Induction and modulation of cellular and humoral immune responses against HIV-1 by immunization with DNA and virus-like particle vaccines

Transcription

1 Induction and modulation of cellular and humoral immune responses against HIV-1 by immunization with DNA and virus-like particle vaccines Dissertation submitted to the Graduate School of Chemistry and Biochemistry for the Degree of Doctor of Natural Sciences (Dr. rer. nat.) by Michael Storcksdieck genannt Bonsmann, M. Sc. prepared at the Department for Molecular and Medical Virology, Institute for Hygiene and Microbiology, Ruhr-University Bochum Head of the Department: Prof. Dr. K. Überla Bochum,

2 "Yet another terrible disease is about to yield to patience, persistence and outright genius." Margaret Heckler Secretary of Health and Human Services with regard to the discovery of HIV

3 Table of contents Table of contents TABLE OF CONTENTS TABLE OF ABBREVIATIONS TABLE OF FIGURES I III V SUMMARY 1 1 INTRODUCTION HIV-1/AIDS STRUCTURE AND DIVERSITY INFECTION AND PATHOGENESIS IMMUNE RESPONSE TO INFECTION HIV-1 VACCINE DEVELOPMENT LIMITED SUCCESS OF CLINICAL TRIALS ALTERNATIVE STRATEGIES UNDER PRE-CLINICAL DEVELOPMENT AIMS OF THE STUDY 17 2 MATERIALS AND METHODS MATERIALS CHEMICALS AND REAGENTS CONSUMABLES INSTRUMENTS NUCLEIC ACIDS Plasmids Oligonucleotides STANDARDS PEPTIDES ANTIBODIES ENZYMES KITS BUFFERS AND MEDIA Buffers and media for molecular biological methods Buffers and media for protein biochemical methods Buffers and media for cytological methods Buffers and media for immunological methods BACTERIA EUKARYOTIC CELL LINES ANIMALS METHODS MOLECULAR BIOLOGICAL METHODS Isolation of plasmid DNA Determination of DNA concentrations Digestion of DNA with restriction enzymes Agarose gel electrophoresis Gel extraction of DNA fragments Polymerase chain reaction (PCR) Ligation of DNA fragments Transformation of bacteria DNA isolation from lung tissue RNA isolation from eukaryotic cells Reverse transcription 40 I

4 Table of contents Quantitative PCR (qpcr) PROTEIN BIOCHEMICAL METHODS SDS-polyacrylamide gel electrophoresis (SDS-PAGE) Coomassie staining of polyacrylamide gels Western immunoblotting Expression and purification of GST-Gag Expression and purification of gp Determination of protein concentrations CYTOLOGICAL METHODS Cultivation of cell lines Transfection of cells Transduction of cells Preparation of virus-like particles IMMUNOLOGICAL METHODS Cytokine-specific ELISA Immunization of mice Collection of sera and PBMCs Preparation of lymphocytes In vitro re-stimulation of lymphocytes Intracellular cytokine staining Surface staining of cells Isolation of CD4 + T cells and adoptive transfer Antigen-specific antibody ELISA Immunoprecipitation Fcγ receptor activation assay 53 3 RESULTS PRODUCTION OF HIV-1 ENV AND GAG ANTIGENS FOR ELISA DNA IMMUNIZATION APPROACHES HUMORAL IMMUNE RESPONSES TO A COMBINED HIV-1 GAG AND ENV DNA VACCINE CO-APPLICATION OF CYTOKINE EXPRESSING PLASMIDS TO MODULATE THE IMMUNE RESPONSE IMMUNIZATION APPROACHES BASED ON INTRASTRUCTURAL HELP VIRUS-LIKE PARTICLE PREPARATION AND CHARACTERIZATION ANALYSIS OF INTRASTRUCTURAL HELP IN THE CONTEXT OF HIV COMPARISON OF INTRASTRUCTURAL HELP VS. DIRECT PRIMING VERIFICATION OF THE INTRASTRUCTURAL HELP MECHANISM INTRASTRUCTURAL HELP FOR GAG-SPECIFIC B CELLS? IMPACT OF ISH ON THE FCγ-EFFECTOR FUNCTIONALITY OF ENV-SPECIFIC ANTIBODIES CO-APPLICATION OF CYTOKINE EXPRESSING PLASMIDS TO MODULATE ISH 89 4 DISCUSSION 98 5 BIBLIOGRAPHY PUBLICATIONS RESEARCH ARTICLE REVIEWS ORAL PRESENTATIONS POSTER PRESENTATIONS CURRICULUM VITAE ACKNOWLEDGEMENTS 138 II

5 Table of abbreviations Table of abbreviations % per cent C degrees Celsius 7-AAD 7-actinoaminomycin D AA amino acid Ad adeno ADCC antibody dependent cell mediated cytotoxicity ADCVI antibody dependent cell mediated viral inhibition AIDS acquired immunodeficiency syndrome Amp ampicillin ANOVA analysis of variance APC antigen presenting cell APC allophycocyanine ATP adenosine triphosphate BCR B cell receptor bnab broadly neutralizing antibody bp base pair BSA bovine serum albumin CCR5 C-C chemokine receptor type 5 CD cluster of differentiation CMV cytomegalovirus CTL cytotoxic T lymphocyte CXCR4 C-X-C chemokine receptor type 4 Cy7 cyanine 7 D Dalton DC dendritic cell DMEM Dulbecco's modified Eagle's medium DMSO dimethyl sulfoxide DNA deoxyribonucleic acid dntp deoxyribonucleic triphosphate E. coli Escherichia coli ECL enhanced chemiluminescence EDTA ethylenediaminetetraacetic acid ELISA enzyme linked immunosorbent assay Env envelope et al and other (et alii) FACS fluorescence activated cell sorting Fc fragment crystallizable FCS fetal calf serum FITC fluorescein isothiocyanate FSC front scatter g gram g acceleration of gravity Gag group antigen GALT gut associated lymphoid tissue GFP green fluorescing protein gp glycoprotein GSH glutathione GST glutathione S transferase h hour HBSS Hank's buffered salt solution HEPES 4-(2- hydroxyethyl)piperazine-1- ethanesulfonic acid HIV human immunodeficiency virus HLA human leukocyte antigen HRP horseradish peroxidase HSV herpes simplex virus HTLV human T cell lymphotrophic virus i.d. intradermal i.m. intramuscular i.p. intraperitoneal i.v. intravenous ICS intracellular cytokine staining IFN interferon Ig immunoglobulin IL interleukin IPTG isopropyl β-d-1- thiogalactopyranoside ISH intrastructural help ITAM immunoreceptor tyrosinebased activation motif ITIM immunoreceptor tyrosinebased inhibition motif ITR inverted terminal repeat k kilo Kan kanamycine kb kilobases l liter III

6 Table of abbreviations LB LLA LPS LTR m m m MCS MHC min MLV MPER MVA n nc Nef NK NTA NYVAC OD ori Ova p p.i. PAGE PBS PCR PE PEI PerCP Pol q r rh RNA rpm RPMI RSV RT RT s.c. SDS lysogeny broth lentil lectin agarose lipopolysaccharide long terminal repeat milli murine meter multiple cloning site major histocompatibility complex minutes murine leukemia virus membrane proximal external region modified vaccinia virus Ankara nano not considered negative regulatory factor natural killer nitrilotriacetic acid New York vaccinia virus optical density origin of replication ovalbumin pico post infection polyacrylamide gel electrophoresis phosphate buffered saline polymerase chain reaction phycoerythrin polyethylene imine peridinin chlorophyll polymerase quantitative recombinant rhesus ribonucleic acid revolutions per minute Roswell park memorial institute respiratory syncytial virus room temperature reverse transcriptase subcutaneous sodium dodecyl sulfate sec seconds SEM standard error of the mean SIV simian immunodeficiency virus SSC sideward scatter TAE tris acetate EDTA TBE tris borate EDTA TCM central memory T cell TCR T cell receptor TE tris EDTA TEM effector memory T cell TEMED tetramethylethylenediamine TM trans membrane TNF tumor necrosis factor UV ultra violet V Volt VLP virus-like particle Vol volume VSV vesicular stomatitis virus VV vaccinia virus WB Western blot WHO world health organization µ micro IV

7 Table of figures Table of figures 1.1: Structure of the human immunodeficiency virus 1 particle 4 1.2: Genetic diversity of the global HIV-1 pandemic 4 1.3: Events during an acute HIV-1 infection 7 3.1: Purification of recombinant GST-p55 protein : Purification of recombinant gp120 protein : Immunization schedule for the combined DNA prime/boost immunization : Humoral immune responses against Env and Gag after DNA immunization : Env- and Gag-specific IgG2a/IgG1 ratios after two DNA immunization : Immunization schedule for the DNA immunization with genetic adjuvants : Humoral immune responses against Env and Gag after DNA immunization with genetic adjuvants : Env- and Gag-specific IgG2a/IgG1 ratios after DNA immunization with genetic adjuvants : Humoral immune responses five weeks after DNA immunization with genetic adjuvants : CD8 + T cell responses after DNA prime/boost immunization with genetic adjuvants : Protective capacity of Gag-specific CD8 + T cell responses after DNA prime/boost immunization with genetic adjuvants : Western blot analysis of purified VLPs and exosomes : Immunoprecipitation and Western blot analysis of VLPs : Immunization schedule for the intrastructural help immunization : Humoral immune responses against after ISH immunization : Protective Gag-specific CD8 + T cell responses after ISH immunization : Immunization schedule to compare intrastructural help with a direct priming : CD4 + T cell responses after the DNA prime immunization : T H 2 responses after MHC II restricted stimulation of splenocytes : CD4 + T cell responses after the DNA prime VLP boost immunization : Humoral immune responses against HIV-1 Env and Gag after DNA prime VLP boost immunization 78 V

8 Table of figures 3.22: Env-specific IgG2a/IgG1 ratios after DNA prime VLP boost immunization : Immunization schedule for the adoptive transfer experiment to verify the ISH mechanism : Gag-specific antibody and CD4 + T cell responses after the DNA prime immunization : Purity analysis of the CD4 + T cell preparation : Humoral immune responses against HIV-1 Env in CD4 + T cell recipients after the VLP immunizations : Anti-p24 surface staining of transfected 293T cells : Indirect immunoprecipitation and Western blot analysis of VLPs : Transduction efficacies of HIV-1 and MLV derived viral vectors : Anti-gp120 surface staining of transduced P815 cells : FACS-based antibody binding assay against P815Env and P815 cells : Fcγ receptor activation assay : Schedule for the immunization to evaluate the potential of genetic adjuvants within intrastructural help : Gag-specific T cell responses after the DNA prime with genetic adjuvants and VLP boost immunizations : Gag-specific antibody responses after the DNA prime immunization with genetic adjuvants : Humoral immune responses after DNA prime with genetic adjuvants and VLP boost immunizations : Env-specific IgG2a/IgG1 ratios after DNA prime with genetic adjuvants and VLP boost immunizations : Protective capacity of Gag-specific CD8 + T cell responses after DNA prime with genetic adjuvants and VLP boost immunizations : Correlation of Gag-specific polyfunctional CD8 + T cells with reduced viral loads 97 VI

9 Summary Summary The global HIV-1 pandemic constitutes a major threat to the global health and turns the development of a prophylactic vaccine into an urgent need. To be most effective such a vaccine should induce protective antibody and T cell responses. Therefore, the present study analyzed the immune responses against HIV-1 Env and Gag induced by DNA prime virus-like particle boost vaccine regimens in a small animal model. Upon immunization with codon-optimized HIV-1 Env and GagPol encoding plasmids by intramuscular DNA electroporation mice generated polyfunctional CD8 + T cell responses against both antigens as determined by intracellular cytokine staining. Although Gag-derived proteins are considered a better target, because they are less variable, Env-specific cytotoxic T cell responses were stronger. Nevertheless, the Gag-specific T cells were sufficient to protect the animals from a lethal challenge with a recombinant vaccinia virus expressing HIV-1 Gag. Co-immunization with cytokine encoding plasmids as genetic adjuvants demonstrated only a minor impact on the cellular immune responses. Thus, the reduced protection from the vaccinia virus challenge observed in the group that received the interleukin 6 (IL6) encoding plasmid was not expected and demands further research. The DNA electroporation also induced substantial Env- and Gag-specific antibody responses. While the antibodies against Env were highly dominated by the IgG1 subclass, the humoral immune response against Gag was balanced. This bias was not dependent on the quaternary structure of the antigen since it was observed for different soluble and membrane-bound forms of Env and could not be modulated by co-application of cytokine encoding plasmids. Although the DNA immunization induced polyfunctional CD4 + T H 1 cells against both antigens, only Env-specific T cells demonstrated a substantial secretion of IL5, IL10 and IL13. In addition, IL4 producing CD4 + T cells specific for Env exhibited a prolonged half-life compared to Gag-specific ones. Therefore, a CD4 + T cell response that is shifted towards a T H 2 phenotype is probably responsible for the IgG1 predominance in the humoral immune response against Env. By using virus-like particles (VLPs) containing HIV-1 Gag and Env proteins as boost antigens, it was analyzed if Gag-specific CD4 + T cells were able to provide heterologous T cell help for Env-specific B cells. This phenomenon was previously 1

10 Summary observed for influenza A, hepatitis B and simian immunodeficiency virus and termed intrastructural help. Only animals that received a DNA prime immunization against GagPol were able to mount a balanced humoral immune response against Env after the VLP boost immunizations. In contrast, the Env-specific humoral immune response was dominated by the IgG1 subclass, if the animals received a DNA prime immunization that contained the Env encoding plasmid and even if the animals received only the VLP immunizations. An adoptive transfer verified that Gag-specific CD4 + T cells were responsible for the increased Env-specific IgG2a/IgG1 ratio. A further modulation by incorporation of cytokine encoding plasmids as genetic adjuvants in the prime immunization was unsuccessful. Nevertheless, the intrastructural help approach induced humoral immune responses against Env that demonstrated an enhanced engagement of the activating Fcγ receptors, despite lower overall antibody levels. Since an increased functionality of the humoral immune response seems to discriminate the modestly efficacious RV 144 from the non-efficacious Vax 003 trial, the results presented within this thesis may prove useful for the development of a prophylactic HIV-1 vaccine. 2

11 Introduction 1 Introduction 1.1 HIV-1/AIDS The human immunodeficiency virus 1 (HIV-1) was discovered in 1983 as the causative agent of the acquired immunodeficiency syndrome (AIDS) (1, 2). According to estimates from the World Health Organization (WHO), the HIV-1 pandemic has killed more than 30 million people since its outbreak and leaves 35.3 million people currently infected (UNAIDS 2013 global fact sheet). A prophylactic vaccine would be the most cost-effective measure to stop the pandemic, but despite tremendous efforts during the last three decades, it remains elusive. This circumstance clearly reflects the continuous need for further research Structure and diversity HIV-1 is a member of the Retroviridae and forms particles of approximately 100 nm diameter covered by a host cell derived lipid bilayer membrane. The only viral surface protein, envelope (Env), is anchored in this membrane and mediates attachment to and fusion with the target cell membrane. The Env protein is a heterodimer made up of a transmembrane subunit glycoprotein 41 (gp41) and a surface subunit gp120. Both originate from the same heavily glycosylated precursor (gp160) by proteolytical cleavage and are linked by non-covalent interactions (3). Three heterodimers assemble into a trimer, by which they form the native viral Env protein complex. Only eight to ten of these trimers are present on the surface of a viral particle, leaving it with an intriguingly low density of attachment proteins (4). The cytoplasmic tail of gp41 may interact with the matrix protein p17, which is attached to the inner side of the lipid bilayer. The cone-shaped core of HIV-1 is made up of capsid proteins (p24) and encapsulates two copies of the single-stranded RNA genome. Additional nucleocapsid proteins (p7) cover the RNA. All three structural proteins, matrix (p17), capsid (p24) and nucleocapsid (p7) are derived from the Gag precursor (p55) through cleavage by the viral protease during maturation. Accordingly, inside the particle the protease and the other two viral enzymes reverse transcriptase and integrase, which are essential for a productive infection, are incorporated. 3

12 Introduction Figure 1.1: Structure of the human immunodeficiency virus 1 particle. The viral particle is surrounded by a host cell derived lipid bilayer in which the envelope protein, consisting of gp41 and gp120, is anchored. On the inside of the membrane matrix proteins form the scaffold of the particle. Capsid proteins encapsulate two copies of the viral RNA. The viral genome is further covered by nucleocapsid proteins and a few reverse transcriptase molecules. Matrix, capsid and nucleocapsid proteins are generated through cleavage of the Gag precursor by the viral protease. The figure is derived from Karlsson Hedestam et al., 2008 (5). Due to its genetic heterogeneity HIV-1 is divided into the four main groups M, N, O and P (6). Each group originates from an independent transmission event of simian immunodeficiency virus from chimpanzees or gorillas to humans, which most probably occurred in Cameroon in the early 20th century (7, 8). The pandemic M group is further subdivided into several clades and circulating recombinant forms (CRF), demonstrating the tremendous diversity of this virus and already indicating an important hurdle for vaccine development (9). HIV-1 is highly variable because of its error-prone reverse transcriptase, which introduces mutations at a frequency of 10-4 to 10-3 (10, 11), a rate that is approximately 10 6 to 10 7 higher than for eucaryotic DNA-polymerases (12). Thereby the reverse transcriptase generates an innumerable repertoire of variants, explaining the extreme diversity of the viral population. Figure 1.2: Genetic diversity of the global HIV-1 pandemic. A neighbour-joining tree to illustrate the genetic heterogeneity of the HIV-1 population. Fourty-four full genome sequences with a few representatives of each major subtype/clade were aligned using the Treemaker tool at the Los Alamos HIV-1 database. Group P is missing, since it was discovered after this figure was prepared and it has only been identified in two persons, so far. The figure is derived from Letvin, 2006 (13). 4

