Nucleic Acid Amplification Assays for Detection of La Crosse Virus RNA

Transcription

1 JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2005, p Vol. 43, No /05/$ doi: /jcm Nucleic Acid Amplification Assays for Detection of La Crosse Virus RNA Amy J. Lambert,* Roger S. Nasci, Bruce C. Cropp, Denise A. Martin, Becky C. Rose, Brandy J. Russell, and Robert S. Lanciotti Division of Vector-Borne Infectious Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Public Health Service, U.S. Department of Health and Human Services, Fort Collins, Colorado Received 23 September 2004/Returned for modification 22 October 2004/Accepted 20 December 2004 We report the development of nucleic acid sequence-based amplification (NASBA) and quantitative real-time reverse transcription (RT)-PCR assays for the detection of La Crosse (LAC) virus in field-collected vector mosquito samples and human clinical samples. The sensitivities of these assays were compared to that of a standard plaque assay in Vero cells. The NASBA and quantitative real-time RT-PCR assays demonstrated sensitivities greater than that of the standard plaque assay. The specificities of these assays were determined by testing a battery of reference strain viruses, including representative strains of LAC virus and other arthropod-borne viruses. Additionally, these assays were used to detect LAC viral RNA in mosquito pool samples and human brain tissue samples and yielded results within less than 4 h. The NASBA and quantitative real-time RT-PCR assays detect LAC viral RNA in a sensitive, specific, and rapid manner; these findings support the use of these assays in surveillance and diagnostic laboratory systems. * Corresponding author. Mailing address: Division of Vector-Borne Infectious Diseases, National Centers for Infectious Diseases, CDC, Rampart Rd., Fort Collins, CO Phone: (970) Fax: (970) ahk7@cdc.gov. Historically, La Crosse (LAC) virus has been the primary cause of pediatric arthropod-borne viral (arboviral) encephalitis in the midwestern and eastern United States (2, 17). With the introduction of West Nile (WN) virus to the Western Hemisphere, recent data indicate that both LAC and WN viruses are now responsible for the vast majority of pediatric arboviral encephalitis cases in the United States (7). LAC virus is a member of the family Bunyaviridae, genus Bunyavirus (3, 18). Members of the family Bunyaviridae have a spherical, enveloped virion that is 90 to 100 nm in diameter and possess a genome of three negative-stranded RNA segments (large, medium, and small) (3, 18). LAC virus is endemic to forested regions along the basins of the Mississippi and the Ohio rivers, which provide a habitat for its primary mosquito vector, Aedes triseriatus (1, 2, 3, 6, 16). The mechanism of LAC virus persistence and propagation in nature is complex, involving transovarial, venereal, and horizontal modes of transmission (2, 16). Amplifying hosts include small mammals that develop levels of viremia sufficient for transmission of virus to mosquitoes during the summer months. Human infection occurs during the summer and early fall, when there is the greatest risk of being bitten by a mosquito. Surveillance of arboviruses is typically achieved by testing field-collected vector mosquitoes. Derived arboviral infection rates are used to assess the risk of transmission to susceptible populations. Traditionally, the laboratory component of arboviral surveillance and human diagnostic laboratory systems has included the detection of viruses by isolation in cell culture and suckling mouse brain followed by immunofluorescence assays for identification. While these methods are sensitive and reliable, they are also time-consuming, labor-intensive, and able to be performed only in laboratories with live virus assay capabilities. The highly sensitive, specific, and rapid nature of nucleic acid amplification assays provides a powerful alternative to standard methods of detecting viruses. Over the past decade, many such assays have been developed for the detection of arboviruses (4, 5, 8, 10, 11, 12, 13, 14, 19, 20). The nucleic acid sequence-based amplification (NASBA) and quantitative realtime reverse transcription (RT)-PCR assays provide two novel platforms for the detection of LAC viral RNA from mosquito pool samples and human tissue samples. MATERIALS AND METHODS Viruses. The viruses used