of light chain of conventional antiody. VHH: Variale domain of heavy-chain antiodies. sda: Single-domain antiody. HCA: Heavy-chain antiody
Par pcmv6 C-mix C-3 C-7 C-8 C-12 CEACAM6 -actin Figure S2. Generation of CEACAM6-overexpressing clones of OEC-M1 cells. The pcmv6- neo vector and CEACAM6 cdna (OriGen, SC118611) were transfected into OEC-M1 cells. After neomycin selection, 12 clones were selected, and the other clones were mixed (C-mix). Finally, four single clones and C-mix were grown (C-3, C-7, C-8, and C-12). A Western lot analysis showed CEACAM6 expression in parental (Par), C-mix, C-3, C-7, C-8, and C12 cells.
OEC-M1 HSC-3 Figure S3. CEACAM6 does not significantly influence OSCC cell growth. 10 4 cells were seeded in 24-well plates. Cells were incuated in DMEM supplemented with 10% FBS for different time periods. Cell numers were quantified using the MTT reagent (Sigma). Results are shown as the relative growth rate y comparing the value of O.D. at 590 nm of each group with that of pcmv6 cells (a) or sh-luc cells (). All of the experiments were performed in triplicate. Results show the mean ± SEM of three independent assays.
sh-luc sh-300 sh-luc sh-300 Figure S4. Knockdown of CEACAM6 suppresses OSCC metastasis. OEC-M1 cells were intravenously injected into SCID mice (n=8). Left panels: Representative macroscopic photograph and H&E staining of lungs. Right panels: Numers of lung metastatic nodules in individual mice were counted under a dissection microscope at 35 days after cell injection. Results are shown as the mean±sem of tumor nodules in the lungs. p < 0.05. Scale ar: 0.5cm.
pcmv6 OC-2 CEACAM6 Fironectin c Collagen Ⅰ Figure S5. CEACAM6 regulates actin-cytoskeleton rearrangement and cell adhesion aility. a. Cells were seeded and fixed on cover slides, and the F-actin structures were stained using rhodamineconjugated phalloidin and were visualized using a deconvolution microscope. The length and density of filopodia were quantified using a VoloCity software (Perkins Elmer). Results are shown as the mean ± SEM of 20 individual cells. Scale ar: 10mm., c. 1X10 5 cells were incuated with 6-cm peri-dishes coated with fironectin or collagen I for 4 h. After washed twice with PBS, the adhered cells were incuated in MTT reagent (Sigma) for 1 h. Cells were lysed in DMSO and the asorance were measured at 450nm. Results are shown as the relative adhesion aility y comparing the asorance of each group with those of pcmv6 cells.
c pcmv6 C-mix d sh-mgat5 sh-luc sh-mgat5 sh-luc (kda) CEACAM6 75 63 GAPDH Fluorescence intensity Fluorescence intensity pcmv6 C-12 Figure S6. MGAT5 shrna suppresses L-PHA inding and CEACAM6-induced cell migration. a. The mrna expression levels of MGAT5, MGAT4A, and MGAT4B in C-mix cells were examined using an RT-qPCR. The relative expression level was calculated y comparing ΔCT values of each gene to those of MGAT5, and results are shown in folds of change.. pcmv6, C-mix, and C-12 cells were infected with a lentivirus carrying sh-luc and sh- MGAT5 shrna. MGAT5 RNA expression was analyzed using an RT-qPCR. The relative expression level of MGAT5 was calculated y comparing ΔCT values of sh-mgat5 to those of sh-luc, and results are shown in folds of change. p < 0.05. c. The inding of L-PHA with pcmv6 and C-12 cells was analyzed using flow cytometry as descried in "Materials and methods". d. MGAT5 expression was silenced y sirna transfection using Lipofectamine 2000 (Invitrogen) according to the manufacturer s instructions. MGAT5 and control sirnas were synthesized y GenePharma. Sequences of MGAT5 sirna (si-mgat5) were 5 - GGCGGAAAUUCGUACAGAUTTAUCUGUACGAAUUUCCGCCTT-3 The control sirna (si-c) sequence was 5 - UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT-3. Results are shown as the relative migratory aility y comparing migrated cells of each group with that of pcmv6 transfected with control sirna (si-c).
si-c si-mgat4a (kda) CEACAM6 75 63 GAPDH Figure S7. Knockdown of MGAT4 does not change the molecular weight of CEACAM6 in oral squamous cell carcinoma (OSCC) cells. a. The MGAT4A sirna (si-mgat4, otained from Dharmacon) suppressed MGAT4A expression in C-mix cells. The relative expression level was calculated y comparing ΔCT values of each group to those of pcmv6 cells transfected with control sirna (si-c), and results are shown in folds of change.. C-mix cells were transfected with MGAT4A sirna and the molecular weight of CEACAM6 was measured using Western lotting with TMU HCA.