13 Introduction Infection and pathogenesis As outlined above, HIV-1 possesses only one viral surface protein, which confers its tropism for host cells bearing the CD4 receptor (although initial adhesion might involve several other cellular surface molecules) (14-16). CD4 + cells include mainly macrophages and T lymphocytes but also some subpopulations of dendritic cells (DC). Upon attachment of gp120 to the CD4 molecule the Env protein undergoes conformational changes to expose the co-receptor binding site (17). Depending on the isolate HIV-1 can use either CXCR4, CCR5 or both (18). Binding of the coreceptor induces another conformational change in Env that leads to exposure of the fusion peptide located in gp41, which is subsequently inserted into the target cell membrane. Finally, three N-terminal heptad repeats near the fusion peptide form a six-helix bundle with three C-terminal heptad repeats near the transmembrane domain of gp41 to induce the fusion of viral and target cell membrane (19). As a result, the capsid is released into the cytosol of the infected cell and, after uncoating, reverse transcription takes place. The resulting proviral DNA is then transported into the nucleus and integrated into the target cell genome by the viral integrase (20). Long-terminal repeat (LTR)-driven gene expression subsequently leads to the translation of the regulatory viral proteins Rev and Tat from spliced RNAs. Whereas Tat increases the overall gene expression Rev promotes the nuclear export of singly and unspliced RNAs, which give rise to the viral structural proteins Gag, GagPol and Env. In addition, the unspliced RNA also represents the viral genome. At the cellular membrane Gag and GagPol proteins oligomerize around two copies of the viral genomic RNA and induce budding of the lipid bilayer in which the viral envelope proteins are embedded. Subsequently, cleavage of the Gag and GagPol proteins by the viral protease yields the mature virions. HIV-1 is naturally transmitted over mucosal surfaces of the genital or anal tissue during sexual intercourse, either as cell-free virions or as infected cells (21). Surprisingly, this infection is rather ineffective with infection rates below 1% (22, 23). HIV-1 can also be acquired by needle sharing or blood transfusion, which spares the virus the need to cross a mucosal barrier (24). Finally, HIV-1 infected mothers can transmit the virus to their child in utero, during birth or by breast feeding (25). Nevertheless, in 90% of the transmission events the virus has to cross a mucosal surface (26). HIV-1 overcomes this hurdle either through microlesions or by attaching to dendrites that protrude from DCs through the epithelium. The DCs are 5

14 Introduction generally not productively infected but carry the virus to their target cells (27). Notably, in most cases of heterosexual transmission HIV-1 infections are established by a single transmitted/founder (T/F) virus and almost all use CCR5 as their coreceptor (28). The first cells that become productively infected are generally CD4 + T lymphocytes with a resting phenotype in the submucosal tissue (29). The virus subsequently establishes a latent reservoir in these resting CD4 + T cells in the draining lymph nodes and the gut-associated lymphatic tissue (GALT) within a few days after infection (30, 31). Following exponential replication in activated CD4 + T cells, HIV-1 starts to spread throughout the body. This dissemination is already accompanied by a massive depletion of memory CD4 + T cells in the GALT, posing an irreparable damage to the hosts immune system (32). Concomitantly, as a first sign of the acquired infection the viral RNA becomes detectable in the circulation approximately by day ten (33, 34). Two to three weeks after acquisition HIV-1 reaches its peak titer before it decreases to a set point as a result of the upcoming cytotoxic T cell (CTL) response (35). A phase of clinical latency follows which can last from months to years, depending on the individual s immune response and restriction factors of the innate immune system. Nevertheless, in almost all cases an untreated HIV-1 infection inevitably leads to AIDS due to the CD4 + T cell loss with lethal opportunistic infections as a consequence (36) Immune response to infection Due to the intimate relationship between the virus and the immune system of the host, the immune response upon infection can be as variable as HIV-1 s etiopathology. Generally, the first immune responses that arise around two weeks post infection are antigen-specific cytotoxic CD8 + T cells at the site of infection and not much later in blood and lymph nodes (37-39). Although these initial responses contribute to the control of acute viremia, they are rather narrow and target the least conserved HIV-1 proteins Env and Nef, allowing for a rapid immune escape of the virus (40). Consequently, the cytotoxic T cells are not able to prevent the irreparable loss of CD4 + T cells or to clear the infection (39). As the initial targets fade during peak viremia, the CTL response broadens and starts targeting more conserved epitopes within the Gag protein (41). These latter responses are most likely responsible for the equilibrium between viral replication and eradication that 6

15 Introduction determines the set point viral load (35, 40, 41). During this phase of clinical latency HIV continuously evolves and, despite rare exceptions, finally escapes the control by the cytotoxic T cells, which results in the progression to AIDS. Thus, a broader cytotoxic T cell response is not a predictor of good control but only a footprint of viral evolution (40, 42). Rather than the CD8 + T cells, the HLA haplotype of the host and the fitness costs associated with escape within the corresponding CTL targets affects the duration of the latency phase (43, 44). Although the direct killing is probably the most important function of CTLs to limit the initial infection (40, 45, 46) increased polyfunctionality with release of antiviral cytokines might gain importance during later control of viremia (47). Figure 1.3: Events during an acute HIV-1 infection. Approximately one week after the initial infection the virus becomes detectable in the circulation. Probably concomitantly with the dissemination the virus establishes a reservoir within the lymphoid tissues. Between week two and three after infection, first humoral and cellular immune responses against HIV-1 arise. These include non-neutralizing antibodies and cytotoxic T cells. Already after the first month, the virus has escaped initial CD8 + T cell responses. The first neutralizing antibodies appear approximately three months after the transmission event with viral escape mutants coming up only a few days later. The figure is derived from McMichael et al., 2010 (48). Shortly after cytotoxic T cells the humoral immune response against HIV-1 starts to develop. The first anti HIV-1 antibodies appear as immune complexes during the second week of infection. These immune complexes contain mostly IgM, although some also include IgG. Approximately one week later, free IgM and IgG specific for the gp41 subunit of Env become detectable in the serum. Anti-gp120 antibodies follow another two weeks later (49). Despite their ability to form immune complexes 7

16 Introduction and to activate complement, these early B cell responses do not seem to exert any immune pressure on the virus (28, 49). The first neutralizing antibodies that appear take several months to develop and target only a limited number of epitopes of the early founder virus (50, 51). Nevertheless, these antibodies, like the early CTL responses, already apply immune pressure as evidenced by their lower neutralization activity against contemporaneous viruses (51). Probably as a consequence of the ongoing antigen exposure, some individuals mount humoral immune responses during the course of infection that are able to neutralize a significant number of heterologous viruses, but these take roughly two years to develop (52, 53). Although this neutralization breadth can be mediated by a combination of antibodies (54), several single broadly neutralizing antibodies (bnab) have been isolated in the recent past (55-57). They generally target the most conserved epitopes of Env, which are functionally important such as the CD4 binding site (CD4bs). While this makes an escape more difficult for the virus, bnab often fail to contain the infection in the long run as viral evolution prevails (58, 59). The infection with HIV-1 also induces humoral immune responses against internal viral proteins. Intriguingly, antibodies against the capsid protein p24 or the whole Gag precursor p55 precede the antibodies that target the gp120 surface subunit of Env (49). Due to the occlusion of the structural proteins by the cellular or viral lipid bilayer these antibodies probably do not contribute to protection. Nevertheless, they seem to be a valuable prognostic marker, as they wane with disease progression, while anti-env antibody titers are sustained (60-62). The loss of anti-p24 antibodies with disease progression is probably the consequence of the vanishing CD4 + T cell help and indicative of a differential regulation of the humoral anti-gag and anti-env responses (63, 64). Despite the induction of virus-specific antibodies an HIV-1 infection is often accompanied by polyclonal B cell activation. As a consequence, chronically infected individuals develop a hypergammaglobulinemia (65-67). The paradoxical B cell activation in presence of ongoing CD4 + T cell deletion may be caused by Env. The gp120 subunit has been described to non-specifically activate B cells through B cell receptor (BCR) or mannose receptor engagement (68-71). Additionally, gp120 binds to the mannose receptor of macrophages and monocytes and induces the secretion 8

17 Introduction of interleukin 10 (IL10), which in turn promotes immunoglobulin production by B cells (72, 73). Taken together, in spite of vigorous HIV-1 specific and unspecific responses the human immune system is generally not able to eliminate or permanently control the viral infection. Thus, to avoid the need for a life long therapy with the always impending threats of severe side effects or viral escape the development of a preventive vaccine is of utmost importance. 1.2 HIV-1 vaccine development Several hurdles make the development of an effective prophylactic HIV-1 vaccine a difficult task. As outlined above, HIV-1 establishes a lethal chronic infection. Thus, vaccination with a life attenuated virus, which proved efficacious against several viral pathogens like smallpox, yellow fever and influenza, are not applicable due to the serious safety concern of a reversion to primary virulence (74, 75). Furthermore, correlates of protection cannot be deduced from the immune response upon natural infection. In addition, the extreme variability of HIV-1, which in one infected individual is comparable to the diversity of influenza viruses world wide in a given year, complicates the choice of an adequate antigen (5, 76). Finally, the lack of a reliable small animal model and the according dependence on non-human primates further impedes the identification of a promising vaccine candidate. Nevertheless, several candidates have entered or run through clinical efficacy trials in recent years Limited success of clinical trials Since HIV-1 constitutes a chronic infection and establishes a latent reservoir early after transmission, initial attempts to develop a prophylactic vaccine tried to induce sterilizing immunity by blocking the first infection event through induction of neutralizing antibodies. Given the serious safety concerns regarding an attenuated live virus vaccine, whole inactivated virus preparations were tested in the SIV macaque model (77-79). Although promising at first, it was soon discovered that the protection was conferred by antibodies directed against the host cell derived HLA molecules present in the vaccine as well as in the challenge virus preparation (80, 81). Therefore, subsequent studies focused on Env subunit vaccines. 9

18 Introduction Challenge studies in chimpanzees suggested that vaccination with the gp120 surface subunit of HIV-1 Env could confer protection from homologous and heterologous infection (82-84). In addition, passive transfer of neutralizing antibodies in the macaque model protected the animals against a chimeric simian/human immunodeficiency virus (SHIV) infection (85-88). Thus, two clinical trials in geographically distinct high risk populations were conducted with gp120 subunit vaccines matching the respective circulating clades of HIV-1 (Vax 003 and Vax 004). Unfortunately, both trials failed to demonstrate efficacy (89, 90), which has been attributed to the low titers and narrow breadth of the induced neutralizing antibody response (91, 92). Since a substantial overall antibody response was achieved by vaccination, an inadequate structural representation of the native HIV-1 Env by the gp120 subunit was proposed as an explanation for the failure (93). Better mimics of the native Env trimer currently under development include artificially stabilized soluble trimers (94) or non-infectious virus-like particles (VLPs; see 1.2.2) (95). The failure of the Vax 003 and Vax 004 trials led to a refocus of the HIV-1 vaccine development. Since induction of neutralizing antibodies and consequently sterilizing immunity seemed hardly achievable, the design of a vaccine that was able to contain viral spread was considered. Due to the inefficient transmission of HIV-1, reducing the viral load in infected individuals should decrease the risk of infection to a level that would probably curtail the global pandemic (23, 96). Because CTLs upon infection were known to control the viral replication after the initial spread, ways to induce these cellular immune responses by vaccination were pursued. The main function of CTLs is to combat intracellular pathogens by recognizing pathogen derived peptides in the context of MHC class I molecules and subsequent killing of the infected cell. Conversely, their induction demands the intracellular expression of an antigen or at least its efficient-cross presentation in the context of MHC I by DCs. Thus, several genetic and viral vector vaccines encoding different HIV-1 derived antigens were evaluated for their potential to induce specific CTL responses. A replication-incompetent adenoviral vector vaccine expressing SIV Gag proved highly immunogenic and led to reduced viral loads and sustained CD4 + T cell counts after the SIV challenge in the macaque model (97). A subsequent clinical trial, called Step trial, tested a combination of replication incompetent adenoviral vectors expressing HIV-1 Gag, Pol and Nef, respectively. Unfortunately, despite induction of strong antigen-specific T cell responses by the vaccine regimen, it again failed to 10

19 Introduction demonstrate any efficacy in regard to acquisition or set point viral loads (98, 99). Even worse, in individuals with pre-existing immunity against the adenoviral vector, the immunization seemed to increase the risk of infection (99). Since the vaccine did not contain an envelope antigen, it solely aimed at the induction of CTL responses against internal proteins. In an attempt to increase the immunogenicity of the CTL based vaccines, a follow up clinical trial included DNA prime immunizations with plasmid DNAs encoding HIV-1 Gag, Pol, Nef and Env before the boost immunization with adenoviral vectors encoding GagPol and Env, respectively. Intramuscular injection of DNA has been known to result in transgene expression and induction of cellular and humoral immune responses ( ). Although the immune responses induced by DNA vaccination alone turned out to be rather weak, especially in larger animals, its application as a prime immunization followed by a viral vector boost proved promising (97, 104). Unfortunately, the clinical trial again failed to demonstrate any efficacy (105). The reasons for the inefficacy of both studies focusing on the cellular arm of the immune system remain to be determined. A possible explanation include the induction of antigen-specific CD4 + T cells. Since HIV-1 preferentially infects HIV-1-specific CD4 + T cells, the vaccine might have provided additional targets, counteracting a potentially protective CTL response (106). Despite the drawbacks, another large scale clinical trial was conducted combining a viral vector based on canarypox with a gp120 protein subunit vaccine (RV 144). Although initial immunogenicity studies of a similar vaccine regimen revealed only low CTL responses (107) and the Vax 003 and Vax 004 indicated that gp120 alone cannot induce protective antibodies, their combination showed for the first time modest protection of 31% against the acquisition of HIV-1 (108). Subsequent analysis demonstrated that RV 144 induced even lower neutralizing antibody responses than the non-protective Vax 003 (109). In addition, low levels of CTL responses were detectable, but these were not higher in vaccinees compared to placebo recipients (110). A correlates of protection analysis revealed antibodies to be the most likely mediators of protection despite the weak and narrow neutralization profile of the induced humoral immune responses (111). Since the RV 144 vaccine regimen induced lower overall antibody titers against Env compared to Vax 003, the difference in efficacies had to be attributed to differences in their quality (112). 11

20 Introduction Beside neutralization, antibodies can mediate several secondary effector functions. These include antibody dependent complement activation to directly lyse pathogens or infected cells, antibody dependent phagocytosis of pathogens or infected cells (antibody dependent cellular phagocytosis = ADCP) and antibody dependent cell mediated cytotoxicity (ADCC) against infected cells. Apart from complement activation, all secondary effector functions are dependent on Fc receptor bearing cells of the innate immune system and are regulated by the induction of several antibody iso- and subtypes with varying affinities for the different Fc receptors (113). Additional regulation is achieved by the immune system through glycosylation of the Fc domain of the immunoglobulins (114, 115). Comparative analysis of immune sera from the RV 144 and the Vax 003 trial indeed revealed significant differences in the quality of the induced humoral immune responses. While Vax 003 participants demonstrated significantly higher Env-specific IgG1, IgG2 and IgG4 response rates and titers, the RV 144 vaccine regimen was superior in inducing IgG3 antibodies against Env (112, 116). Furthermore, although Vax 003 initially induced significant amounts of Env-specific IgG3, these antibodies waned with repeated boosting and were replaced by strong IgG4 responses. Given the high capacity of IgG3 and the poor ability of IgG4 to mediate ADCC, these differences in the quality of the humoral immune responses may well account for the disparate efficacies of both trials. Taken together, the Vax 003, Vax 004 and Step vaccine trials, although inefficacious, provided new insights into the immunobiology of HIV-1. In combination with the knowledge gained from the partially protective RV 144 trial, this information may pave the way for the development of an efficacious HIV-1 vaccine Alternative strategies under pre-clinical development Although RV 144 was a major step forward in the development of a prophylactic HIV-1 vaccine, one has to be cautious not to overvalue the observed efficacy. In contrast to the Vax and Step trials, it was conducted in a low risk population, since sex workers, men who have sex with men and people who inject drugs were excluded. In addition, neither broadly neutralizing antibody responses, nor substantial CTL responses were induced by the vaccine regimen. Finally, the 12

21 Introduction protection observed was only short lived. Thus, much room for improvement remains. Neutralizing antibodies are generally believed to be the most potent mediators of sterilizing immunity against HIV-1. Their protective capacity has been demonstrated by passive immunization against hybrid SHIVs in the macaque model or by recombinant adeno-associated virus based vectored-immunoprophylaxis in humanized mice ( ). Thus, their induction remains one of the major aims of HIV-1 vaccine development. The observation that a remarkable number of infected people are able to mount a humoral immune response that exhibits neutralizing activity against a broad range of HIV-1 variants spurred the belief that this aim might be achievable by vaccination (53). The weak and narrow neutralizing antibody response that arose after immunization with a recombinant gp120, as observed in Vax 003, Vax 004 and RV 144 was attributed to the insufficient representation of vulnerable targets of the Env protein (89, 90, 93, 109). Vulnerable targets are generally identified by the different broadly neutralizing antibodies that have been isolated from infected individuals so far (122, 123). Thus, several strategies are followed to develop more potent Env immunogens for the induction of neutralizing antibody responses. One approach focuses on the exposition of the membrane proximal external region (MPER) of gp41, a conserved epitope important for viral fusion and a known target for neutralizing antibodies ( ). Immunization with the MPER presented on different protein scaffolds or on virus-like particles by truncated gp41 proteins induced MPER-specific antibodies ( ). Unfortunately, these antibodies were not able to mediate substantial neutralization. Since some of the most potent neutralizing antibodies target conformational epitopes (55, 57), other approaches try to design immunogens that resemble the native structure of the functional envelope more closely. Among these are soluble envelope trimers stabilized by heterologous trimerization domains (130, 131) or additional disulfide bonds (132, 133). Immunization with the envelope trimers induced higher neutralizing antibody titers than monomeric gp120, although the overall neutralizing activity in the immune sera remained rather weak ( ). This observation was attributed to a lack of antibodies that recognize conformational epitopes, which unfortunately had been the rationale for the design of the trimeric Envs (138). The switch to another primary isolate Env and further modifications led 13

22 Introduction to the exposure of additional neutralization-sensitive epitopes with concurrent occlusion of non-sensitive epitopes. A more focused humoral immune response should be the consequence, but the immunogenicity of this next generation soluble trimer remains to be determined (94). Another approach towards an antigen that presents the native envelope protein is based on VLPs, which are formed by structural proteins of the parental virus (139). The co-expression of HIV-1 Gag, Pol and Env leads to the production of lentiviral particles, that resemble the structure of the native virion (140). Such VLPs are devoid of viral genes and are therefore non-infectious. Thus, inactivation, which is essential for whole virus vaccine regimens and which may destroy the structural integrity of Env (141), is not necessary. Additionally, depending on the expression system used, HIV-1 VLPs present higher numbers of envelope proteins on their surface compared to native virions, which can increase their immunogenicity (4, ). In first immunization studies VLPs revealed the ability to induce broader humoral immune responses compared to soluble envelope vaccine regimens (146). Furthermore, enzymatic removal of non-functional Env proteins from the surface of the VLPs resulted in preferential exposure of neutralizing epitopes (95, 147). Thus, VLPs represent another promising approach for the induction of neutralizing antibodies or at least antibodies targeting conformational epitopes. The development of a single optimized immunogen might not be sufficient for the induction of protective humoral immune responses by vaccination. Since neutralizing antibody responses in infected individuals correlate with the duration of infection and the viral loads, the constant exposure to an evolving antigen has been proposed as a necessity for their development (148). The fact that known broadly neutralizing antibodies are heavily hypermutated corroborates this notion (149). Finally, broadly neutralizing antibodies that have been reverted to their putative germline predecessors often lack a detectable Env binding ability ( ). Thus, the antigens that trigger the initial B cell response probably differ from those that later support the development of the neutralization activity, as has been observed in a longitudinal study that followed the co-evolution of Env and a respective antibody lineage in an infected individual (58). Therefore, a sequential immunization approach with different Env structures that mimic different steps of their evolution under the selective pressure of the humoral immune response has been proposed to guide the 14