in this study were provided by the Arbovirus Diseases Branch of the Division of Vector-Borne Infectious Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention (CDC), where a World Health Organization reference collection of arboviruses is maintained. For sensitivity testing, a LAC virus (strain Original) was titrated in Vero cells by a standard plaque assay. Mosquito pool samples and clinical samples. Mosquito pool samples, collected and tested as part of collaborative arboviral surveillance programs at county, state, and federal laboratories, were processed as previously described (13). Human central nervous system (CNS) tissues were submitted to the CDC molecular diagnostic laboratory after a LAC virus infection was inferred by testing at another laboratory. Human tissues were homogenized in Ten Broeck grinders with 1 ml of BA-1 diluent. Mosquito pool and tissue homogenates were clarified by centrifugation at 20,000 g for 3 min, and the resultant supernatants were subjected to RNA extraction. RNA extraction. Viral RNA was extracted from mosquito pool and human tissue homogenate supernatants, processed as described above, as well as from virus seed with the QIAamp viral RNA mini kit (QIAGEN, Valencia, Calif.), according to the manufacturer s instructions. Extractions were performed on samples ranging in volume from 70 to 140 l; RNA was eluted in a volume equal to the volume of the starting sample. Eluted RNA was stored at 70 C until used. Two BA-1-negative extraction controls were processed along with each group of samples subjected to RNA extraction. NASBA assay. NASBA assays were performed with 5 l of extracted RNA and 50 pmol of each primer by use of the NucliSens basic kit (biomerieux, Durham, 1885

2 1886 LAMBERT ET AL. J. CLIN. MICROBIOL. LAC primer b TABLE 1. Oglionucletide primers and probes for LAC NASBA a and quantitative real-time RT-PCR assays M segment coding location Sequence (5 3 ) Product size (bp) NASBA LAC gatgcaaggtcgcatatgagctgcaagcccagtgtatcaaa 189 LAC 284c aattctaatacgactcactatagggagaaggcagagacgagccatttcctta LAC 197 probe AGCATGATCAAAACAGAGGCCAGGT Quantitative real-time RT-PCR LAC TATAAAAGCCTAAGAGCTGCCAGAGT 83 LAC 1018c GACCAGTACTGCAGTAATTATAGACAAT LAC 963 probe TGTGCAAGTCGAAAGGGCCTGCA a NASBA forward primers have a 5 ECL sequence (lowercase, roman letters); reverse primers have a T7 promoter sequence (lowercase, italic letters). b Primers are named according to their LAC genome M segment target nucleotide position. Reverse primers are labeled with c. N.C.). For detection, the NASBA enhanced-chemiluminescence (ECL) format was used as previously described (14). Sample results were determined by the NucliSens reader as previously described (biomerieux) (14). A minimum of two negative amplification controls containing 5 l of RNase- and DNase-free water, instead of extracted RNA, were included with each group of samples processed. Quantitative real-time RT-PCR. Quantitative real-time RT-PCR assays were performed with 5 l of extracted RNA, 50 pmol of each primer, and 10 pmol of probe in a total volume of 50 l by use of the Quantitect probe RT-PCR kit (QIAGEN) according to manufacturer s instructions. Amplification and fluorescence detection were performed on the icycler (Bio-Rad Laboratories, Hercules, Calif.). Forty-five cycles of amplification were performed according to the manufacturer s recommendations for quantitative real-time RT-PCR cycling conditions. Positive results were determined according to the amplification cycle at which fluorescence increased above the threshold value set at 50 relative fluorescence units by use of the PCR baseline-subtracted curve fit analysis mode (threshold cycle [C T ]). A sample was determined to be positive if the C T value was A minimum of eight negative amplification controls containing RNase- and DNase-free water, instead of extracted RNA, were included with each group of samples processed. Primer design. LAC virus primers and/or probes were designed with the published sequence of the LAC virus strain Human/78 (GenBank accession number NC004109). LAC virus quantitative real-time RT-PCR primers and probes were designed with the PrimerExpress software package (PE Applied Biosystems, Foster City, Calif.). PrimerExpress-derived quantitative real-time RT-PCR primer pairs and probes were compared to an alignment of seven LAC virus sequences and one