9A6 A pcmv6 9A6 A C-mix pcmv6 C-mix N104Q N197Q N256Q (kda) (kda) sh-luc sh-300 sh-302 sh-luc sh-300 sh-302 100 75 75 -actin GAPDH Figure S8. The 9A6 antiody cannot specifically recognize the glycosylated CEACAM6 in cultured OSCC cells. a. Cell lysates of pcmv6, C-mix, N104Q, N197Q, and N256Q cells were collected for Western lotting with the 9A6 antiody.. pcmv6 and C-mix cells were infected with a lentivirus carrying luciferase (sh-luc) and CEACAM6 (sh-300 and sh-302) shrnas. Although the 9A6 antiody recognized a 75-kD and, it was postulated a non-specific inding ecause The 9A6 A did not detect a decreased expression of the 75-kD and in sh-300 and sh-302 cells compared with sh-luc cells.
Gefitini p-egfr pcmv6 C-mix - + - + EGFR N.S. N.S. c EGF (10ng/ml) pcmv6 C-mix Gefitini (5mM) C-12-shLuc C-12-sh298 C-12-sh300 0 10 20 30 40 60 0 10 20 30 40 60 0 10 20 30 40 60 (min) p-erk1/2 p-akt T-Erk1/2 T-Akt d e IP: CEACAM6 10% input a-egfr a-ceacam6 (TMU HCA) Figure S9. CEACAM6 promotes OSCC cell migration through EGFR. (a) EGFR expression was silenced y sirna transfection using Lipofectamine 2000 (Invitrogen) according to the manufacturer s instructions. EGFR and control sirnas were synthesized y GenePharma. Results are shown as the relative migratory aility y comparing migrated cells of each group with that of pcmv6 transfected with control sirna (si-c). () The EGFR kinase activities were required for CEACAM6-enhanced cell migration. OEC-M1 cells were pretreated with gefitini (5 µm) for 48 h. The migratory aility was susequently measured. Results are shown as the relative migratory aility y comparing migrated cells of each group with that of pcmv6 cells without gefitini treatment. (c) Knockdown of CEACAM6 inhiits EGF-induced cell signaling. Cells were infected with a lentivirus carrying luciferase shrna (sh-luc) or CEACAM6 shrna (sh-298 and 300). Cells were treated with EGF (10 ng/ml) for 10 min, and the activation of Akt and ERK1/2 was analyzed y Western lotting. (d) Inhiition of ERK1/2 and Akt activation suppresses CEACAM6-enhanced cell migration. C-12 cells were pretreated with U0126 or wortmannin for 30 min to lock ERK1/2 and Akt activation. The migratory aility was measured in the presence of the EGF (1 ng/ml). Results are shown as the relative migratory aility y comparing migrated cells of each group with those of pcmv6 cells treated with DMSO. p < 0.05. N.S. No significant difference. (e) MGAT5-silencing and N256Q cells had reduced CEACAM6/EGFR interactions compared with C-mix cells.
N.S. TMU sda Figure S10. TMU sda does not significantly suppress the migration aility of CEACAM6 shrna-transduced cells. C-mix cells were infected with lentivirus carrying CEACAM6 shrna (sh-300). The sh-300 transduced cells were treated with or without TMU sda and the migration aility was measured. Results are shown as the relative migratory ailities y comparing the numer of migrated cells of each group with those of cells without TMU sda treatment. N.S. No significant difference.
Figure S11. A proposed model depicting the role of glycosylated CEACAM6 in OSCC. Both EGFR and CEACAM6 are decorated with ranching poly-lacnac which can e recognized y galectin-3 (Gal-3). Therefore, CEACAM6 and EGFR could e co-clustered y Gal-3 pentamer in micro-domains of cell memrane (lipid-rafts) which enhances the activation of EGFR, ERK1/2 and Akt upon EGF stimulation.
c IP: CEACAM6 10% input Gal-3 shrna a-egfr IP: CEACAM6 10% input - + - + a-egfr a-ceacam6 (TMU HCA) a-ceacam6 (TMU HCA) a-gal-3 a-gal-3 p-erk1/2 sh-luc sh-gal-3 0 5 10 20 30 0 5 10 20 30 (min) p-akt ERK1/2 a-gal-3 Akt Figure S12. Galectin-3 (Gal-3) is involved in the CEACAM6/EGFR complex. a. The immunoprecipitation showed that knockdown of Gal-3 reduces the interactions of CEACAM6 and EGFR.. Knockdown of Gal-3 suppresses CEACAM6-enhanced EGFR signaling. C-mix cells infected with a lentivirus carrying luciferase and Gal-3 shrna. Cells were treated with EGF for different time periods, and activation of ERK1/2 and Akt was detected. Notaly, knockdown of Gal-3 significantly reduced the ERK1/2 and Akt activation at the 30 min after EGF stimulation. c. The full-length lots of fig. S12a.
Gene name shrna target sequence (5'-3') CCCAGAATCGTATTGGTTACA (sh-298) CEACAM6 CCAGAATGACACAGGATTCTA (sh-300) CCTGCACAGTACTCTTGGTTT (sh-302) MGAT5 EGFR CCTACGAAGAAGCTGATCATA GCTGGATGATAGACGCAGATA Gene name MGAT5 EGFR sirna sequence (5'-3') GGCGGAAAUUCGUACAGAUTTAUCUGUAC GAAUUUCCGCCTT AAAUCCAGACUCUUUCGAU Figure S13. The shrna target sequence and sirna sequence.