23 Introduction development of broadly neutralizing antibodies. Respective studies are currently ongoing. Not only neutralizing, but also non-neutralizing antibodies capable of mediating ADCC target conformational epitopes (153, 154). The importance of such secondary effector functions has been demonstrated in passive immunization studies in rhesus macaques and they have been linked to the protection observed in RV 144 (111, 112, 116, 120). Thus, the development of Env immunogens that resemble the structure of the natural trimer more closely remains worthwhile, even if neutralizing antibodies should prove not to be inducible by vaccination. Beside the induction of humoral immune responses against HIV-1, several strategies to induce protective CD8 + T cell responses are also under evaluation. Because CTLs mainly combat intracellular pathogens, they are best induced by endogenously expressed antigens. Thus, genetic vaccines, like DNA or recombinant viral vectors, are among the strongest inducers of T cell responses. Although first generation DNA vaccines suffered from low immunogenicity, several aspects render them a promising vaccine platform (155). Compared to recombinant proteins and viral vectors, the production of plasmids is by far easier and more rapid. Furthermore, their stability favors their application in less developed areas. Finally, DNA vaccines do not suffer from anti-vector immunity, which may erode vaccine efficacy. Therefore, several ways to increase their immunogenicity are pursued. DNA immunization not only allows for the endogenous expression of antigens, but also for co-expression of immune modulatory proteins. Thus, several cytokine and chemokine expressing plasmids were evaluated as genetic adjuvants for their ability to amplify or modify vaccine-induced immune responses ( ). Interleukin 12 (IL12) turned out to be consistently among the most potent genetic adjuvants and the prophylactic co-immunization of rhesus macaques with a DNA vaccine expressing SIV Gag and IL12 led to reduced viral loads and sustained CD4 + T cell counts after challenge with a chimeric SHIV (161). As a separate approach, electroporation, a known physical method to deliver DNA into prokaryotic as well as eukaryotic cells in vitro, was considered as a delivery method in vivo to increase the potency of DNA vaccines. It was shown that transient permeabilization of muscle cells by local application of electric pulses enhanced the gene transfer efficacy in vivo (162). This enhancement translated into increased humoral and cellular immune responses against Gag and Env in different small 15

24 Introduction animal models (163). Furthermore, in vivo electroporation also boosted the efficacy in larger animals, one of the major impairments of DNA vaccines before and this was not only due to the enhanced gene transfer, but also due to the locally induced inflammation (164, 165). Finally, the combination of electroporation with IL12 as a genetic adjuvant further enhanced antigen-specific immune responses in rhesus macaques and led to significantly reduced peak and set point viral loads after an SIV challenge (166, 167). A subsequent phase 1 clinical trial indicated, that such a vaccine was well tolerated with modest efficacy to induce antigen-specific T cell responses, but the protective capacity remains to be determined (168). Despite the progress made with DNA vaccines, their immunogenicity remains to be low, especially in larger species. Nevertheless, they turned out to be excellent vaccine regimens to prime immune responses, which are later boosted with recombinant viral vector or protein vaccines (169). One such approach that has already gone through clinical testing consisted of DNA prime followed by adenoviral vector boost immunizations (HVTN505). As mentioned before, this combination unfortunately proved as inefficacious as the adenoviral vector vaccine alone (99, 105). But since the immune responses induced in humans by the adenoviral vector vaccine may simply be inadequate, additional viral vectors are under development and preclinical testing. Given the success of vaccinia virus in the eradication of smallpox much effort is spent on the production and evaluation of recombinant vaccinia viruses that express HIV-1 derived antigens. Due to safety concerns with the vaccinia virus itself (170), studies focus on highly attenuated vaccinia strains like modified vaccinia Ankara (MVA) and New York vaccinia virus (NYVAC). Homologous and heterologous prime boost immunization strategies with recombinant vaccinia viruses derived from both strains have shown the potential to induce substantial immune responses and/or reduce viral loads in macaques after SIV challenge ( ). Consequently, several vaccine regimens employing recombinant vaccinia viruses are currently in clinical trials awaiting the proof that the promising results from the SIV model can be translated into humans (179). Probably the most intriguing preclinical results for the development of a CTL based HIV-1 vaccine were obtained with a viral vector derived from cytomegaloviruses (CMV). CMVs are beta-herpes viruses that establish persistent infections. The rationale behind the employment of a CMV derived vector is that peripheral T cell memory is short lived in the absence of antigen and that central 16

25 Introduction memory T cells respond too slow to an HIV-1 infection (180). Conversely, persistent antigen expression by a viral vector that establishes a chronic infection should result in peripheral T cell memory, which may lead to immediate reactivation at the portal of entry. Indeed, immunization of rhesus macaques with recombinant rhesus CMV vectors (RhCMV) expressing SIV derived antigens resulted in the induction of SIVspecific peripheral effector memory T cells (T EM ) (181). Four out of twelve RhCMV immunized macaques were able to completely control the virus after an SIV challenge, whereas all control animals showed a progressive infection. Follow up studies demonstrated that RhCMV vaccination reproducibly protected approximately 50% of the animals from a progressive SIV infection and that these animals were even able to clear the infection (182, 183). Surprisingly, vaccinated animals that established an SIV infection did not exhibit reduced viral loads as it was the case for DNA/adenoviral vector immunized macaques (182). Thus, RhCMV vectors seem to protect in an all-or-nothing fashion at a level not observed for another HIV-1 vaccine candidate before. In conclusion, many promising vaccination approaches are currently under preclinical or clinical evaluation that may further the protection observed in the RV 144 trial. Given the progress made with humoral as well as cellular immune response inducing antigens, a combination of the most effective ones may ultimately lead to the development of a prophylactic HIV-1 vaccine. 1.3 Aims of the study Although true correlates of protection remain elusive, results from (pre-)clinical studies indicate that the induction of humoral and cellular immune responses is necessary for a prophylactic vaccine to be efficacious against HIV-1. Since DNA vaccines are capable of activating both arms of the adaptive immune system, one aim of the current study was to characterize the immune responses induced by a mixed Env and Gag DNA vaccine in a small animal model. Additionally, the impact of the quaternary structure of the Env on the immune responses against both antigens was analyzed by the use of respective DNA vaccines. Given their ability to induce antibodies, a further aim of this study was to evaluate the potential of a VLP vaccine either alone or in combination with a DNA immunization. Resulting humoral immune responses were comparatively analyzed for their magnitudes and immunoglobulin 17

26 Introduction subclass distribution. Furthermore, the functional properties of the antibodies induced by the different vaccine regimen were determined in an Fcγ receptor activation assay. An additional aim was the analysis of the cellular immune responses after application of the different vaccine regimens. While CD4 + T cells play a pivotal role in orchestrating the humoral immune response, CD8 + T cells have the potential to control viral replication. Thus, the quality of the cellular immune responses against Env and Gag was determined by characterization of their cytokine expression profile. Furthermore, the potency of the Gag-specific CTL responses was evaluated by challenging animals with a recombinant vaccinia virus expressing HIV-1 Gag. Finally, different genetic adjuvants were tested for their ability to modulate humoral or cellular immune responses against Env and Gag. By this multifocused approach the current study aimed for a better understanding of the immune responses that can be induced against the different HIV-1 derived antigens. Thus, the results obtained should support the development of a prophylactic HIV-1 vaccine. 18

27 Materials and methods 2 Materials and methods 2.1 Materials Chemicals and reagents 0.9% NaCl SteriPharm 2-Propanol J. T. Baker 7-AAD ebioscience Acetic acid VWR Acrylamide solution 30% AppliChem Agar AppliChem Agarose Roth Aluminium sulfate AppliChem Ammonium chloride Riedel-de Haën Ammonium peroxodisulphate Roth Ampicillin sodium salt AppliChem Bovine serum albumin Sigma Bromophenol blue Fluka Calcium chloride J. T. Baker Coomassie brilliant blue Serva D(+)-Glucose AppliChem D(+)-Sucrose AppliChem DMSO J. T. Baker Dynabeads Protein G Life technologies dntps Amersham Biosciences EDTA Merck Ethanol Sigma-Aldrich Ethidium bromide AppliChem FCS Gibco G418 disulfate AppliChem Gentamycin sulfate AppliChem Glutathione Sigma Glutathione Sepharose 4B GE Healthcare Glycerol J. T. Baker Glycine Roth 19

28 Materials and methods Heparin sodium salt HEPES Hydrogen peroxide 30% Imidazole IPTG Isoflurane Kanamycin sulfate Ketamin Lentil lectin Sepharose 4B LPS Luminol sodium salt Magnesium chloride Magnesium sulfate Manganese(II) chloride Methanol Methyl α-d-mannopyranoside Monensin sodium salt Ni-NTA agarose ortho-phosphoric acid p-coumaric acid Paraformaldehyde Penicillin-Streptomycin Polyethylenimine Potassium hydrogen carbonate Potassium chloride Potassium dihydrogen phosphate Saponin SDS Skimmed milk powder Sodium azide Sodium carbonate Sodium chloride Sodium dihydrogen phosphate Sodium hydrogen carbonate Sodium hydroxide Sodium hypochlorite Sodium monohydrogen phosphate AppliChem AppliChem J. T. Baker Alfa Aesar AppliChem CP-Pharma AppliChem CP-Pharma GE Healthcare Invivogen Sigma J. T. Baker J. T. Baker J. T. Baker Sigma-Aldrich Sigma Sigma Qiagen J. T. Baker Sigma Riedel-de Haën Gibco Aldrich Riedel-de Haën J. T. Baker J. T. Baker Sigma AppliChem Heirler AppliChem J. T. Baker J. T. Baker J. T. Baker J. T. Baker J. T. Baker AppliChem J. T. Baker 20

29 Materials and methods Streptavidin-HRP Sybr Green TAE 50x TBE 5x TEMED Triton X-100 Trizma base Trypton Tween 20 Urea Water Xylavet Yeast extract β-mercaptoethanol BD Biosciences Molecular Probes AppliChem AppliChem Merck Fluka Sigma AppliChem AppliChem J. T. Baker B. Braun CP-Pharma AppliChem AppliChem Consumables Bacterial culture tubes 13 ml Blotting paper Cell culture flasks 25 cm 2, 75 cm 2, 175 cm 2 Cell scraper Cell strainer Econo column Hematocrit capillaries, heparinized, 10 µl Microtiter/Multiwell plates with 6, 24, 48, 96 wells Nitrocellulose membrane 0.45 µm Pipette tips 10 µl, 20 µl, 200 µl, 1000 µl Pipettes 2 ml, 5 ml, 10 ml, 25 ml Pleated filters QIAshredder Reaction tubes 0.2, 1.5, 2.0, 15, 50 ml Rotor-Gene STRIP tubes 0.1 ml Syringe filter units 0.20 µm, 0.45 µm Syringes 0.5 ml, 1 ml, 2 ml, 5 ml, 20 ml, 50 ml Ultracentrifugation tubes Ultrafiltration device 30 kda cut-off Sarstedt Macherey & Nagel Greiner Bio One TPP BD Falcon Bio-Rad Hirschmann Laborgeräte Falcon, Nunc, Sarstedt, Greiner Bio One GE Healthcare Starlab Greiner Bio One Macherey & Nagel Qiagen Greiner Bio One LTF-Labortechnik Sarstedt B. Braun, Terumo, BD Medical, Henry Schein Seton Scientific Sartorius Stedim 21

30 Materials and methods Instruments Alphaimager HP Analytical balance SBA31 Autoclave 75S/135S BioPhotometer Cell counter 8700 Centrifuge 5415 Centrifuge 5417C Centrifuge 6K15 Centrifuge Allegra X-15A Centrifuge Avanti J-25 Centrifuge Rotina 420R Cryosystem 6000 Dissociator GentleMACS Electrophoresis system PerfectBlue Electrophoresis systems Mini Protean 3 and Tetra Cell Flow cytometer FACS Calibur Flow cytometer FACS Canto II Fluorescence microscope Axiovert 100 Fluorometer Qubit Freezer -20 C Freezer -86C VIP series Freezer ULT -86 Ice maker AF 100 Incubator Aerotron Incubator Hera cell 240 Incubator HS 12 Incubator Unitron Luminometer Magnetic particle concentrator MPC-E Magnetic stirrer RCT standard Microplate luminometer Orion Microplate reader Sunrise Microplate washer Wellwash 4 MK2 Microscope TMS-F Microwave oven R-22A ProteinSimple Scaltec H+P Labortechnik GmbH Eppendorf mölab Eppendorf Eppendorf Sigma Beckman Coulter Beckman Hettich Zentrifugen MVE Miltenyi Biotec PeqLab Bio-Rad BD Biosciences BD Biosciences Zeiss Life technologies Siemens, Bosch, Liebherr, AEG Sanyo Thermo Forma Scotsman Infors HT Heraeus Heraeus Infors HT Hamamatsu Photonics Dynal IKA Berthold Detection Systems Tecan Thermo Scientific Nikon Sharp 22

31 Materials and methods Mixer Centomat SII Mixer DRS 12 Mixer IKA-Vibrax-VXR Mixer Polymax 1040 Mixer REAX 2000 Mixer Roller Drum Mixer UZUSIO VTX-3000L Mixer Vortex Genie 2 Mixer Vortex Genius 3 ph meter ph211 Pipettor pipetus Powersupply E835 Powersupply PowerPack P25 Precision balance SPB63 Real-time PCR cycler Rotor-Gene RG-3000 Refrigerator Sterilizer T6420 Thermocycler PTC-100 Thermocycler PTC-200 Thermomixer comfort Ultracentrifuge Optima L-70K Rotor SW28 Rotor SW41 Ultrasonic bath Variable volume pipettes Waterbath Waterbath 1086 B. Braun Biotech International neolab IKA Heidolph Heidolph Bellco Glass, Inc. LMS Scientific Industries IKA HANNA instruments Hirschmann Laborgeräte Consort Biometra Scaltec Corbett Research Siemens, Bosch Heraeus MJ Research MJ Research Eppendorf Beckman Beckman Coulter Beckman Merck eurolab Abimed, Eppendorf, Gilson, Thermo Scientific Breda Scientific GFL 23

32 Materials and methods Nucleic acids Plasmids Hgp Syn : Codon-optimized expression plasmid for HIV-1 GagPol based on the IIIB isolate BH10. The expression is driven by the CMV immediate early promoter (184). Hg Syn : Codon-optimized expression plasmid for HIV-1 Gag based on the IIIB isolate BH10. The expression is driven by the CMV immediate early promoter. HIV-CS-CG-R53SDa: Self-inactivating lentiviral vector construct containing the gene for the green fluorescing protein under control of the CMV immediate early promoter. An additional CMV immediate early promoter replaces the U3 region of the 5 LTR to allow high level expression of the proviral vector. The plasmid also contains a 133 bp deletion in the U3 region of the 3 LTR and the R53SD target sequence for a qpcr in antisense direction. The vector is based on pcs-cg (185). pcd-hivgp120dkr-his: Codon-optimized expression plasmid for consensus clade B gp120. The last two amino acids of the gp120 protein were deleted to disrupt the furin cleavage site and a polyhis tag was added to the C-terminus for the purification. The expression is driven by the CMV immediate early promoter. pcdna3.1(+): Eukaryotic expression vector containing the CMV immediate early promoter, the bovine growth hormone polyadenylation sequence and a SV40 ori (Invitrogen). pconbgp160opt: Codon-optimized expression plasmid for HIV-1 consensus clade B gp160. The expression is driven by the CMV immediate early promoter (186). pconbgp140g/cd: Codon-optimized expression plasmid for HIV-1 consensus clade B Env. The cytoplasmic domain was replaced with the one from the VSV-G protein. The expression is driven by the CMV immediate early promoter. 24

33 Materials and methods pconbgp160uncopt: Codon-optimized expression plasmid for HIV-1 consensus clade B gp160. The furin cleavage site between gp120 and gp41 was disrupted by introduction of two amino exchanges from arginine to serine. The expression is driven by the CMV immediate early promoter (186). pctatrev: Expression plasmid for a Tat-Rev fusion protein (187). pgex-gag: Prokaryotic expression plasmid for HIV-1 Gag. Expression is driven by the IPTG-inducible tac promoter and the Gag protein is fused to GST for purification. pgreenlantern: Expression plasmid for the green fluorescing protein. The expression is driven by the CMV immediate early promoter. phit-g: Expression plasmid for the G protein of the vesicular stomatitis virus (188). phit60: Expression plasmid for Moloney murine leukemia virus GagPol (189). pires2-egfp: Expression plasmid for the enhanced green fluorescing protein. The expression is driven by the CMV immediate early promoter. The plasmid contains an internal ribosomal entry site (IRES) upstream of the EGFP gene to allow for translation of a separate protein from the same mrna (Clontech). plegfp-n1: A retroviral vector construct based on the Moloney murine leukemia virus that expresses the enhanced green fluorescing protein under the control (Clontech). pl-conbgp140g/cd: A retroviral vector construct derived form plegfp-n1, in which the EGFP expression cassette was exchanged with the one for the gp140 protein carrying the cytoplasmic domain of VSV-G. porf-mil12: Expression plasmid for the murine interleukin 12. The murine IL12 subunits p35 and p40 are fused by an elastin linker. The expression of the fusion protein is driven by a composite human elongation factor 1 and HTLV promoter (Invivogen). 25

34 Materials and methods pvax1: A plasmid designed for the development of DNA vaccines. It contains the CMV immediate early promoter and the bovine growth hormone polyadenylation sequence (Invitrogen). pv-conbsgp140: The plasmid pvax1 with the expression cassette for the consensus clade B Env ectodomain derived from pconbgp160uncopt. pv-conbsgp140ft: The plasmid pvax1 with the expression cassette for the consensus clade B Env ectodomain derived from pconbgp160uncopt. The trimerization motif of the fibritin protein from the bacteriophage T4 was added to the C-terminus according to (131). pv-mil5oh: The plasmid pvax1 with the expression cassette for the murine interleukin 5. An Ollas and a His tag were added C-terminally. pv-mil5doh: The plasmid pvax1 with the expression cassette for the murine interleukin 5. The Ollas and a His tag were removed by replacing their coding sequences with a stop codon. pv-mil6oh: The plasmid pvax1 with the expression cassette for the murine interleukin 6. An Ollas and a His tag were added C-terminally. pv-mil6doh: The plasmid pvax1 with the expression cassette for the murine interleukin 6. The Ollas and a His tag were removed by replacing their coding sequences with a stop codon. pv-mil28aoh: The plasmid pvax1 with the expression cassette for the murine interleukin 28A. An Ollas and a His tag were added C-terminally. pv-mil28adoh: The plasmid pvax1 with the expression cassette for the murine interleukin 28A. The Ollas and a His tag were removed by replacing their coding sequences with a stop codon. 26