Jamestown Canyon virus sequence; primer pairs and probes that demonstrated maximum homology to all LAC virus strains M segment polyprotein genes were selected (Table 1). The LAC quantitative real-time RT-PCR probes were labeled at the 5 end with the 6-carboxyfluorescein reporter dye and labeled at the 3 end with the quencher molecule BHQ1. LAC NASBA primers and probes were designed by following the primer design guidelines described in the NucliSens basic kit application manual (biomerieux). The NASBA reverse primers incorporate the T7 promoter sequence at the 5 end of the primer, and the forward primers contain a generic capture sequence complementary to the ruthenium-labeled detection probe (generic ECL probe) at the 5 end of the primer (Table 1). The NASBA-ECL virus-specific capture probes were 5 biotin labeled and immobilized onto avidin-coated magnetic particles by following the protocol described in the NucliSens basic kit application manual. Vero cell culture. Vero cell culture 25-cm 2 flasks were inoculated with 100- l volumes of mosquito pool or human tissue homogenate supernatants. Inoculated flasks were incubated at 37 C in 5% CO 2 for 10 days and reviewed for signs of cytopathic effect. Positive results were determined by the presence of cytopathic effect and were confirmed by quantitative real-time RT-PCR assays. RESULTS Comparison of NASBA and quantitative real-time RT-PCR sensitivities. To evaluate the sensitivities of the NASBA and quantitative real-time RT-PCR assays, dilutions of previously titrated LAC virus (strain Original) were tested (Table 2). Both the NASBA and the quantitative real-time RT-PCR assays were more sensitive than the standard plaque assay in Vero cells, detecting and PFU eq of virus, respectively (Table 2). Comparison of NASBA and quantitative real-time RT-PCR specificities. To determine the specificities of NASBA and quantitative real-time RT-PCR assays, seven isolates of LAC virus were tested (Table 2). In addition, we tested related California serogroup viruses (California encephalitis, Guaroa, Inkoo, Jamestown Canyon, snowshoe hare, Keystone, Tahyna, and Cache Valley viruses) and unrelated arboviruses (WN, St. Louis encephalitis, Powassan, eastern equine encephalitis, and western equine encephalitis) that circulate in areas of known LAC virus transmission (Table 2). Both the NASBA and the quantitative real-time RT-PCR assays detected LAC viral RNAs extracted from all strains of LAC virus represented in Table 2, with no other related or unrelated arboviruses generating positive results (Table 2). Detection of LAC viral RNA in mosquito pool samples. A panel of 17 mosquito pool samples was tested by the isolation of virus from Vero cells, as well as by NASBA and quantitative real-time RT-PCR assays for the presence of LAC viral RNA. Thirteen of 17 samples were positive by the isolation of virus from Vero cell culture (Table 3). LAC viral RNA was detected in all Vero cell culture-positive pool samples by both the NASBA and the quantitative real-time RT-PCR assays (Table 3). Detection of LAC viral RNA in human tissues. A panel of 10 human tissues, including tissues from a presumptive LAC virus fatal case, was tested by the isolation of virus in Vero cells, as well as by NASBA and quantitative real-time RT-PCR assays for the presence of LAC viral RNA. None of the samples tested was positive by isolation of virus in Vero cell culture (Table 3). LAC viral RNA was detected in 4 of 10 human tissues by NASBA (Table 3). LAC viral RNA was detected in 6 out of 10 human tissues by quantitative real-time RT-PCR (Table 3). DISCUSSION This report describes the development and application of NASBA and quantitative real-time RT-PCR assays for the detection of LAC viral RNA. These assays provide enhanced sensitivities compared to that of the standard plaque assay in Vero cells, with the quantitative real-time RT-PCR assay demonstrating the most sensitive detection of 0.01 PFU of LAC virus (Table 2). In addition, these assays have demonstrated