35 Materials and methods pv-mil28boh: The plasmid pvax1 with the expression cassette for the murine interleukin 28B. An Ollas and a His tag were added C-terminally. pv-mil28bdoh: The plasmid pvax1 with the expression cassette for the murine interleukin 28B. The Ollas and a His tag were removed by replacing their coding sequences with a stop codon Oligonucleotides All oligonucleotides were purchased from biomers and are represented in 5 to 3 orientation. HIVgp120 for HIVgp120 rev3 GCATCTCGAGTCCGCCGCCGAGAAGCTGTG GCCCTCTAGATCAGTGATGGTGGTGATGGT GCTCGCGCTGCACCACGCGGC HindIII-mIL-28 for PvuI-mIL-28A rev PvuI-mIL-28B rev GCATAAGCTTGCCACCATGCTCCTCCTGCTG TTGCC CCGGCGATCGGACACACTGGTCTCCAT CCGGCGATCGGACACACTGGTCTCCAC HindIII mil5 for PvuI mil5 rev GCATAAGCTTGCCACCATGAGAAGGATGCTT CTGCACTTG CCGGCGATCGGCCTTCCATTGCCCACTCTG HindIII mil6 for PvuI mil6 rev GCATAAGCTTGCCACCATGAAGTTCCTCTCT GCAAGAGACTTCC CCGGCGATCGGGTTTGCCGAGTAGATCTCA AAGTG PvuI-Stop-AgeI-XhoI sense (5 -phosphorylated) PvuI-Stop-AgeI-XhoI antisense (5 -phosphorylated) CGTAGATTACCGGTC TCGAGACCGGTAATCTACGAT HindIII ConBgp140 for gp140 Fibritin PvuI rev GCATAAGCTTGCCACCATGCGCGTGAAGGG CCGGCGATCGCAGGAAGGTGCTCAGCAGCA CCCACTCGCCGTCCTTCCTCACGTAGGCCT GGCCGTCCCTAGGGGCCTCAGGGATGTAGC CCTTGATGTACCACAGCCAGTTGGTG 27

36 Materials and methods SalI IRES for IRES AgeI rev GCATGTCGACGCCCCTCTCCCTCCCC CCGGACCGGTTGTGGCCATATTATCATCGT GTT I4LF I4LR GACACTCTGGCAGCCGAAAT CTGGCGGCTAGAATGGCATA BGH reverse PEN1 532F TAGAAGGCACAGTCGAGG AGGCGTGTACGGTGGGA Standards GeneRuler 100 bp and GeneRuler 1 kb plus DNA ladders (Fermentas/Thermo Scientific) served as size standards for the agarose gel electrophoresis of DNA. For the SDS-PAGE the Precision Plus Protein Dual Color Standard (Bio-Rad) was used. Finally, recombinant gp120 (IIIB, NIH AIDS reagent program), p24 (GenScript) and murine interleukin 2 (ebioscience) were used in the respective ELISAs to generate standard curves Peptides Gag MHC I Env MHC I AMQMLKETI IHIGPGRAFYT Gag MHC II Gag MHC II Env MHC II PVGEIYKRWIILGLN SPEVIPMFSALSEGA GVPVWKEATTTLFCASDAKA Antibodies Antibody Reactivity Clonality Host Conjugation Source 2G12 (αgp120) HIV-1 monoclonal Human None Polymun Scientific HIV-IG HIV-1 polyclonal Human None NIH AIDS reagent program αcd107a Mouse monoclonal Rat FITC BD Biosciences αcd107a Mouse monoclonal Rat AlexaFluor488 ebioscience αcd16/32 Mouse monoclonal Rat None BD Biosciences 28

37 Materials and methods αcd16/32 Mouse monoclonal Rat None ebioscience αcd19 Mouse monoclonal Rat APC BD Biosciences αcd28 Mouse monoclonal Syr. None BD Biosciences Hamster αcd28 Mouse monoclonal Syr. None ebioscience Hamster αcd3 Mouse monoclonal Arm. None BD Biosciences Hamster αcd4 Mouse monoclonal Rat PerCP BD Biosciences αcd4 Mouse monoclonal Rat PerCP-eF710 ebioscience αcd8 Mouse monoclonal Rat PerCP BD Biosciences αcd8 Mouse monoclonal Rat PerCP-eF710 ebioscience αcd8 Mouse monoclonal Rat ef450 ebioscience αcd8 Mouse monoclonal Rat Pacific Blue BD Biosciences αgp120 HIV-1 polyclonal Goat None Acris αifnγ Mouse monoclonal Rat PE BD Biosciences αifnγ Mouse monoclonal Rat PE ebioscience αig Mouse polyclonal Rabbit HRP Dako αig Goat polyclonal Rabbit HRP Dako αig Rat polyclonal Rabbit HRP Dako αig Mouse polyclonal Rat FITC BD Biosciences αig Mouse polyclonal Goat PE ebioscience F(ab')2 αig Mouse monoclonal Rat HRP Rockland (TrueBlot) αigg Human polyclonal Rabbit HRP Dako αigg Human monoclonal Mouse PE BD Biosciences αigg1 Mouse monoclonal Rat HRP BD Biosciences αigg2a Mouse monoclonal Rat HRP BD Biosciences αil2 Mouse monoclonal Rat None BD Biosciences αil2 Mouse monoclonal Rat Biotin BD Biosciences αil2 Mouse monoclonal Rat APC BD Biosciences αil2 Mouse monoclonal Rat APC ebioscience αollas tag monoclonal Rat None Own department αp24 HIV-1 monoclonal Mouse None NIH AIDS reagent program αtnfα Mouse monoclonal Rat AlexaFluor488 BD Biosciences αtnfα Mouse monoclonal Rat PE-Cy7 BD Biosciences 29

38 Materials and methods Enzymes All enzymes were used according to the manufacturer s instructions. Restriction endonucleases Expand-High-Fidelity DNA polymerase Lysozyme DNaseI New England Biolabs Roche AppliChem AppliChem Kits Method Kit Manufacturer Plasmid isolation RotiPrep Plasmid MINI Roth Plasmid isolation JETstar 2.0 Plasmid Purification MAXI Kit Genomed Plasmid isolation NucleoBond Xtra Maxi EF Macherey-Nagel Plasmid isolation NucleoBond PC EF Macherey-Nagel DNA purification Nucleospin Gel and PCR Clean-up Macherey-Nagel DNA purification QIAamp DNA Blood Kit Qiagen DNA quantification Qubit dsdna HS Assay Kit Life technologies Ligation of DNA fragments Ligation Kit Ver. 2.1 TaKaRa Quantitative PCR QuantiTect Probe PCR Kit Qiagen RNA isolation RNeasy Mini Kit Qiagen Reverse transcription ThermoScript RT-PCR System Invitrogen ELISA Ready-SET-Go! ELISA Kit ebioscience ELISA ELISA MAX Standard SET BioLegend ELISA BD OptEIA TMB Substrate BD Biosciences Western blot ChemiGlow West Alpha Innotech Protein quantification BCA Protein Assay Kit Pierce Cell isolation CD4 + T Cell Isolation Kit II Miltenyi Biotec 30

39 Materials and methods Buffers and media Most solutions for molecular biological and protein biochemical work were prepared with demineralized water. Sterile solutions for cytological and immunological methods and solutions for methods demanding extraordinary purity, such as RNA isolation and PCR, were prepared with sterile water obtained from B. Braun Melsungen AG. Due to its ubiquitary use, the composition of the PBS stock solution is stated here. DPBS, 10x (Gibco): KCl KH 2 PO 4 NaCl Na 2 HPO mm 14.7 mm 1.38 M 80.6 mm ph Buffers and media for molecular biological methods DNA loading buffer: LB medium: Urea 4 M Yeast extract 5 g/l Sucrose 50% w/v Tryptone 10 g/l EDTA 0.1 M NaCl 5 g/l Bromophenol blue tip of spatula ph respective antibiotic TAE, 50x (Applichem): EDTA 0.05 M LB agar: Acetic acid 1 M Agar 1.5% w/v Tris 2 M in LB medium ph respective antibiotic TBE, 5x (AppliChem): Boric acid M EDTA 0.01 M Tris M ph

40 Materials and methods 2x YTA medium: SOC medium (Invitrogen): Tryptone 16 g/l Tryptone 2% w/v Yeast extract 10 g/l Yeast extract 0.5% w/v NaCl 5 g/l NaCl 10 mm Ampicillin 100 mg/l KCl 2.5 mm ph 7.0 MgCl 2 10 mm MgSO 4 10 mm Glucose 20 mm ph Buffers and media for protein biochemical methods GST elution buffer: Tris/HCl 50 mm Tris-glycine buffer: Trizma base Glutathione 10 mm ph 8.0 Glycine SDS 2.5 mm 19 mm 0.1% w/v Tris/HCl ph 6.8: Trizma base 0.5 M HCl to adjust the ph 6.8 Tris/HCl ph 8.8: Trizma base 2 M HCl to adjust the ph 8.8 SDS sample buffer: Tris 150 mm Glycerol 30% v/v SDS 1.2% Bromophenol blue w/v β-mercaptoethanol 15% v/v Colloidal Coomassie solution: Coomassie brilliant blue 0.02% w/v Aluminiumsulfate 5% w/v Ethanol 10% v/v ortho-phosphoric acid 2% v/v Western blot transfer buffer: Trizma base 2 mm Glycine 15.2 mm Methanol 20% v/v Western blot washing buffer: Tween % v/v in PBS 32

41 Materials and methods Western blot blocking buffer: Skimmed milk powder 5% w/v in Western blot washing buffer 0.1 M bicarbonate buffer: NaHCO g/l Na 2 CO g/l ELISA washing buffer: Tween % v/v in PBS ECL solution: Solution A: Tris/HCl ph 8.6 Luminol Solution B: p-coumaric acid in DMSO Working solution: Solution A + 1% Solution B % v/v H 2 O M 250 mg/l 1.1 mg/ml Buffers and media for cytological methods Complete growth medium (DMEM): DMEM (Invitrogen) + 10% FCS CD 293 medium: CD 293 medium (Invitrogen) + 1% Penicillin-Streptomycin (Gibco) µg/ml Gentamycin AIM V medium (Invitrogen) Complete growth medium (RPMI): RPMI 1640 (Invitrogen) + 10% FCS + 1% Penicillin-Streptomycin (Gibco) + 50 µm β-mercaptoethanol PEI solution: PEI 1 mg/ml ph x Trypsin-EDTA (Invitrogen): R10: NaCl 147 mm RPMI 1640 (Invitrogen) EDTA 4.8 mm + 10% FCS Trypsin 5 g/ml + 10 mm HEPES + 2 mm L-Glutamine (Gibco) + 1% Penicillin-Streptomycin (Gibco) 20% Sucrose: D(+)-Sucrose 20% w/v + 50 µm β-mercaptoethanol in PBS 33

42 Materials and methods Buffers and media for immunological methods Heparin solution: Heparin 250 U/ml 4% Paraformaldehyde: Paraformaldehyde in HBSS in PBS 4% w/v HBSS (Invitrogen): FACS buffer: KCl 5.33 mm BSA 0.5% w/v KH 2 PO mm NaN 3 1 mm NaHCO mm in PBS NaCl mm Na 2 HPO mm Permeabilization buffer: D-Glucose 5.55 mm Saponin 1% w/v in FACS buffer ACK buffer (Lonza): NH 4 Cl 150 mm MACS buffer: KHCO 3 10 mm BSA 0.5% w/v EDTA 0.01 mm EDTA 2 mm in PBS, sonicate to degas Bacteria Strain Genotype Manufacturer DH5α supe44 lacu169 (φ80lacz M15) hsdr17 New England reca1 enda1 gyra96 thi-1 rela1 Biolabs One Shot TOP10 F - mcra Δ(mrr-hsdRMS-mcrBC) φ80laczδm15 ΔlacX74 reca1 arad139 Δ(araleu) 7697 galu galk rpsl (StrR) enda1 nupg Invitrogen Eukaryotic cell lines HEK 293A: Human embryonal kidney cells, which have been transduced with the Adenovirus type 5 (190) 34

43 Materials and methods HEK 293T (ATCC CRL-3216): Human embryonal kidney cells, which have been transduced with the Adenovirus type 5. In addition, they express the large T antigen of the simian virus 40 (191). P815 (ATCC TIB-64): Murine mastocytoma cells derived from the DBA/2 strain (192). BW5147 (ATCC TIB-47): Murine thymoma cells derived from the AKR/J strain (193). These cells were used to generate the Fcγ receptor reporter cell lines, since they do not express the TCR α, β, γ and ζ subunits. The respective reporter cell lines were generated and kindly provided by Katrin Ehrhardt and Prof. Hartmut Hengel, Institute of Virology, University Medical Center, Freiburg Animals Six to eight weeks old BALB/cJRj mice were purchased from Janvier and housed in the S2 animal facility in individually ventilated cages with free access to drinking water and feed. The mice were allowed to accustom to the new keeping conditions for at least one week before they entered an experiment. All animals were handled according to the Federation of European Animal Science Associations (FELASA) in accordance with national law and institutional guidelines. 35

44 Materials and methods 2.2 Methods Molecular biological methods Isolation of plasmid DNA Isolation of plasmid DNA from bacterial suspension cultures was performed at different scales using adequate kit systems according to the manufacturer s instructions. Name Scale Culture volume Endotoxin-free Manufacturer RotiPrep Plasmid MINI JETstar 2.0 Plasmid Purification MAXI Kit NucleoBond Xtra Maxi EF NucleoBond PC EF mini 2 ml no Roth maxi 300 ml no Genomed maxi 300 ml yes Macherey-Nagel giga 2.5 l yes Macherey-Nagel Determination of DNA concentrations To determine the concentration of plasmid DNA in a solution, the optical density of the solution was measured at 260 nm (OD 260 ) with a BioPhotometer (Eppendorf). The solution was diluted to yield an OD 260 between 0.1 and 1.5 in order to reach the linear range of the assay. An OD 260 value of one corresponds to 50 µg/ml of dsdna. Concentrations of total DNA isolated from eukaryotic cells was determined with the Qubit dsdna HS Assay KIT (Life technologies) according to the manufacturer s instructions. The samples were diluted 1 to 200 before they were analyzed in a Qubit fluorometer (Life technologies). 36

45 Materials and methods Digestion of DNA with restriction enzymes To verify the identity of a plasmid or to produce DNA fragments for subcloning the DNA was treated with a single or a combination of two type II restriction endonucleases. All restriction enzymes were purchased from New England Biolabs and the restriction was carried out according to the manufacturer s instructions Agarose gel electrophoresis For the separation of DNA fragments the samples were subjected to agarose gel electrophoresis. To this end, % w/v agarose was heated in TAE or for separation of small fragments in TBE until it was completely dissolved. The solution was cooled down to approximately 50 C before ethidiumbromide was added to a final concentration of 1 µg/ml. Subsequently, the solution was poured into the electrophoresis chamber and the comb to form the gel pockets was inserted. After hardening, the gel was covered with TAE or TBE buffer, accordingly. The samples were mixed with a sixth of the total volume of loading buffer and filled into the gel pockets. For determination of DNA fragment sizes a suitable DNA standard was added and the electrophoresis was performed at a constant voltage of V. To visualize the DNA fragments after electrophoresis the gel was exposed to UV light with a wavelength of 306 nm on a AlphaImager (Alpha Innotech and Protein Simple, respectively) Gel extraction of DNA fragments If the DNA fragments separated by agarose gel electrophoresis were to be used for subcloning, the gel was only exposed to low energy UV light (365 nm) and the fragments of interest were cut out using a scalpel. The DNA fragment containing gel pieces were weighted and subjected to gel extraction with the Nucleospin gel extraction and PCR clean-up kit (Macherey-Nagel) according to the manufacturer s instructions. For the elution, distilled water heated to 70 C was used Polymerase chain reaction (PCR) For the amplification of specific DNA fragments, oligonucleotides (primer) complementary to the 5 region in sense direction and to the 3 region in antisense direction were used. Following denaturation of the DNA double-strand at 95 C, the 37

46 Materials and methods temperature is lowered to allow these primers to anneal to their complimentary regions on the DNA template, which provides the necessary 3 hydroxyl group for the thermostable DNA polymerase. The annealing temperature is determined by the oligonucleotide sequence and length and commonly between 55 and 65 C. Finally, beginning at the 3 hydroxyl group of the respective primer the DNA polymerase synthesizes the complimentary DNA strands during the elongation step to produce two double-stranded DNA molecules per reaction. The optimal elongation temperature for most DNA polymerases is close to 72 C. To increase the fidelity of the PCR, DNA polymerases with a proof reading activity can be used. These enzymes possess a 3 to 5 exonuclease activity, which allows the polymerase to excise accidentally introduced mismatching bases. The PCR can also be used to add new sequences to the amplified DNA fragment, like recognition sites for restriction endonucleases, stop codons or a Kozak sequence for enhanced gene expression in eukaryotic systems. To this end, the desired sequences can be added as an overlap 5 to the complimentary sequence of the respective oligonucleotide. The PCRs were generally performed as follows: Setup: Program: 1 µl template (appr. 100 ng) Step Temp. Time 5 µl PCR-buffer (10x) Denaturation 95 C 2 min 1 µl dntp-mix (10 µm each) Denaturation 95 C 45 sec 5 µl sense primer (10 µm) Annealing C 45 sec 5 µl antisense primer (10 µm) Elongation 72 C 1 min/1000 bp 0.5 µl Expand HiFi-Pol Elongation 72 C 10 min Ad 50 µl H 2 O Storage 4 C Ligation of DNA fragments DNA fragments derived from restriction endonuclease treatment ( ) and/or PCR ( ) were ligated with the DNA Ligation Kit Ver. 2.1 (Takara) according to the manufacturer s instructions. If a DNA fragment was to be inserted into a plasmid, 4 µl of the fragment were mixed with 1 µl of the plasmid backbone before 5 µl of the 38

47 Materials and methods T4 DNA ligase containing ligation mix were added. Subsequently, the reaction was incubated at 16 C for at least one hour Transformation of bacteria To amplify a DNA plasmid, it was inserted into a suitable bacterial host derived from E. coli (DH5α, Top10). The insertion of free DNA into bacteria is called transformation and was conducted by the heat shock method. Competent bacteria were incubated with 1 µl of the ligation mixture ( ) or 1 µl of isolated plasmid DNA ( ; c 100 ng/µl) for 20 min on ice. Subsequently, the bacteria were subjected to a heat shock at 42 C for 50 sec and immediately afterwards put back on ice for 2 min. Two hundred µl of SOC medium was given to the bacteria and the culture was incubated for at least 1 h under constant shaking at 37 C before they were plated on LB-agar plates containing the adequate antibiotic for selection. After an incubation over night at 37 C, single colonies representing individual clones were used to inoculate a suspension culture DNA isolation from lung tissue To allow for the determination of viral loads in murine lungs, total DNA was isolated from lung homogenates using the QIAamp DNA Blood Kit (Qiagen). Lung homogenates were prepared from whole lungs by addition of 2 ml PBS followed by homogenization with a gentlemacs Dissociator (Miltenyi) using the predefined program RNA_02. The resulting homogenates were centrifuged for 5 min at 2000x g to remove cellular debris and 200 µl of the supernatants were subjected to DNA isolation according to the manufacturer s instructions RNA isolation from eukaryotic cells Total RNA from eukaryotic cells was isolated with the RNeasy Mini Kit (Qiagen) according to the manufacturer s instructions. To support the release of RNA, the samples were homogenized with QIAshredder (Qiagen) spin columns. Eukaryotic cells subjected to RNA isolation included in vitro LPS-stimulated splenocytes and influenza A virus infected lung cells, which were homogenized with the gentlemacs Dissociator (Miltenyi). 39

48 Materials and methods Reverse transcription To generate templates for cloning of genetic adjuvants, cdna was generated from total RNA extracts. For this purpose, the ThermoScript RT-PCR System (Invitrogen) was used with the supplied Oligo(dT) 20 primer according to the manufacturer s instructions. Four µl of total RNA ( ) served as template Quantitative PCR (qpcr) For the quantification of viral loads in lung homogenates, the isolated total DNA ( ) was subjected to quantitative PCR (qpcr). The qpcr combines the convenience and sensitivity of the normal PCR with a quantitative measure of fluorescence produced by an intercalating fluorophore or a probe, which is directly proportional to the amount of dsdna in the sample. Since the copy number of DNA templates initially present in the sample is in direct relationship with the qpcr cycle number at which the fluorescence intensity exceeds a predefined threshold, the use of standards with known copy numbers allows for the generation of a standard curve. Consequently, this standard curve can be used to deduce the initial copy numbers of the specific DNA sequence in a given sample. The qpcr was performed with the QuantiTect Probe PCR Kit (Qiagen) according to the manufacturer s protocol with the exception that Sybr Green (Molecular Probes) was used as an intercalating fluorophore instead of a probe. The primers I4LF and I4LR define a 71 bp fragment within the ribonucleotide reductase of the vaccinia virus. The qpcr was run in a Rotor-Gene 3000 (Corbett Research) real time PCR cycler. Setup: Program: 2 µl template Step Temp. Time 10 µl PCR-mastermix (2x) Denaturation 95 C 15 min 1 µl I4LF primer (10 µm) Denaturation 95 C 30 sec 1 µl I4LR primer (10 µm) Annealing 62 C 30 sec 1 µl Sybr Green Elongation 72 C 30 sec 5 µl H 2 O Measurement 78 C 30 sec 40

49 Materials and methods Protein biochemical methods SDS-polyacrylamide gel electrophoresis (SDS-PAGE) The SDS-polyacrylamide gel electrophoresis is capable of separating proteins according to their molecular mass. While the SDS breaks up higher-order structures and furnishes the proteins with a uniform charge, the β-mercaptoethanol reduces disulfide bonds to further support the denaturation and to separate individual proteins that do not share the same polypeptide backbone. For the SDS-PAGE, samples were mixed 1:1 with SDS sample buffer and heated to 95 C for 15 minutes to completely denature the proteins. Subsequently, samples were loaded onto a discontinuous polyacrylamide gel, consisting of a 4.2% stacking gel in Tris/HCl with a ph of 6.8 and a 10% separation gel in Tris/HCl with a ph of 8.8. A protein marker (Bio-Rad) was included to allow for the estimation of protein masses. The electrophoresis was performed in Tris-glycine buffer in a Mini-Protean 3 or Tetra cell system (Bio-Rad) at a constant voltage of 150 V until the bromphenol blue front reached the end of the gel Coomassie staining of polyacrylamide gels To visualize protein bands separated by electrophoresis directly inside a polyacrylamide gel, a colloidal Coomassie staining was performed. For this purpose, the stacking gel was discarded before the separation gel was washed two times with H 2 O for at least 10 minutes to remove the SDS. Subsequently, the gel was incubated in colloidal Coomassie solution for at least one hour. For the detection of less prominent protein bands, the incubation time was prolonged for up to 16 h. Afterwards, excessive Coomassie brilliant blue was removed by repeated washing with H 2 O Western immunoblotting For the detection of specific proteins, the samples separated by SDS-PAGE were transferred onto nitrocellulose membrane by Western blotting. To this end, the separation gel was freed from the stacking gel and covered with a nitrocellulose membrane. Gel and membrane were then placed between two sheets of Whatman paper and two thin sponges, which have also been equilibrated in transfer buffer, 41

50 Materials and methods and fixed in a gel holder cassette of the Mini Trans-Blot transfer cell (Bio-Rad). Subsequently, the electrode module was placed into the buffer chamber. The gel holder cassette was inserted into the electrode module with the nitrocellulose membrane facing towards the anode. The cooling unit was added and the buffer chamber was filled with transfer buffer, before the electrophoresis was performed for 1 h at a constant voltage of 100 V. After the transfer, the nitrocellulose membrane was incubated in blocking buffer to block vacant protein binding sites, followed by the incubation with the primary antibody diluted in blocking buffer. The nitrocellulose was then washed five times for five minutes with washing buffer, before incubation with the HRP-conjugated detection antibody also diluted in blocking buffer. All incubation steps were performed for at least one hour at room temperature or at 4 C over night. After another five washing steps with washing buffer, specific proteins were detected with the ChemiGlow West chemiluminescence substrate (Protein Simple) using a luminometer (Hamamatsu Photonics) Expression and purification of GST-Gag HIV-1 Gag was recombinantly expressed in E. coli (BL21) as a GST fusion protein. For this purpose, pgex-gag transformed bacteria were used to inoculate 100 ml of 2x YTA medium and the culture was incubated over night at 37 C under constant shaking at 230 rpm. On the next morning, 20 ml of the over night culture were used to inoculate 2 l of pre-warmed 2x YTA medium and the bacteria were grown at 37 C under constant shaking until they reached an optical density at 600 nm of 1. Subsequently, GST-Gag expression was induced by addition of IPTG at a final concentration of 1.0 mm and the bacterial culture was incubated for another 4 h at 32 C under constant shaking. Afterwards, the bacteria were harvested by centrifugation at 7700x g and 4 C for 10 min. The supernatant was discarded and the bacteria were resuspended in 40 ml PBS. Lysozyme was added to the suspension at a final concentration of 1 mg/ml before incubation for 30 min on ice. Subsequently, the suspension was subjected to sonication for 15 min in a water bath at 4 C, before a DNase I digestion was performed with a final DNase concentration of 46 U/ml for 30 min on ice. To support the solubilization of the fusion protein, 2 ml of a 20% solution of Triton X-100 in PBS was added for another 30 min incubation 42

51 Materials and methods on ice under slow shaking at 25 rpm on a rocking shaker. After centrifugation at 12000x g and 4 C for 10 min to remove bacterial debris, the supernatant was used to purify the GST-Gag protein. For this purpose, 1.33 ml of Glutathione Sepharose 4B (GE Healthcare) were equilibrated to PBS and added to the supernatant of the bacterial lysate. After 1 h incubation at RT on an end over end mixer, the Sepharose was sedimented by centrifugation for 5 min at 500x g and the supernatant was carefully removed. Subsequently, the Sepharose was washed three times with 10 ml PBS, before the GST-Gag protein was eluted by incubation with 1 ml elution buffer for 15 min at 4 C. The elution procedure was repeated once at 4 C and a third time for 30 min at RT. All centrifugation steps were carried out at 500x g for 5 min at RT. The three eluates were pooled and the buffer was exchanged to PBS using a 30 kda cut off ultrafiltration unit Expression and purification of gp120 For the expression of recombinant gp120, HEK 293T cells were transiently transfected with the plasmid pcd-hivgp120δkr-his as described below. Six hours after the transfection, the medium was exchanged to serum free CD293. Two days later, the conditioned supernatant was harvested and cellular debris was removed by centrifugation at 940x g and 4 C for 10 min and filtration through a 0.2 µm filter. The ph of the medium was raised by addition of 2 M Tris/HCl ph 8.8 until it turned dark red. Furthermore, CsCl 2 and MgCl 2 were added at final concentration of 1 mm, each. Subsequently, the medium was subjected to capillary flow affinity chromatography using Lentil Lectin Sepharose 4B (GE Healthcare) packed into an Econo-Column (1.0 x 10 cm; Bio-Rad). Bound proteins were eluted with 10 ml of 0.5 M methyl α-dmannopyranoside in PBS and loaded onto a Ni 2+ -NTA gravity flow column for further purification of the gp120 protein. After three washing steps each with 10 ml of 20 mm imidazole in PBS the protein was eluted with 250 mm imidazole in PBS. Finally, removal of imidazole by buffer exchange to PBS and concentration of the recombinant gp120 were achieved by ultrafiltration with a 30 kda cut-off device. 43

52 Materials and methods Determination of protein concentrations Total protein concentrations were determined with the BCA Protein Assay Kit (Pierce) according to the manufacturer s instructions. The 96-well plate procedure was used and the plates were analyzed in a Sunrise microplate reader (Tecan) at a wavelength of 550 nm. Concentrations of Gag and Env proteins in virus-like particle preparations were determined by ELISA. To this end, opaque high-binding 96-well plates were coated with 100 µl of serial dilutions of the different VLP preparations or several dilutions of purified gp120 and p24, respectively, in 0.1 M bicarbonate buffer ph 9.5 at 4 C over night. The next day, the plates were washed three times with washing buffer and blocked for 1 h at RT with 200 µl/well of 5% skimmed milk powder in washing buffer. Following three washing steps, 100 µl/well of 2G12 at a 1:10000 dilution or the antip24 antibody at a 1:500 dilution in washing buffer containing 2% skimmed milk powder were used to detect bound Env and Gag proteins. After 1 h incubation at RT, the plates were washed again as before. The HRP-coupled anti-human and antimouse antibodies were diluted 1:5000 and 1:2000 in washing buffer with 2% skimmed milk powder, respectively, and 100 µl/well were put on the plates for 1 h at RT, accordingly. Finally, the plates were washed five times and 50 µl of a home made ECL solution were added to each well. Luminescence signals were acquired on an Orion microplate luminometer (Berthold detection systems) Cytological methods Cultivation of cell lines In the course of the current study, several eukaryotic cell lines were used. All were cultivated in cell culture flasks (Greiner Bio-One) with 25, 75 or 175 cm 2 surface area in a humidified atmosphere with 5% CO 2 at 37 C. Depending on the growing characteristic of the individual cell lines, they were subcultured every two to three days at a ratio of 1:3 to 1:10. To this end, the culture medium was removed from adherent cells before thy were washed with 5-10 ml of PBS. Subsequently, ml Trypsin/EDTA solution (Gibco) was evenly distributed over the cells. Detachment was supported by incubation at 37 C. Complete growth medium was added to a final volume of 5-10 ml. The cells were resuspended by gentle pipetting 44

53 Materials and methods and ml were left in the cell culture flask or transferred into a new one. Additional growth medium was added to a final volume of 5-35 ml and the cells were cultivated at 37 C in a humidified atmosphere containing 5% CO 2. Suspension cell lines were subcultured by scraping, followed by resuspension in the conditioned medium and seeding of 1/10 to 1/3 of the volume into a cell culture flask. Afterwards, complete growth medium was added to a final volume of 5-30 ml and the cells were cultivated under the same conditions as the adherent cell lines. For long term storage, cells were resuspended in complete growth medium containing 10% DMSO, distributed into 2 ml cryo tubes and slowly adapted to -80 C in a cryo vessel. Finally, cells were kept in the vapor phase of a liquid nitrogen freezer. To start a new culture, cells were thawed and directly diluted 1 to 10 in complete growth medium. Subsequently, they were centrifuged for 6 min at 400x g and 4 C. The supernatant was discarded and the cells were seeded in fresh complete growth medium. Cell line Growth characteristic Complete growth medium: HEK 293T adherent DMEM, 10% FCS, 250 µg/ml Gentamycin HEK 293A adherent DMEM, 10% FCS, 250 µg/ml Gentamycin P815 suspension DMEM, 10% FCS, 250 µg/ml Gentamycin BW5147 suspension RPMI1640, 10% FCS, 1% Penicillin/Streptomycin, 50 µm β- mercaptoethanol Transfection of cells To verify the expression from plasmids used for immunization studies and for the production of recombinant gp120 or virus-like particles, HEK 293T were transfected with the respective expression plasmids using polyethyleneimine (PEI). For this purpose, HEK 293T cells were seeded to reach 60 to 90% confluence on the day of transfection. Per 25 cm 2 culture flask area a total of 10 µg plasmid DNA was diluted in 500 µl of serum-free DMEM. The solution was shortly mixed on a vortex mixer. Subsequently, 15 µl of 1 µg/µl PEI in H 2 O with a ph of 7.0 were added and the solution was thoroughly mixed on a vortex mixer, followed by an incubation at RT for 45

54 Materials and methods 15 min. In the meantime, the medium on the cells was exchanged with fresh complete growth medium. Afterwards, the transfection mixture was added to the cells and they were incubated at 37 C in a humidified atmosphere with 5% CO Transduction of cells Lentiviral and retroviral vectors were produced by co-transfection of HEK 293T cells with the necessary plasmids. For the lentiviral vectors, these included HIV-CS- CG, pctat-rev, Hgp Syn and phit-g. The retroviral vectors were generated using the plasmids phit-60, phit-g and plegfp or pl-conbgp140g/cd. Two days after transfection the supernatant was collected and filtered through a 0.2 µm filter to remove cellular debris, before it was used to transduce HEK 293A or P815 cells. One day prior to transduction, HEK 293A cells were disseminated into the wells of a 24-well plate. The next day, the conditioned medium was removed and 200 µl of the viral vector solution were given into the wells. For transduction of P815 suspension cells, cells were directly added to 200 µl of the viral vector solution. After 4-6 h incubation at 37 C in a humidified atmosphere containing 5% CO 2, 1 ml complete growth medium was added to the wells and the cells were further cultivated. If the cells were selected, the respective antibiotic was added one day after the transduction and the medium was renewed every 2-3 days Preparation of virus-like particles For the preparation of virus-like particles, HEK 293T cells were transfected with Hgp Syn and pconbgp140g/cd as described above ( ). Six hours later, the medium was changed to a 1:1 mixture of serum-free DMEM and AIM-V. On the second day post transfection, the conditioned medium was harvested and cellular debris was removed by centrifugation for 10 min at 940x g and 4 C and subsequent filtration through 0.45 µm filters. Virus-like particles were then purified and concentrated from the medium by ultracentrifugation through a 20% sucrose cushion prepared in PBS for 2.5 h at 90000x g and 4 C. Afterwards, the supernatant was discarded and the virus-like particles were resuspended in PBS. 46

55 Materials and methods Immunological methods Cytokine-specific ELISA Analysis of cytokine secretion from in vitro re-stimulated splenocytes was performed with Ready-SET-Go! ELISA Kits (ebioscience) specific for IL4, IL5, IL10 and IL13 according to the manufacturer s instructions. Corning high-binding 96-well microplates were used. Culture supernatants were diluted in 1x ELISA diluent and incubated with the capture antibody coated ELISA plates over night at 4 C. All washing steps were performed with five washings, except the final step that was performed with seven. Finally, the TMB reaction was stopped with 1 M H 3 PO 4, before absorbance was analyzed on a Sunrise microplate reader (Tecan) at 450 nm with 620 nm as the reference wavelength. Secretion of IL5 and IL6 from HEK 293T cells transfected with the respective plasmids was performed with ELISA MAX Standard Kits (BioLegend) on Nunc MaxiSorp 96-well plates according to the manufacturer s instructions. The TMB reaction was stopped with 2 N H 2 SO 4 and the absorbance was analyzed on a Sunrise microplate reader (Tecan) at 450 nm. IL2 secretion from Fcγ receptor reporter cell lines was analyzed by a home made ELISA. Nunc MaxiSorp 96-well plates were coated with 50 µl/well of the IL2 capture antibody diluted 1:500 in bicarbonate buffer at 4 C over night. The next day, the plates were washed three times with washing buffer and blocked for 1 h at RT with 10% FCS in washing buffer. After another three washes, 100 µl of the Fcγ receptor reporter cell culture supernatants were transferred to the ELISA plate. Additional serial two-fold dilution of recombinant IL2 in washing buffer containing 10% FCS starting at 2000 pg/ml were prepared and 100 µl/well were used as standards in duplicates for each ELISA plate. The plates were incubated for 1.5 h at RT, before they were washed again three times and 50 µl/well of the biotinylated IL2 detection antibody diluted 1:500 in washing buffer containing 10% FCS were added. Following an incubation for 1 h at RT and three washes, 50 µl/well of HRP-conjugated streptavidin diluted 1:1000 in washing buffer containing 10% FCS were put on the plates and incubated for another 30 min. Finally, plates were washed five times and 50 µl/well TMB solution was used to detect bound IL2. The TMB reaction was 47

56 Materials and methods stopped with 1 M H 3 PO 4, before absorbance was analyzed on a Sunrise microplate reader (Tecan) at 450 nm with 620 nm as the reference wavelength Immunization of mice All immunization experiments were conducted with 6-8 weeks old BALB/cJRj (Janvier) mice. The animals were housed in individually ventilated cages in groups of 3-4 mice with access to water and feed ad libitum. Before the experiments were started, animals were allowed to accustom to the new keeping conditions for 1-2 weeks. DNA immunizations were performed under Ketamine/Xylazine (100 mg/kg and 15 mg/kg, respectively) anesthesia applied intraperitoneally. The DNA immunogens were diluted in sterile 0.9% NaCl solution to concentrations ranging from 200 ng/µl to 400 ng/µl, depending on the experiment. Both hind legs of the mice were shaved. The TriGrid electrode array (Ichor Medical Inc.) with 2.5 mm electrode spacing bearing the centered injection needle was inserted into the musculus gastrocnemius and 50 µl of the DNA solution were injected, immediately followed by the local application of electric signals of 63 V and 40 ms total duration. The procedure was repeated for the second leg. The VLP vaccines were applied subcutaneously into both hind foot pads. The animals received a total amount of 400 ng of Env protein diluted in 100 µl sterile PBS Collection of sera and PBMCs To monitor humoral immune responses, blood was collected with 10 µl heparinized hematocrit capillaries by puncture of the retro orbital sinus. Sera were obtained after 5 min centrifugation at 2600x g in a table top centrifuge and stored at -20 C until further use. If the cellular immune responses were analyzed, 2.5 U heparin were placed into the 1.5 ml reaction tubes used to collect the blood. The blood samples were centrifuged for 5 min at 2600x g in a table top centrifuge and the serum was kept for antibody assays. The sedimented PBMCs were resuspended in a total volume of 5 ml ACK buffer and the erythrocytes were lysed for 12 min at RT. Subsequently, 9 ml of HBSS were added to stop the lysis and the cells were centrifuged for 6 min at 48