3 VOL. 43, 2005 LAC VIRUS NASBA, QUANTITATIVE REAL-TIME RT-PCR ASSAYS 1887 TABLE 2. Sensitivities and specificities of LAC NASBA, quantitative real-time RT-PCR, and standard plaque assays a Sample Standard plaque assay quantity (PFU) absolute specificity, detecting all temporally and geographically diverse LAC viral RNAs tested, with no related or unrelated arboviral RNAs detected (Table 2). Primarily since the introduction of WN virus to the United States, nucleic acid amplification assays have become more routinely used as methods of detecting arboviral RNAs for surveillance purposes. In the testing of field-collected vector mosquitoes, the NASBA and quantitative real-time RT-PCR assays have demonstrated highly sensitive detection of LAC viral RNA, generating positive results from all 13 Vero cell culture-positive pool samples (Table 3). These results indicate the utility of the LAC nucleic acid amplification assays if used in addition to a surveillance laboratory s existing battery of assays. With regard to human tissue testing, both the NASBA and quantitative real-time RT-PCR assays were shown to be more sensitive than the isolation of virus in Vero cells, detecting LAC viral RNA in multiple postmortem CNS tissues from which no virus was isolated (Table 3). These data indicate that perhaps the most significant application of the LAC nucleic acid amplification assays is in the human diagnostic laboratory. NASBA b Quantitative c realtime RT-PCR ECL Int. C T Int. Titrated LAC viruses (strain Original) LAC-1 17,500 1,758,472 POS 12.5 POS LAC-2 1, ,268 POS 15.2 POS LAC ,270,068 POS 17.9 POS LAC ,885 POS 22.3 POS LAC ,891 POS 26.4 POS LAC ,331 POS 30.1 POS LAC ,032 POS 33.2 POS LAC NEG 37.5 POS LAC NEG 40.3 NEG LAC NEG NA NEG LAC virus strains LAC, Wisconsin, 1960 (strain Original) ND 2,749,942 POS 9.8 POS LAC, North Carolina, 1978 ND 24,096 POS 10.1 POS LAC, Minnesota, 1978 ND 2,668,199 POS 13.1 POS LAC, Georgia, 1990 ND 1,433,770 POS 22.8 POS LAC, West Virginia, 1996 ND 859,752 POS 16.8 POS LAC, West Virginia, 1997 ND 658,709 POS 19.4 POS LAC, North Carolina, 2000 ND 787,790 POS 20.7 POS Other viruses Califonia encephalitis virus ND 197 NEG NA NEG Guaroa virus ND 164 NEG NA NEG Inkoo virus ND 146 NEG NA NEG Jamestown Canyon virus ND 113 NEG NA NEG Snowshoe hare virus ND 276 NEG NA NEG Keystone virus ND 128 NEG NA NEG Tahyna virus ND 153 NEG NA NEG Cache Valley virus ND 164 NEG NA NEG WN virus ND 98 NEG NA NEG St. Louis encephalitis virus ND 141 NEG NA NEG Powassan virus ND 123 NEG NA NEG Eastern equine encephalitis virus ND 111 NEG NA NEG Western equine encephalitis virus ND 73 NEG NA NEG a Abbreviations: POS, positive; NEG, negative; NA, no amplification; ND, not determined; Int., interpretation. b NASBA-ECL units of 300 are interpreted as positive. c Quantitative real-time RT-PCR C T values of 38.5 are interpreted as positive. The effectiveness of ribaviran therapy in the treatment of LAC viral encephalitis further emphasizes the critical need for fast and accurate laboratory results (5, 15). The LAC nucleic acid amplification assays offer exceptional rapidity and unprecedented sensitivities in the detection of LAC viral RNA. The LAC nucleic acid amplification assays have not been applied to human fluid samples. However, the ability of these assays to detect LAC viral RNA in CNS tissues indicates their potential usefulness for the detection of target analyte in cerebrospinal fluid (CSF). Additional investigation is warranted to determine the effectiveness of the LAC nucleic acid amplification assays when applied to acute-phase human serum and CSF samples from patients with serologically confirmed cases of LAC virus infection. In response to the introduction of WN virus to the Western Hemisphere, nucleic acid amplification assays comparable to those presented here were developed for the detection of WN viral RNA from predominantly fieldcollected mosquito samples (13, 14). Since their development, these assays have become routinely used for the detection of WN viral RNA in human serum and CSF samples from patients with acute WN virus infection. This evolution in assay