57 Materials and methods 400x g and 4 C. Except for approximately 500 µl, the supernatant was discarded. The cells were resuspended in the remaining volume and distributed to the wells of a 96-well plate. After centrifugation at 940x g and 4 C for 2.5 min, the supernatant was again discarded, the cells were resuspended in 100 µl of R10/well and subjected to in vitro re-stimulation ( ) Preparation of lymphocytes Lymphocytes from spleens were used to monitor cellular immune responses. For purification of CD4 + T cells for the adoptive transfer, additional lymphocytes were obtained from popliteal and inguinal lymph nodes. To this end, animals were sacrificed and their spleens and respective lymph nodes were collected in 5 ml HBSS. Single cell suspensions were prepared by forcing the cells through 70 µm cell strainer using a 5 ml syringe plunger. The cell strainer were washed with 5 ml HBSS and the whole 10 ml cell suspension was centrifuged for 6 min at 400x g and 4 C. After discarding the supernatant, splenocytes were resuspended in 1 ml ACK buffer to lyse erythrocytes. Following a 7 min incubation at room temperature, the lysis was stopped by addition of 9 ml HBSS. Cell pellets from lymph nodes were not subjected to red blood cell lysis, but washed once with 5 ml of HBSS. Subsequently, cells were centrifuged again for 6 min at 400x g and 4 C. Finally, the supernatant was discarded, before the cells were resuspended in R10 medium In vitro re-stimulation of lymphocytes To monitor cellular immune responses, lymphocytes recovered from spleen or peripheral blood were re-stimulated in vitro and analyzed for their cytokine production profile either by intracellular cytokine staining (ICS) or cytokine specific ELISA. ICS was performed with splenocytes and PBMCs. For this purpose, splenocyte suspensions were adjusted to 10 7 cells/ml with R10 and 100 µl/well were distributed to the wells of a 96-well plate. If PBMCs were used, all cells recovered were distributed equally to the wells of a 96-well plate, centrifuged and resuspended in 100 µl of R10 medium as described above ( ). The cells were re-stimulated with MHC class I and/or class II restricted peptides at a final concentration of 5 µg/ml in the presence of 2 µm monensin at 37 C in a humidified atmosphere containing 5% CO 2. If CD8 + T cells were analyzed, a FITC-conjugated anti-cd107a antibody 49

58 Materials and methods was included at a 1:200 dilution, while it was necessary to add an anti-cd28 antibody at a final concentration of 1 µg/ml for the analysis of CD4 + T cells. Positive controls were stimulated with anti-cd3 (2 µg/ml) and anti-cd28 (1 µg/ml) antibodies. The stimuli were prepared in 100 µl R10 medium/well, leading to a final volume of 200 µl per well during the stimulation. Six hours later, the plates were centrifuged for 2.5 min at 940x g and 4 C and the cells were subjected to ICS. To analyze the antigen-specific cytokine secretion by ELISA, only splenocytes were used. Five hundred micro liters of the splenocyte suspension containing 10 7 cells/ml were distributed into wells of a 24-well plate. Subsequently, the cells were re-stimulated with 5 µg/ml MHC class II restricted peptides in the presence of 1 µg/ml anti-cd28 antibody. The stimuli were again prepared in 100 µl R10 medium/well, resulting in a final volume of 600 µl/well and the stimulation was performed for 48 h at 37 C in a humidified atmosphere containing 5% CO 2. Afterwards, the 24-well plates were centrifuged for 2.5 min at 940x g and 4 C and the supernatants were collected for cytokine specific ELISA Intracellular cytokine staining Re-stimulated splenocytes were washed by resuspension in 200 µl FACS buffer/well, centrifugation for 2.5 min at 940x g and 4 C and discarding the supernatant. All centrifugation steps within this protocol were performed the same way. Subsequently, the cells were resuspended in 100 µl FACS buffer containing the antibodies for the surface staining. These included anti-cd4 PerCP, anti-cd4 PerCP-eFluor710, anti-cd8a PerCP and anti-cd8a PerCP-eFluor710. To discriminate between live and dead cells, a fixable viability dye (efluor 780) was included in most stainings. The surface staining was performed for 20 min at RT in the dark followed by the addition of 100 µl PBS to each well. The plates were centrifuged and washed once with 200 µl PBS/well, before the cells were resuspended in 100 µl PBS. Next, the cells were fixed by addition of 100 µl 4% paraformaldehyde in PBS. Fixation was conducted for 20 min at RT in the dark. Afterwards, the cells were washed two times with FACS buffer. Following permeabilization of the cells by a 10 min incubation in 150 µl permeabilization buffer/well containing Fc block at a 1:300 dilution, intracellular cytokine staining was performed. Respective antibodies were diluted in 100 µl permeabilization buffer/well 50

59 Materials and methods and included anti-ifnγ PE, anti-tnfα AlexaFluor-488, anti-tnfα PE-Cy7 and anti- IL2 APC. The staining was conducted for 30 min at RT in the dark. Subsequently, 100 µl/well of permeabilization buffer were added and the plates were centrifuged. After two washing steps with permeabilization buffer and one washing step with FACS buffer, the cells were finally resuspended in 250 µl FACS buffer and subjected to flow cytometry on a FACScalibur (BD Biosciences) or FACSCanto II (BD Biosciences). The data acquired was analyzed using Tree Star Flowjo software Surface staining of cells Surface staining of cells was performed to confirm the identity of a cell population or to verify cell surface expression of specific proteins. To this end, cells were harvested by centrifugation for 6 min at 400x g and 4 C and washed with FACS buffer. Afterwards, cells were distributed to the wells of a 96-well plate in FACS buffer and centrifuged for 2.5 min at 940x g and 4 C. After discarding the supernatant, the cells were stained with antigen-specific antibodies diluted in 100 µl FACS buffer/well for 20 min at RT in the dark. These antibodies included anti-p24, anti-gp120, anti-gp120 AlexaFluor647, anti-cd4 PerCP-eFluor710, anti-cd19 APC and anti-cd3 FITC as well as murine sera. The cells were washed twice with FACS buffer. In case the antigen-specific antibodies were not fluorescently labeled, appropriate secondary antibodies carrying a suitable fluorescent dye were used in a subsequent staining under the same conditions as before. Subsequently, the cells were washed again for two times with FACS buffer. Finally, the cells were resuspended in 250 µl FACS buffer/well and subjected to flow cytometric analysis on a FACSCalibur (BD Biosciences) or FACSCanto II (BD Biosciences) device. Where indicated, 5 µl of the viability dye 7-AAD were added to the samples at least 5 min before acquisition. The data acquired was analyzed using Tree Star Flowjo software Isolation of CD4 + T cells and adoptive transfer Preparation of CD4 + T cells for the adoptive transfer experiment was performed by negative selection with the CD4 + T Cell Isolation Kit II (Miltenyi Biotec) under sterile conditions. To this end, lymphocytes from spleens and lymph nodes were pooled by group, counted and resuspended in the recommended volume of MACS buffer. Subsequently, isolation was performed on LS columns (Milteyni Biotec) 51

60 Materials and methods according to the manufacturer s instructions. Afterwards, isolated CD4 + T cells were centrifuged for 10 min at 300x g and 4 C, washed once with PBS and resuspended in a total volume of 700 µl. Finally, the CD4 + T cells were adoptively transferred via the tail vein. Each animal received approximately one animal equivalent of cells in 100 µl of PBS Antigen-specific antibody ELISA Humoral immune responses against Env and Gag in murine sera were determined by antigen-specific ELISA. Therefore, gp120 or GST-p55 were diluted in 0.1 M bicarbonate buffer (ph 9.5) to a final concentration of 1 µg/ml and 1.5 µg/ml, respectively. One hundred microliter of the diluted antigens were distributed to the wells of opaque high-binding 96-well ELISA plates and incubated over night at 4 C to coat the antigens. The next day, plates were washed three times with washing buffer and remaining protein binding sites were blocked by incubation with 5% skimmed milk powder in washing buffer for 1 h at RT. Murine sera were diluted in 2% skimmed milk powder in washing buffer. After additional three washing steps 100 µl/well of the diluted sera put in the wells of the ELISA plate for 1 h at RT. Excess and unspecific antibodies were washed off by three washing steps and bound antibodies were detected with 100 µl/well of HRP-conjugated anti-igg1 or anti-igg2a detection antibodies diluted 1:1000 in 2% skimmed milk powder in washing buffer. Following an incubation for 1 h at RT, the plates were washed five times to remove excess detection antibodies. Finally, 50 µl of a home made ECL solution were added to each well and luminescence signals were acquired on an Orion microplate luminometer (Berthold detection systems). Acquired data was logarithmically transformed, before it was used for statistical analysis and graphical representation Immunoprecipitation Immunoprecipitation was performed to verify the incorporation of Env and Gag into the same viral particles and to show that antibody accessible Gag can still be attached to Env. In both cases, 50 µl of protein G coupled dynabeads (Life Technologies) were employed and freed from their supernatants by using a magnetic stand. For the Gag immunoprecipitation, the beads were washed two times with

61 Materials and methods µl PBS containing 5% BSA. The beads were resuspended a third time in 250 µl PBS + 5% BSA and incubated for 1 h at 4 C on an end over end mixer to block unspecific protein binding with the BSA. Afterwards, 20 µg of the monoclonal antip24 antibody were added to the blocking reaction for another hour at 4 C under constant mixing. Excess antibody was removed by washing five times with 1 ml PBS + 5% BSA. Subsequently, the different VLP preparations were diluted in PBS + 5% BSA to a final volume of 100 µl. A total amount of µg of Env was used and where indicated Triton X-100 was added to the samples 15 min prior to the immunoprecipitation. The beads were resuspended in the VLP dilutions and incubated as before. After 1 h, the beads were washed five times with 1 ml PBS, before the bound proteins were eluted by heating the beads in 30 µl SDS sample buffer for 5 min at 95 C. The protein-containing SDS sample buffer was recovered after centrifugation at 20800x g for 5 min in a table top centrifuge and subjected to SDS-PAGE. For the Env immunoprecipitation, the beads were resuspended in PBS with 0.05% Tween 20 containing 12 µg of the human anti-env antibody 2G12. After a 30 min incubation at RT, the beads were washed once with 200 µl of PBS with 0.05% Tween 20 and once with PBS without Tween 20. Subsequently, the beads were resuspended in 100 µl of the different VLP preparations diluted in PBS and incubated for 30 min at RT with intermittent mixing by gentle pipetting or flicking of the reaction tube. A total of 500 ng - 1 µg of Env were used and the VLPs lacking Env were adjusted to the same amount of Gag. Afterwards, the supernatant was removed and the beads were washed three times with 200 µl PBS. To reduce background signals during antigen detection, the beads were resuspended in 100 µl PBS and transferred into a new reaction tube. After removal of the supernatant, bound proteins were eluted by boiling the beads in 30 µl SDS sample buffer for 5 min at 95 C. The protein-containing SDS sample buffer was recovered as described above and subjected to SDS-PAGE Fcγ receptor activation assay To analyze the Env-specific Fcγ receptor activation profile of murine sera, respective reporter cell lines for the Fcγ receptors II, III and IV were employed. Murine sera were diluted 1:100 in PBS and the dilution was used to resuspend 2 53

62 Materials and methods 10 5 of transduced P815Env or parental P815 cells in conical 96-well plates. These antigen presenting cells were incubated with the different serum dilutions for 30 min at RT. Subsequently, 100 µl of PBS was added to each well, the plates were centrifuged for 2.5 min at 940x g and 4 C and the supernatants were discarded. After a washing step with 200 µl PBS, opsonized antigen presenting cells were mixed with cells of the respective Fcγ receptor reporter cell lines in complete growth medium. The co-cultures were incubated for 16 h at 37 C in a humidified atmosphere containing 5% CO 2, before 100 µl of PBS with 0.05% Tween 20 were added to each well. The cell suspensions were mixed by pipetting up and down five times, before they were centrifuged for 2.5 min at 940x g and 4 C and the supernatants were subjected to IL2-specific ELISA ( ). 54

63 Results 3 Results 3.1 Production of HIV-1 Env and Gag antigens for ELISA To monitor the induction of humoral immune responses against HIV-1 Env and Gag by ELISA, respective antigens were produced. The Gag protein was expressed as a GST-p55 fusion protein from the pgex-gag plasmid in E. coli and batch purified from bacterial lysates with glutathione- (GSH-)coupled sepharose beads. A Bacterial lysate Bacterial supernatant Bead supernatant 1. Wash 2. Wash Marker 3. Wash 1. Elution 2. Elution 3. Elution B Bacterial lysate Bacterial supernatant Bead supernatant 1. Wash 2. Wash 3. Wash 1. Elution 2. Elution 3. Elution 150 kda 150 kda 75 kda GSTp55 75 kda GSTp55 50 kda 50 kda 37 kda 37 kda 25 kda 25 kda Figure 3.1: Purification of recombinant GST-p55 protein. The GST-p55 fusion protein was expressed in pgex-gag transformed E. coli by IPTG induction. Subsequently, the fusion protein was batch purified from bacterial lysates with GSH-coupled sepharose. Individual steps of the purification process were checked by SDS-PAGE and either Coomassie staining (A) or Western blot with subsequent analysis using a monoclonal anti-p24 antibody and a respective HRP-conjugated detection antibody. The purified protein showed a characteristic banding pattern in Western blot analysis between 50 kda and 80 kda, which has been reported before (Fig. 3.1B). Although the fusion protein did not bind quantitatively to the GSH matrix, as indicated by the aforementioned banding pattern in the bead supernatant, substantial amounts were recovered from the beads with each of the three elution steps. The amount recovered was dependent on the elution time, since elution three was incubated for the longest time and contained the highest concentration of the fusion protein. Coomassie staining revealed additional proteins in the final preparation, although the three washing steps seemed sufficient to remove unspecifically bound protein (Fig 3.1A). These may be degradation products of the fusion protein that lost the epitope of the anti-p24 antibody or bacterial proteins that aggregated to GST-p55. Since the vaccine antigen is not derived from E. coli the preparation was considered suitable 55

64 Results for the detection of Gag-specific humoral immune responses by ELISA, despite the contaminations and the non quantitative recovery of the fusion protein. Since the Env protein is heavily modified during trafficking through the endoplasmic reticulum and the Golgi apparatus, it was necessary to produce the respective antigen for ELISA in a eukaryotic cell culture. To this end, a consensus clade B gp120 expression plasmid was generated that contained the tissue plasminogen activator leader peptide for enhanced secretion and a N-terminal Histag for subsequent purification. In addition, the last two amino acids (lysine and arginine) were deleted to disrupt the furin cleavage site. Six hours after transfection of 293T cells, the cell culture medium was exchanged to serum free medium, to reduce the amount of bovine serum proteins in the supernatants. Two days later, the recombinant gp120 was purified from the conditioned medium by a two step procedure. A 150 kda 75 kda Supernatant LLA flow through LLA eluate Ni 2+ NTA flow through Marker Ni 2+ NTA wash Ni 2+ NTA eluate 30 kda flow through 30 kda concentrate gp120 B 150 kda 75 kda Supernatant LLA flow through LLA eluate Ni 2+ NTA flow through Ni 2+ NTA wash Ni 2+ NTA eluate 30 kda flow through 30 kda concentrate gp kda 50 kda 25 kda 25 kda Figure 3.2: Purification of recombinant gp120 protein. The recombinant protein containing a polyhistidine tag was expressed in 293T cells and purified from the cell culture supernatant by lentil lectin affinity chromatography with subsequent Ni 2+ -NTA chromatography. Individual steps of the purification process were checked by SDS-PAGE and either Coomassie staining (A) or Western blot with subsequent analysis with a polyclonal anti-gp120 antibody and the respective HRP-conjugated detection antibody. The picture of the Coomassie stained SDS-PAGE was processed in its entirety to increase the visibility of faint protein bands. First, glycoproteins were concentrated from the supernatant by affinity chromatography using a lentil lectin agarose (LLA) matrix. A significant amount of the gp120 protein was retained on the LLA column, since the Western blot signal in the LLA flow through was weaker than in the supernatant (Fig. 3.2B). In contrast, most unspecific proteins passed through the LLA column, as can be seen in the Coomassie staining (Fig. 3.2A). The gp120 was further purified from the LLA eluate with a Ni 2+ -NTA chromatography column. The final product appeared as a smear 56

65 Results between 75 kda and 150 kda in Western blot analysis (Fig. 3.2B) and Coomassie staining (Fig. 3.2A) due to the inhomogeneous glycosylation of the over-expressed gp120 protein. 3.2 DNA immunization approaches The potential of DNA vaccines to induce cellular and humoral immune responses against different pathogens has been reported before. Furthermore, the immune responses to Env- and Gag-derived antigens seem to differ in infected individuals. Finally, qualitative differences in the humoral immune response against Env seem to be responsible for the different efficacies observed in vaccine trials employing recombinant gp120 as an antigen. Therefore, in the first part of the thesis the immune responses induced by combined DNA vaccines containing Env- and GagPol-encoding plasmids were thoroughly analyzed Humoral immune responses to a combined HIV-1 Gag and Env DNA vaccine As a first step, the humoral immune responses against Gag and Env induced by a combinatory DNA vaccine applied by intramuscular electroporation were analyzed by ELISA using the newly produced antigens. To test for any influence of the quaternary structure of the Env protein, expression plasmids encoding different forms of HIV-1 Env were used. These were all based on the codon optimized consensus clade B expression plasmid pconbgp160opt (gp160). The plasmid pconbgp140g/cd (gp140gcd) encodes the consensus clade B envelope in which the cytoplasmic domain is replaced with the one from the G protein of the vesicular stomatitis virus (VSV-G). This modification led to decreased cytotoxicity and increased incorporation of Env proteins into virus-like particles. In addition, two plasmids coding for different soluble forms of Env were included. The plasmid pv- ConBsgp140 (sgp140) encodes the whole ectodomain of the uncleaved form of ConBgp160, while the pv-conbsgp140ft (sgp140trim) encodes for the same protein with an additional heterologous trimerization domain fused to the N-terminus. 57

66 Results d DNA ELISA DNA ELISA Figure 3.3: Immunization schedule for the combined DNA prime/boost immunization. On day 0 and day 21 BALB/c mice were immunized with 10 µg of a codon-optimized consensus clade B Env expression plasmid or pcdna3.1 as an empty vector control together with 10 µg of Hgp Syn by intramuscular DNA electroporation into the hind legs. Eighteen days after the first and 14 days after the second immunization blood was collected by retro-orbital puncture and sera were subjected to HIV-1 gp120- and p55-specific ELISA. BALB/c mice were immunized twice in a three week interval by intramuscular DNA electroporation with the different HIV-1 Env expression plasmids in combination with the codon optimized HIV-1 GagPol expression plasmid Hgp Syn (subsequently denoted GagPol). Since IgG1 and IgG2a are representative of qualitatively different immune responses, their Env- and Gag-specific levels were determined 18 days after the prime immunization and two weeks after the booster immunization by antigen-specific ELISA (Fig. 3.3). A Prime B Boost Env antibodies (log RLU/s) C gp140gcd gp160 sgp140trim * **** *** sgp140 pcdna gp140gcd gp160 Prime IgG1 IgG2a sgp140trim sgp140 pcdna Env antibodies (log RLU/s) D **** **** **** **** ** **** **** ** gp140gcd gp160 sgp140trim sgp140 pcdna gp140gcd gp160 sgp140trim sgp140 pcdna Boost Gag antibodies (log RLU/s) gp140gcd gp160 sgp140trim sgp140 pcdna gp140gcd gp160 sgp140trim sgp140 pcdna gp140gcd gp160 sgp140trim sgp140 pcdna gp140gcd gp160 sgp140trim sgp140 pcdna Figure 3.4: Humoral immune responses against Env and Gag after DNA immunization. IgG1 and IgG2a antibody responses against gp120 (A and B) or p55 (C and D) were determined by antigen-specific ELISA. The respective antibody levels were analyzed 18 days after the prime immunization at a 1:100 dilution (A and C) and 14 days after the boost immunization at a 1:1000 dilution (B and D) and depicted as means + SEM. Statistical significance of differences was determined by one-way ANOVA followed by Tukey's post test (n = 5-6; * = p < 0.05 vs. pcdna; ** = p < 0.01 vs. pcdna; *** = p < vs. pcdna; **** = p < vs. pcdna). Gag antibodies (log RLU/s)

67 Results A single intramuscular DNA electroporation induced significant antibody responses against gp120 in mice that received plasmids expressing the soluble or the parental Env constructs. These responses consisted solely of the IgG1 subclass (Fig. 3.4A). The second immunization boosted the antibody responses against Env in all groups. Although significant amounts of gp120-specific IgG2a antibodies were detectable, IgG1 was still the predominant subtype (Fig. 3.4B). In consequence, Envspecific IgG2a/IgG1 ratios after the boost immunization were all below one, exemplifying the IgG1 predominance. Despite the slight differences in IgG1 responses, there were no significant differences in the ratios (Fig. 3.5). Ratio IgG2a/IgG gp140gcd ** * ** ** gp160 sgp140trim sgp140 pcdna Gag Env Figure 3.5: Env- and Gag-specific IgG2a/IgG1 ratios after two DNA immunization. The individual ratios were calculated with untransformed RLU/s values derived from sera collected after the second DNA immunization. The bars represent geometric mean values. No statistical significance of differences was found between the groups for Env- or Gag-specific ratios after analysis with Kruskal-Wallis test followed by Dunn's post test. Statistical significance of differences between the two ratios within one group was determined by Mann- Whitney test (* = p < 0.05; ** = p < 0.01) The Gag-specific humoral immune responses exhibited different properties. In contrast to Env, a single DNA immunization did not lead to significant IgG1 or IgG2a responses against Gag (Fig. 3.4C). Consequently, the total humoral immune response against Gag remained much lower than against Env (Fig. 3.4A). The subsequent boost immunization induced significant amounts of Gag-specific antibodies of both subclasses with IgG2a always contributing at least equally to the total antigen specific antibody response (Fig. 3.4D and 3.5). While the co-applied gp140-based Env constructs did not demonstrate an influence on the Gag-specific humoral immune response, co-immunization with the parental gp160 expression plasmid seemed to reduce the IgG1 and IgG2a antibody levels against Gag. Taken together, the very same animals mounted different humoral immune responses against the two separate antigens that they received in combination. The phenomenon became even more obvious when the individual IgG2a/IgG1 ratios were calculated for the antibody responses against the two antigens (Fig. 3.5). The 59

68 Results Env-specific IgG1 predominance was not dependent on the quaternary structure in this setup and thus seemed antigen-inherent. It was therefore tried to modulate the Env-specific humoral immune response by co-application of cytokine expressing plasmids as genetic adjuvants. Given the minor impact on the Gag-specific humoral immune response and a structure that probably resembles the native Env protein more closely, the pconbgp140g/cd was used in subsequent DNA immunizations as the Env antigen (subsequently denoted as Env) Co-application of cytokine expressing plasmids to modulate the immune response As a first step, respective cytokine expression plasmids were cloned. Cytokines to be tested included the prototypic T H 1 cytokine interleukin 12 (IL12), the proinflammatory cytokine IL6 and the recently discovered antiviral cytokines IL28A and IL28B. In addition, IL5 was used to analyze, whether a T H 2 cytokine could exacerbate the IgG1 bias of the Env-specific humoral immune response. To generate the expression plasmids for IL5 and IL6, murine splenocytes were stimulated with LPS in vitro. Subsequently, total RNA was isolated and used to generate mrna derived cdna. The coding regions for IL5 and IL6 were amplified from the cdna and cloned into the pvax plasmid upstream of an Ollas and His tag. The expression plasmids for IL28A and IL28B were generated accordingly, with the exception that homogenized lungs from influenza A virus infected mice served as the RNA source. Expression was verified by Western blot analyses of transfected 293T cell supernatants with the anti-ollas antibody and by IL5 and IL6 specific ELISA. Subsequently, the Ollas sequence was deleted to minimize the risk of anti-adjuvant responses. Finally, the IL12 expression plasmid was purchased from Invivogen. BALB/c mice were immunized as before by intramuscular DNA electroporation with vaccine formulations consisting of the HIV-1 Env and GagPol expression plasmids together with a cytokine expression plasmid or the empty pcdna vector as a control (Fig. 3.6). 60

69 Results d DNA ELISA DNA ICS ELISA ELISA rvv-gag qpcr Figure 3.6: Immunization schedule for the DNA immunization with genetic adjuvants. On days 0 and 21 BALB/c mice (n = 10) were immunized by intramuscular DNA electroporation with a combination of 10 µg pconbgp140g/cd, 10 µg Hgp Syn and 10 µg of a cytokine expression plasmid or pcdna as control. Fourteen days after the first and 14 and 34 days after the second immunization HIV-1 gp120- and p55-specific antibody responses were determined by antigen-specific ELISA. Additionally, 14 days after the second immunization spleens of four mice per group were collected and splenocytes were subjected to ICS. On day 56, remaining animals were intranasally challenged with 50,000 PFU rvv-gag and their body weight was monitored daily. Six days post infection the animals were sacrificed and the viral loads in the lungs were determined by qpcr. After the priming, all immunized animals developed Env-specific IgG1 antibody responses, but only in the groups that were co-inoculated with the plasmids encoding IL6, IL12 or one of the IL28 variants this immune response reached statistical significance. Furthermore, co-application of the IL12 or IL28B expression plasmid led to significantly higher IgG1 responses against Env compared to the pcdna control group. On the contrary, none of the genetic adjuvants tested was able to support the induction of IgG2a antibodies against Env after the first immunization (Fig. 3.7A). The second immunization led to a boost in the Env-specific humoral immune response in all groups that received the Env encoding plasmid. Although IgG2a antibodies were induced in significant amounts in all groups, the IgG1 response was still highly predominant (Fig. 3.7B) and the genetic adjuvants did not significantly affect the IgG2a/IgG1 ratios (Fig. 3.8A). The effect of the co-application of cytokine expressing plasmids on the humoral immune response against Gag was even less pronounced. No significant Gagspecific antibody responses were detectable after the prime immunization (Fig. 3.7C). The boost immunization induced similar IgG1 and IgG2a responses against Gag in all groups without significant differences between the individual groups (Fig. 3.7D). Consequently, Gag-specific IgG2a/IgG1 ratios were balanced without significant impact of the co-applied cytokine encoding plasmids (Fig. 3.8B) 61

70 Results A Env antibodies (log RLU/s) C Gag antibodies (log RLU/s) * **** *** **** + pcdna + IL5 + IL6 + IL12 + IL28A + IL28B naive + pcdna + IL5 + IL6 + IL12 + IL28A + IL28B naive Prime Prime IgG1 IgG2a + pcdna + IL5 + IL6 + IL12 + IL28A + IL28B naive + pcdna + IL5 + IL6 + IL12 + IL28A + IL28B naive + pcdna + IL5 + IL6 + IL12 + IL28A + IL28B naive + pcdna + IL5 + IL6 + IL12 + IL28A + IL28B naive Figure 3.7: Humoral immune responses against Env and Gag after DNA immunization with genetic adjuvants. IgG1 and IgG2a antibody responses against gp120 (A, B) and p55 (C, D) were analyzed by antigen-specific ELISA. The respective antibody levels were determined 14 days after the prime immunization at a 1:50 dilution (A) and a 1:100 dilution (C), respectively. Dilutions for sera from 14 days after the boost immunization were 1:500 (B) and 1:1000 (D), respectively. Depicted are means + SEM. Statistical significance of differences was determined by one-way ANOVA followed by Tukey's post test (n = 5-6; * = p < 0.05 vs. naive; ** = p < 0.01 vs. naive; *** = p < vs. naive; **** = p < vs. naive; + = p < 0.05 vs. pcdna). B Env antibodies (log RLU/s) D Gag antibodies (log RLU/s) **** **** **** **** **** **** *** **** **** **** **** **** *** **** **** **** **** **** **** **** **** **** **** **** + pcdna + IL5 + IL6 + IL12 + IL28A + IL28B naive Boost Boost + pcdna + IL5 + IL6 + IL12 + IL28A + IL28B naive To get an indication for the longevity of the respective responses, antibody levels were also determined five weeks after the second DNA immunization. Significant Env-specific IgG1 responses were still evident in all immunized groups. In addition, in the IL28B immunized group Env-specific IgG1 showed a trend towards increased levels, while they seemed slightly reduced in the IL12 group. This led to a significant difference between these two groups. IgG2a responses against Env were still substantially lower than IgG1 responses. Probably as a consequence of the increased serum dilution, they only reached significant levels in the IL28A and IL28B co-immunized groups, confirming the trend of these cytokines to enhance the Envspecific humoral immune responses. Additionally, only in the IL28A co-immunized group this response was significantly different from the immunized pcdna control group (Fig. 3.9A). 62

71 Results A 1 Env B 100 Gag Ratio IgG2a/IgG Ratio IgG2a/IgG pcdna + IL5 + IL6 + IL12 + IL28A + IL28B + pcdna + IL5 + IL6 + IL12 + IL28A + IL28B Figure 3.8: Env- and Gag-specific IgG2a/IgG1 ratios after DNA immunization with genetic adjuvants. The individual ratios were calculated with untransformed RLU/s values derived from sera collected after the second DNA immunization. The bars represent geometric mean values. No statistical significance of differences was found after analysis with Kruskal-Wallis test followed by Dunn's post test. 0.1 For the Gag-specific humoral immune responses five weeks after the second DNA immunization the results were again different. Due to the increased dilution, only in the groups that received IL6, IL28A or IL28B as a genetic adjuvant, Gagspecific IgG1 responses reached levels that were significantly different from naive animals. In contrast, all immunized groups still exhibited significant Gag-specific IgG2a responses. Although no substantial differences between the groups were observed, these responses tended to be lower in the pcdna and the IL12 group (Fig. 3.9B). A Env antibodies (log RLU/s) # IgG1 + **** **** **** **** **** **** IgG2a *** * + pcdna + IL5 + IL6 + IL12 + IL28A + IL28B naive + pcdna + IL5 + IL6 + IL12 + IL28A + IL28B naive B Figure 3.9: Humoral immune responses five weeks after DNA immunization with genetic adjuvants. IgG1 and IgG2a antibody responses against gp120 (A) and p55 (B) were analyzed by an antigen-specific ELISA. The respective antibody levels were determined 34 days after the boost immunization at a 1:2000 dilution and depicted as means + SEM. Statistical significance of differences was determined by one-way ANOVA followed by Tukey's post test (n = 5-6; * = p < 0.05 vs. naive; ** = p < 0.01 vs. naive; *** = p < vs. naive; **** = p < vs. naive; + = p < 0.05 vs. pcdna; # = p < 0.05 vs. IL12). Gag antibodies (log RLU/s) pcdna + IL5 + IL6 + IL12 * * ** *** **** **** ** **** **** + IL28A + IL28B naive + pcdna + IL5 + IL6 + IL12 + IL28A + IL28B naive In summary, the co-application of different cytokine expressing plasmids clearly demonstrated an impact on the induced humoral immune responses. Since the 63

72 Results effects were most evident at either early or late time points, they influenced rather the kinetics than the phenotype of the humoral immune responses. In addition, they differed depending on the respective antigen. Although IL28A seemed to increase the Env-specific IgG2a response, especially at the late time point, IgG1 was still the dominant subtype. As outlined in the introduction, sterilizing immunity against HIV-1 is generally considered to depend on protective antibodies, while cellular immunity may help to delay the progression to AIDS and reduce the risk of transmission by lowering the viral load. In addition, preclinical studies in the macaque model also demonstrated CTL mediated control or clearance of pathogenic SIV, which was dependent on an effector memory phenotype of the antigen specific CD8 + T cell response. Thus, the ability of the DNA vaccine regimens to induce CTL responses was also analyzed. To this end, intracellular cytokine staining was used to quantify the Gag- and Env-specific CD8 + T cell responses and to determine their quality in animals that received Env and GagPol in conjunction with the different cytokine expression plasmids by intramuscular DNA electroporation (Fig. 3.6). Two weeks after the boost immunization, splenocytes were re-stimulated in vitro with immunodominant MHC class I restricted Gag- or Env-derived peptides and surface stained for the presence of CD8 as a lineage and CD107a as a degranulation marker to assess their cytotoxic potential. In addition, polyfunctionality of antigen specific T cells has been associated with control of viral replication (194). Thus, splenocytes were intracellularly stained for the presence of IFNγ, which mediates non-lytic antiviral activity, and the T cell proliferation factor IL2, as a marker for the ability to sustain the antigen-specific T cell response. All immunized animals developed substantial Gag-specific CD8 + T cell responses with at least two functions, as indicated by the concomitant expression of CD107a on the surface and IFNγ intracellularly. Probably because of the many different groups and the little number of animals per group (n = 4), these results did not reach statistical significance. The co-application of the cytokine expression plasmids did not seem to affect the T cell response much, although the IL28A and IL28B coimmunized animals showed a trend towards lower responses. Approximately half of the Gag-specific CD8 + T cells were polyfunctional, as determined by IL2 coexpression. Since the co-application of most of cytokine expressing plasmids slightly 64

73 Results reduced these CD107 + IFNγ + IL2 + responses, only the pcdna and IL6 groups reached statistical significant levels compared to naive animals (Fig. 3.10A). The Env-specific CD8 + T cell responses were even stronger after two DNA immunizations. All immunized animals demonstrated statistically significant IFNγ and IL2 producing CD8+ T cell responses. In contrast to Gag-specific CD8 + T cells, the co-application of IL5 and IL28B as genetic adjuvants seemed to increase Envspecific CD8 + T cells. This increase was most prominent in the CD107 + IFNγ + population, although the differences between the immunized groups did not reach statistical significance (Fig. 3.10B). A Gag % of CD8+ T cells 4 * * * * * * CD107 + nc nc + + IFN nc + nc + + IL2 nc nc pcdna + IL5 + IL6 + IL12 + IL28A + IL28B naive B 10 *** * * * ** * *** ** * * *** ** *** * * * * *** * * ** ** *** * * * * Env % of CD8+ T cells CD107 + nc nc + + IFN nc + nc + + IL2 nc nc Figure 3.10: CD8 + T cell responses after DNA prime/boost immunization with genetic adjuvants. Two weeks after the second DNA immunization spleens were collected from four animals per group and in vitro re-stimulated with MHC I restricted peptides derived from p24 (A) or gp120 (B). The cells were stained for surface expression of CD8 and CD107 and for intracellular expression of IFNγ and IL2. For each population the background values of unstimulated cultures were subtracted. Depicted are the mean values + SEM of cells expressing at least one cytokine or CD107 or a combination of these (nc = not considered). Statistical significance of differences was determined by one-way ANOVA followed by Tukey's post test (n = 4; * = p < 0.05 vs. naive; ** = p < 0.01 vs. naive; *** = p < vs. naive). To analyze the protective capacity of the Gag-specific T cells, groups of six mice were intranasally challenged five weeks after the second immunization with a lethal 65

74 Results dose of a recombinant vaccinia virus expressing HIV-1 Gag (rvv-gag; Fig. 3.6). All animals showed weight loss on day three, demonstrating a productive infection. The DNA immunization protected all mice from rvv-gag induced mortality, regardless of the co-applied genetic adjuvant. In contrast, the protection seemed slightly reduced in the animals that received the IL28A plasmid and significantly reduced in the animals that were co-immunized with the IL6 plasmid, as demonstrated by an increased weight loss (Fig. 3.11A). A % initial body weight ## *** ** + pcdna + IL5 + IL6 + IL12 + IL28A + IL28B naive B Log copies/ng DNA **** **** *** **** **** **** Day p.i. 1 + pcdna + IL5 + IL6 + IL12 + IL28A + IL28B naive Figure 3.11: Protective capacity of Gag-specific CD8 + T cell responses after DNA prime/boost immunization with genetic adjuvants. Five weeks after the boost immunization animals were intranasally challenged with 50,000 PFU rvv-gag. Following infection the body weight was monitored daily for six days. The mean percentages of the initial body weights are shown (A). On day six post infection the animals were sacrificed and their lungs were collected. After homogenization the DNA was extracted and subjected to qpcr to determine the viral loads. Viral loads are depicted as means of the logarithmically transformed copy numbers per ng total DNA +/- SEM (B). Statistical significance of differences was determined by one-way ANOVA followed by Tukey's post test (n = 5-6; ## = p < 0.01 vs. + IL6; ** = p < 0.01 vs. naive; *** = p < vs. naive; **** = p < ). On day six post infection animals were sacrificed to determine the viral loads in their lungs by qpcr. In line with the protection from rvv-gag induced mortality, all immunized animals showed 1.5 to 2 logs lower rvv-gag loads compared to the unvaccinated group. This reduction was highly significant. The decreased protection from weight loss observed in IL6 and IL28A co-immunized animals was also reflected by increased rvv-gag titers, although the differences between the immunized groups did not reach statistical significance. Thus, none of the genetic adjuvants was able to increase the protection against the rvv-gag challenge compared to the pcdna group (Fig. 3.11B). This is in line with the highest Gagspecific CD8 + T cell responses in the pcdna group. In contrast, the significantly reduced vaccine efficacy in the mice that received the IL6 expression plasmid was 66