4 1888 LAMBERT ET AL. J. CLIN. MICROBIOL. TABLE 3. Detection of LAC virus in mosquito pools and human tissues by NASBA, quantitative real-time RT-PCR, and Vero cell culture assays a Sample Vero cell culture NASBA b Quantitative c realtime RT-PCR ECL units Int. C T Int. Method(s) used for detection of LAC virus infection d Field-collected mosquitoes Mosquito pool, West Virginia, 1996a POS 752,593 POS 20.1 POS Molecular Mosquito pool, West Virginia, 1996b POS 34,839 POS 25 POS Molecular Mosquito pool, West Virginia, 1996c POS 313 POS 35.1 POS Molecular Mosquito pool, West Virginia, 1996d POS 30,119 POS 36.3 POS Molecular Mosquito pool, West Virginia, 1996e POS 38,820 POS 36.5 POS Molecular Mosquito pool, West Virginia, 1997a POS 1,226,649 POS 30.4 POS Molecular Mosquito pool, West Virginia, 1997b POS 1,114,538 POS 27.9 POS Molecular Mosquito pool, West Virginia, 1997c POS 341,999 POS 20.4 POS Molecular Mosquito pool, West Virginia, 1997d POS 384,340 POS 17.1 POS Molecular Mosquito pool, West Virginia, 1997e POS 360,421 POS 19.8 POS Molecular Mosquito pool, West Virginia, 1997f POS 337,988 POS 14.8 POS Molecular Mosquito pool, West Virginia, 1997g POS 6,556,784 POS 17.3 POS Molecular Mosquito pool, West Virginia, 1997h POS 408,804 POS 20.2 POS Molecular Negative mosquito pool 1 NEG 202 NEG NA NEG NA Negative mosquito pool 2 NEG 203 NEG NA NEG NA Negative mosquito pool 3 NEG 244 NEG NA NEG NA Negative mosquito pool 4 NEG 168 NEG NA NEG NA Human tissues e Medulla, f North Carolina, 2000 NEG 145 NEG 32.6 POS Serology Medulla, g North Carolina, 2000 NEG 206 NEG NA NEG Serology Temporal lobe, North Carolina, 2000 NEG 244,988 POS 31 POS Serology Frontal lobe, f North Carolina, 2000 NEG 1,820,475 POS 19.2 POS Serology Frontal lobe, g North Carolina, 2000 NEG 1,153,764 POS 27.8 POS Serology Spinal cord, f North Carolina, 2000 NEG 59,156 POS 33.6 POS Serology Spinal cord, g North Carolina, 2000 NEG 159 NEG 29.7 POS Serology Negative CNS tissue 1 NEG 266 NEG NA NEG NA Negative CNS tissue 2 NEG 238 NEG NA NEG NA Negative CNS tissue 3 NEG 224 NEG NA NEG NA a Abbreviations: POS, positive; NEG, negative; NA, not applicable; Int., interpretation. b NASBA-ECL units of 300 are interpreted as positive. c Quantitative real-time RT-PCR C T values of 38.5 are interpreted as positive. d Samples tested at the CDC molecular diagnostic laboratory after LAC virus infection was inferred by testing at another laboratory. e North Carolina human tissues from a 2000 fatal case are described as they were labeled by the submitting laboratory; multiple preparations of some tissues were received and tested at the CDC molecular laboratory. LAC virus infection was inferred by serological testing of an acute-phase serum sample submitted with tissues from this patient (day 4 postonset sample with an immunoglobulin M endpoint titer of 1/12,800 and a plaque reduction neutralization test titer of 1/320). f Sample 1. g Sample 2. application further illustrates the possible contribution of the LAC NASBA and quantitative real-time RT-PCR assays in the field of human diagnostics. In the development of the quantitative real-time RT-PCR assay, several primer-probe sets were evaluated. Each primerprobe set was designed to target a unique nucleotide sequence of the LAC viral genome. The quantitative real-time RT-PCR primer-probe set presented here demonstrated highly effective detection of a broad spectrum of LAC-positive samples (Tables 2 and 3). However, the other primer-probe sets that we evaluated were able to detect only some of the LAC-positive samples in Tables 2 and 3 (data not included). This observation may indicate that target nucleotide sequence heterogeneity prevented the detection of all LAC viral RNAs by each primerprobe set. Recent studies have shown similarities in the nucleotide sequences of LAC viral RNAs isolated from two separate humans with fatal cases (5, 9). However, there is little or no nucleotide sequence data for many isolates of LAC virus, and this lack of data limited primer-probe design in this study (see Materials and Methods). Nucleotide sequencing of additional isolates would facilitate a more comprehensive understanding of the genetic stability of LAC virus for the purposes of diagnosis and research. The LAC NASBA and quantitative real-time RT-PCR assays were developed to enhance arboviral surveillance and human diagnostic testing. Compared to traditional live-virus assays, these nucleic acid amplification assays provide an advantageous combination of sensitivity, specificity, and rapidity. In addition, the assays presented here have been shown to have consistent sensitivities when multiple preparations of LAC viral dilutions were tested, indicating the reproducibility of the results of these assays (data not included). In dealing with nucleic acid amplification assay-positive live virus assay-negative results, the concern arises that these results may be due to contamination rather than to evidence of infection (Table 3). In this study, negative controls were used at both the RNA extraction and amplification levels to reduce the likelihood that such results are due to contamination (see Materials and Methods). In addition, the pre- and postamplification steps were physically separated. Under ideal circumstances, a labo-

5 VOL. 43, 2005 LAC VIRUS NASBA, QUANTITATIVE REAL-TIME RT-PCR ASSAYS 1889 ratory could utilize both the LAC NASBA and the quantitative real-time RT-PCR assays in critical diagnostic situations. Running these assays simultaneously would allow for confirmation of results from two unique amplification formats between which contamination is unlikely. ACKNOWLEDGMENTS We thank Katherine Wolff (CDC) for the production of viruses used in this study, the North Carolina State Laboratory of Public Health for providing samples for testing, and Barbara W. Johnson for editorial advice. REFERENCES 1. Beaty, B. J., and C. H. Calisher Bunyaviridae natural history. Curr. Top. Microbiol. Immunol. 169: Calisher, C. H Medically important arboviruses of the United States and Canada. Clin. Microbiol. Rev. 7: Calisher, C. H Taxonomy, classification, and geographic distribution of California serogroup bunyaviruses. A. R. Liss, New York, N.Y. 4. Campbell, W. P., and C. Huang Detection of California serogroup viruses using universal primers and reverse transcription-polymerase chain reaction. J. Virol. Methods 53: Chandler, L. J., M. K. Borucki, D. K. Dobie, L. P. Wasieloski, W. H. Thompson, C. B. Gunderson, K. Case, and B. J. Beaty Characterization of La Crosse virus RNA in autopsied central nervous system tissues. J. Clin. Microbiol. 36: Grimstad, P. R California group virus disease, p In T. P. Monath (ed.), The arboviruses: epidemiology and ecology, vol. II. CRC Press, Boca Raton, Fla. 7. Hayes, E. B Personal communication. 8. Huang, C., B. Slater, W. Campbell, J. Howard, and D. White Detection of arboviral RNA directly from mosquito homogenates by reversetranscription polymerase chain reaction. J. Virol. Methods 94: Huang, C., W. H. Thompson, N. Karabatsos, L. Grady, and W. P. Campbell Evidence that fatal human infections with La Crosse virus may be associated with a narrow range of genotypes. Virus Res. 48: Kuno, G., C. J. Mitchell, G.-J. J. Chang, and G. C. Smith Detecting bunyaviruses of the Bunyamwera and California serogroups by a PCR technique. J. Clin. Microbiol. 34: Lambert, A. J., D. A. Martin, and R. S. Lanciotti Detection of North American eastern and western equine encephalitis viruses by nucleic acid amplification assays. J. Clin. Microbiol. 41: Lanciotti, R. S Molecular amplification assays for the detection of flaviviruses. Adv. Virus Res. 61: Lanciotti, R. S., A. J. Kerst, R. S. Nasci, M. S. Godsey, C. J. Mitchell, H. M. Savage, N. Komar, N. A. Panella, B. C. Allen, K. E. Volpe, B. S. Davis, and J. T. Roehrig Rapid detection of West Nile virus from human clinical specimens, field-collected mosquitoes, and avian samples by a TaqMan reverse transcriptase-pcr assay. J. Clin. Microbiol. 38: Lanciotti, R. S., and A. J. Kerst Nucleic acid sequence-based amplification assays for rapid detection of West Nile and St. Louis encephalitis viruses. J. Clin. Microbiol. 39: McJunkin, J. E., R. Khan, E. C. de los Reyes, D. L. Parsons, L. L. Minnich, R. G. Ashley, and T. F. Tsai Treatment of severe La Crosse encephalitis with intravenous ribavirin following diagnosis by brain biopsy. Pediatrics 99: McJunkin, J. E., R. R. Khan, and T. F. Tsai California-La Crosse encephalitis. Infect. Dis. Clin. N. Am. 1: Tsai, T. F Arboviral infections the United States. Infect. Dis. Clin. N. Am. 5: van Regenmortel, M. H., C. M. Fauquet, D. H. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeogh, C. R. Pringle, and R. B. Wickner (ed.) Virus taxonomy. Classification and nomenclature of viruses. Seventh report of the International Committee on Taxonomy of Viruses. Academic Press, Inc., San Diego, Calif. 19. Vodkin, M. H., T. Streit, C. J. Mitchell, G. L. McLaughlin, and R. J. Novak PCR-based detection of arboviral RNA from mosquitoes homogenized in detergent. BioTechniques 17: Wasieloski, L. P., Jr., A. Rayms-Keller, L. A. Curtis, C. D. Blair, and B. J. Beaty Reverse transcription-pcr detection of LaCrosse virus in mosquitoes and comparison with enzyme immunoassay and virus isolation. J. Clin. Microbiol. 32: Downloaded from on November 14, 2018 by guest