75 Results not expected from the ICS data, since these animals demonstrated the highest CD8 + T cell responses among all groups that received a genetic adjuvant (Fig. 3.10). 3.3 Immunization approaches based on intrastructural help Since the co-application of genetic adjuvants demonstrated little to no benefit on the humoral immune response against Env, as well as on the cellular immune response against Gag, another way to modulate the Env-specific humoral immune was analyzed. More than three decades ago it was reported that pre-existing immunity to internal proteins of the Influenza A virus can enhance the humoral immune response to the surface proteins upon immunization with whole influenza A viruses (195). Later, Lamb et al. demonstrated in vitro and Scherle and Gerhard in vivo that T helper cells specific for internal viral proteins were responsible for the increased antibody response against the surface protein (196, 197). The mechanism proposed includes a B cell receptor (BCR) dependent uptake of whole viral particles by surface protein-specific B cells with subsequent presentation of peptides derived from all viral proteins within MHC class II complexes on the cell surface. This renders the surface antigen-specific B cell competent to receive help from CD4 + T cells specific for internal viral proteins. The phenomenon was termed intrastructural help and shown to be also applicable to hepatitis B virus (198), but not vaccinia virus (199). Given the balanced humoral immune response against HIV-1 Gag and the protective efficacy of the Gag-specific CD8 + T cell response after DNA vaccination, it was analyzed if the cellular immune response against Gag could be exploited to modulate the humoral immune response against Env by intrastructural help. Since the density of envelope spikes on the surface of HIV-1 particles is rather low (4) and inactivation of lentiviral particles may lead to decomposition of the antigenic structure of Env (141), virus-like particles were employed as booster antigens after an initial DNA priming Virus-like particle preparation and characterization To produce virus-like particles 293T cells were transiently transfected with Hgp Syn and pconbgp140g/cd. For comparison, transfections with only Hgp Syn or pconbgp140g/cd were also performed. After transfection, the cell culture medium 67

76 Results was exchanged to serum free DMEM mixed with AIM-V to reduce the amount of bovine serum derived proteins in the final VLP preparation. Two days after transfection the conditioned cell culture supernatants were freed from cellular debris by centrifugation and subsequent filtration through 0.45 µm filters. VLPs were separated from soluble proteins and concentrated by ultracentrifugation through a 20% sucrose cushion. The final pellet was resuspended in phosphate-buffered saline and analyzed by SDS-PAGE and Western blot using an HIV-1 hyperimmune globulin preparation (HIV-IG) to detect the viral proteins. Env- and GagPol-derived proteins were easily detectable in the VLP preparation. After ultracentrifugation of the supernatant from only Hgp Syn -transfected cells, substantial amounts of GagPolderived proteins were detected in the Western blot, too. Thus, and as expected, GagPol alone was able to form particles than can pass through the sucrose cushion. Finally, although the total amount was lower compared to Hgp Syn co-transfected cells, Env protein produced by only pconbgp140g/cd transfected cells was also detectable in the pellet after the ultracentrifugation (Fig. 3.12). Since free proteins cannot pass through the sucrose cushion, these Env molecules were most likely incorporated into exosomes or comparable structures kda GagPol + Env GagPol Env gp140 p55 p41 p24 Figure 3.12: Western blot analysis of purified VLPs and exosomes. 293T cells were transfected with Hgp Syn (GagPol) and pconbgp140g/cd (Env) alone or in combination. Two days later VLPs and exosomes were purified by ultracentrifugation of the conditioned supernatant through a 20% sucrose cushion. The pellets were resuspended in PBS and subjected to SDS-PAGE and Western blot analysis with the human HIV-1 hyperimmune serum HIV-IG to detect viral proteins. The putative protein bands are indicated by the accordingly labeled arrows. As shown above, GagPol- and Env-derived proteins can pass through the sucrose cushion individually (Fig. 3.12). Thus, it cannot be stated whether these proteins are incorporated into the same VLPs upon co-transfection or not. Since this is a prerequisite for intrastructural help to occur, VLPs bearing or lacking Env (ΔEnv) were immunoprecipitated with the monoclonal anti-env antibody 2G12 using magnetic protein G beads. Precipitated proteins were subsequently analyzed by SDS-PAGE and Western blot with antibodies directed against gp120 (Fig. 3.13A) or 68

77 Results p24 (Fig. 3.13B). If 2G12 was omitted during immunoprecipitation, no viral proteins were detectable in Western blot (Δ2G12). Thus, the VLPs did not bind unspecifically to the protein G beads. Precipitation of Env-bearing VLPs with 2G12 resulted in an almost complete recovery of the Env- and Gag-derived proteins as determined by comparison to the amount initially subjected to immunoprecipitation (VLP Input). This clearly indicates incorporation of the viral proteins into the same particles. In addition, without Env on the surface of the VLPs no VLPs were precipitated, demonstrating the specificity of this assay. The additional bands that appear at 25 kda in the immunoprecipitation samples in both Western blots are probably due protein G, that was co-eluted from the magnetic beads. Figure 3.13: Immunoprecipitation and Western blot analysis of VLPs. VLPs with and without Env (ΔEnv) on their surface were produced by transfection of 293T cells with Hgp Syn together with pconbgp140g/cd or pcdna and purified from the conditioned supernatant by ultracentrifugation through a 20% sucrose cushion. The resulting VLPs were subjected to immunoprecipitation with 2G12 coated protein G magnetic beads. To control for unspecific binding protein G beads without 2G12 were used (Δ2G12). After immunoprecipitation and washing bound proteins were eluted by boiling the beads in SDS sample buffer and analyzed by SDS-PAGE and Western blot. Env proteins were detected with a polyclonal anti-gp120 antibody (A) and Gag-derived proteins were detected with the monoclonal anti-p24 antibody (B) followed by their respective detection antibodies. The additional bands at 25 kda in immunoprecipitation samples are due to protein G, that was co-eluted from the beads Analysis of intrastructural help in the context of HIV-1 To analyze if intrastructural help occurs in the context of HIV-1, animals were immunized by a single intramuscular DNA electroporation with Hgp Syn. Five and eight weeks later animals were boosted with VLPs containing 400 ng of Env. Four weeks after the priming and two weeks after each boost humoral immune responses were analyzed (Fig. 3.14). 69

78 Results d DNA ELISA VLP ELISA VLP ELISA rvv-gag qpcr ICS Figure 3.14: Immunization schedule for the intrastructural help immunization. BALB/c mice were immunized with 20 µg of Hgp Syn together with 10 µg pcdna3.1 by intramuscular DNA electroporation. Five and eight weeks later, primed and naive control animals received VLP booster immunizations containing 400 ng of Env via the foot pads. Four weeks after the DNA prime immunization and two weeks after each VLP immunization, the humoral immune responses against Gag and Env were determined by antigen-specific ELISA. Five weeks after the second VLP immunization animals were intranasally challenged with 50,000 PFU rvv-gag and their body weight was monitored on a daily basis. On day six post infection the mice were sacrificed and their lungs and spleens were collected. The viral load was determined by qpcr from lung homogenates and the anamnestic CD8 + T cell responses were determined by ICS. As expected, DNA immunized animals mounted an antibody response against Gag, but not Env (Fig. 3.15A and 3.15D). The Gag-specific humoral immune response was dominated by IgG2a, with no significant amounts of IgG1 detectable (Fig. 3.15A). The subsequent VLP immunizations boosted the Gag-specific antibody responses. Although IgG1 responses reached significant levels, as compared to unprimed animals, the IgG2a levels increased concomitantly and thus remained predominant (Fig. 3.15B and 3.15C). After the first VLP immunization both groups demonstrated a humoral immune response against Env. While Env-specific IgG1 levels did not show a significant difference between the two groups, only the Gag-primed group was able to mount a significant Env-specific IgG2a response (Fig. 3.15E). This led for the first time to a balanced humoral immune response against Env in the mice that received the GagPol DNA immunization. Additionally, these results demonstrate that not only DNA vaccine regimens induce a predominant Env-specific IgG1 response, but also a VLP based protein vaccine. The second VLP immunization increased the overall antibody responses without affecting the individual subtype ratios (Fig. 3.15F). 70

79 Results A B C Gag antibodies (log RLU/s) Env antibodies (log RLU/s) HgpSyn no Prime HgpSyn no Prime Prime 1. Boost 2. Boost IgG1 IgG2a 7 * **** 7 *** ** ** HgpSyn no Prime D E F Prime 1. Boost 2. Boost IgG1 IgG2a 7 ** 7 * HgpSyn no Prime Gag antibodies (log RLU/s) Env antibodies (log RLU/s) HgpSyn no Prime HgpSyn no Prime HgpSyn no Prime HgpSyn no Prime HgpSyn no Prime HgpSyn no Prime Figure 3.15: Humoral immune responses against after ISH immunization. IgG1 and IgG2a antibody responses against p55 (A, B, C) and gp120 (D, E, F) were analyzed by antigen-specific ELISA. The respective antibody levels were determined four weeks after the DNA prime immunization (D - 1:50 dilution, A - 1:500 dilution) and two weeks after the first (E - 1:50 dilution, B - 1:500 dilution) and second (F - 1:500 dilution, C - 1:5000 dilution) VLP immunization and depicted as means + SEM. Statistical significance of differences was determined by two-tailed unpaired t test (n = 4-5; * = p < 0.05 vs. naive; ** = p < 0.01 vs. naive; *** = p < vs. naive; **** = p < vs. naive). Gag antibodies (log RLU/s) Env antibodies (log RLU/s) HgpSyn no Prime HgpSyn no Prime In addition to the reversed Env-specific immunoglobulin subclass usage, it was analyzed, if the intrastructural help immunization protocol was able to induce protective CTL responses. To this end, five weeks after the last VLP immunization animals were intranasally challenged with a lethal dose of rvv-gag (Fig. 3.14). The unprimed animals, which only received two VLP immunizations, progressively lost body weight until the end of the observation period. In contrast, the DNA immunized mice started to recover by day four. On day six, the increase in body weight became statistically significant (Fig. 3.16A). On the same day the animals were sacrificed to determine the viral loads in their lungs. In line with the observed recovery from weight loss, DNA primed animals demonstrated a significantly reduced rvv-gag titer (Fig. 3.16B). 71

80 Results A % initial body weight Day p.i. no prime GagPol ** B log copies/ng DNA no prime IL2 nc nc Figure 3.16: Protective Gag-specific CD8 + T cell responses after ISH immunization. Five weeks after the second VLP immunization animals were intranasally challenged with 50,000 PFU rvv-gag. Following infection the body weight was monitored daily for six days. The mean percentages of the initial body weights +/- SEM are shown (A). On day six post infection the animals were sacrificed and their lungs were collected. After homogenization the DNA was extracted and subjected to qpcr to determine the viral loads, which are depicted as means of the logarithmically transformed copy numbers per ng total DNA +/- SEM (B). In addition, anamnestic Gag-specific CD8 + T cell responses were determined by ICS of splenocytes (C; nc = not considered). Statistical significance of differences was determined by two-tailed unpaired t test (n = 4; ** = p < 0.01 vs. naive; *** = p < vs. naive; **** = p < vs. naive). *** GagPol C % of CD8+ T cells **** **** **** **** **** GagPol no prime CD107 + nc nc + + IFN nc + nc + + To delineate the immunological mechanism that confers protection, CD8 + T cell responses in the spleens were determined by ICS on day six post infection. GagPol primed animals showed substantial CD107 + IFNγ + CD8 + T cell responses (Fig. 3.16C). These responses were considerably higher than observed in a previous experiment after two DNA immunizations (Fig. 3.10), which was most probably due to a boosting effect of the replicating rvv-gag. Low levels of Gag-specific, polyfunctional CD8 + T cells that additionally secrete IL2 were also observed in DNA primed animals. Detection of IL2 was overall poorer than before, due to acquisition on a different flow-cytometer. In contrast, animals that only received VLPs did not show significant CTL responses, arguing against an induction of Gag-specific CD8 + T cell responses by the VLP immunization (Fig. 3.16C). Consequently, the induced CTL responses correlated inversely with the percent body weight loss and the rvvgag titers in the lung on day six post infection. Thus, the intrastructural help immunization led to a reversion of the Env-specific IgG1 predominance with concomitant induction of protective CTL responses against Gag Comparison of intrastructural help vs. direct priming So far, it was shown that the humoral immune responses against HIV-1 Env were dominated by IgG1 after DNA and VLP immunization. In contrast, intrastructural help, which was achieved by DNA immunization against GagPol and boosting with 72

81 Results virus-like particles, led to a balanced Env-specific humoral immune response. Although unlikely, it was not clear if a DNA immunization against Env followed by VLP booster immunization may also lead to a balanced humoral immune response against Env. Furthermore, no indication for the reasons for the Env-specific IgG1 predominance could be observed. Thus, animals were primed against Env and GagPol alone or in combination by intramuscular DNA electroporation. To analyze whether the Env-specific IgG1 predominance was rooted in the respective T cell help, antigen-specific CD4 + T cells were analyzed. In addition, respectively primed animals were boosted with VLPs to compare the humoral immune responses (Fig. 3.17). d DNA ICS ELISA VLP ELISA VLP ELISA ICS ELISA ELISA Figure 3.17: Immunization schedule to compare intrastructural help with a direct priming. BALB/c mice were immunized with 20 µg of Hgp Syn (GagPol) and with 20 µg pconbgp140g/cd (Env) alone or in combination (Mix) by intramuscular DNA electroporation. Where necessary, the total amount of DNA was adjusted with pcdna3.1. A control group received only 40 µg of pcdna3.1 as the prime immunization (Mock). Five and eight weeks later, the animals received VLP booster immunizations containing 400 ng of Env via the foot pads. Two weeks after the DNA priming and two weeks after the second VLP immunization antigen specific CD4 + T cell responses were analyzed by ICS. In addition, two and five weeks after the DNA priming splenocytes were re-stimulated in vitro and antigen-specific secretion of T H 2 associated cytokines was determined by ELISA. Four weeks after the DNA prime immunization and two weeks after each VLP immunization the humoral immune responses against Gag and Env were determined by antigen-specific ELISA. Two weeks after the intramuscular DNA electroporation, peak CD4 + T cell responses were analyzed by ICS. Env-specific re-stimulation led to significant numbers of IFNγ, IL2 and TNFα expressing splenocytes in animals that were immunized against Env, either alone or in combination with GagPol. Most of these cells were polyfunctional, since they expressed all three cytokines together. The coapplication of Hgp Syn reduced the numbers of Env-specific CD4 + T cells slightly, but significantly when the production of individual cytokines was considered. In contrast, the polyfunctional subpopulation was not significantly affected (Fig. 3.18A). 73

82 Results A Gag Env B % of CD4+ T cells **** *** **** **** **** **** **** **** IFN + nc nc + IL2 nc + nc + TNF nc nc + + % of CD4+ T cells *** **** *** **** **** *** GagPol Env Mix Mock naive 0.00 IFN + nc nc + IL2 nc + nc + TNF nc nc + + Figure 3.18: CD4 + T cell responses after the DNA prime immunization. Two weeks after the DNA immunization animals were sacrificed and their spleens were collected for in vitro re-stimulation with an MHC II restricted peptides derived from gp120 (A) or p24 (B). The cells were stained for surface expression of CD4 and for intracellular expression of IFNγ, IL2 and TNFα. For each population the background values of unstimulated cultures were subtracted. Depicted are the mean values + SEM of cells expressing at least one cytokine or all three together, derived from two independent experiments (nc = not considered). Statistical significance of differences was determined by one-way ANOVA followed by Tukey's post test (n = 10-11, except naive with n = 4; *** = p < vs. naive; **** = p < vs. naive; + = p < 0.05 vs Mix; ++ = p < 0.01 vs. Mix). Re-stimulation with Gag-derived peptides also showed significant numbers of reacting CD4 + T cells in both Hgp Syn immunized groups (Fig. 3.18B), although the overall responses were substantially lower compared to Env-specific CD4 + T cells (Fig. 3.18A). Again, most CD4 + T cells expressed all three cytokines upon restimulation. In contrast to Env-specific responses, the co-application of pconbgp140g/cd decreased the numbers Gag-specific CD4 + T cells in all populations significantly. Thus, intramuscular DNA electroporation with Hgp Syn and pconbgp140g/cd alone or in combination induced substantial amounts of antigenspecific polyfunctional CD4 + T cell responses, which should be able to provide help to the respective B cells. 74

83 Results Since the cytokines analyzed by ICS are rather produced by T H 1 cells, the CD4 + T cells should be able to support an IgG2a class-switch of antigen-specific B cells. In contrast, the production of antibodies of the IgG1 subclass is generally promoted by T H 2 cells. Thus, the secretion of the T H 2 associated cytokines IL4, IL5, IL10 and IL13 was analyzed by ELISA after in vitro re-stimulation of splenocytes with MHC II restricted peptides for two days. Furthermore, the responses were determined two weeks and additionally five weeks after the DNA priming at the time of the first VLP boost immunization (Fig. 3.17). Re-stimulation with the Env-derived MHC II restricted peptide induced significant secretion of IL4 on day 14 as well as on day 35 in splenocyte cultures from both groups that received the Env expression plasmid (Fig. 3.19A). In contrast, the Gagderived peptides induced significant IL4 secretion only in the group that received both plasmids (Mix), and only on day 14 (Fig. 3.19A). Similar results were observed for the secretion of IL5 after peptide stimulation, although Gag-specific secretion was already on day 14 hardly detectable (Fig. 3.19B). Env-specific peptide stimulation also induced substantial secretion of IL10 and IL13 on day 14 in the respective groups (Fig. 3.19C and 3.19D). This secretion was still detectable on day 35. Gagspecific production of these cytokines was also detectable on day 14 in the respective groups but total amounts were much lower. Furthermore, secretion of IL10 and IL13 after Gag-specific re-stimulation vanished until day 35 (Fig. 3.19C and 3.19D). In general, splenocytes from animals that received the Env expression plasmid produced substantially more T H 2 cytokines upon antigen-specific restimulation than it was the case for splenocyte cultures from Gag-immunized animals. Furthermore, since no Gag-specific secretion was detectable on day 35 post immunization, it was not only lower but probably also more transient. Thus, the Env-specific CD4 + T cell response seemed to exhibit a shift towards T H 2. 75

84 Results A mil4 pg/ml Env **** *** *** ** Gag ** d 14 d 35 0 GagPol Env Mix Mock GagPol Env Mix Mock B 60 Env **** ** **** *** Gag * mil5 pg/ml GagPol Env Mix Mock GagPol Env Mix Mock C 1500 Env **** ** **** **** Gag ** *** mil10 pg/ml GagPol Env Mix Mock GagPol Env Mix Mock D 3000 Env **** *** **** **** Gag * *** mil13 pg/ml GagPol Env Mix Mock GagPol Env Mix Mock Figure 3.19: T H 2 responses after MHC II restricted stimulation of splenocytes. Two and five weeks after the DNA immunization animals were sacrificed and their spleens were collected for in vitro re-stimulation with MHC II restricted peptides derived from gp120 (Env) or p24 (Gag). Two days later, culture supernatants were subjected to cytokine-specific ELISA. Depicted are the mean values + SEM for the cytokine secretion by the splenocyte cultures. Statistical significance of differences was determined by one-way ANOVA followed by Tukey's post test (n = 5; * = p < 0.05 vs. naive; ** = p < 0.01 vs. naive; *** = p < vs. naive; **** = p < vs. naive). To determine the impact of the VLP immunizations on the CD4 + T cell response, an ICS was performed two weeks after the final immunization (Fig. 3.17). Both groups that received a prime immunization containing the Env encoding plasmid still showed substantial amounts of Env-specific CD4 + T cells that secreted IFNγ, IL2 and TNFα upon re-stimulation. All of them retained their polyfunctional profile as they 76

85 % of CD4+ T cells Results produced at least two, most of them all three cytokines together (Fig. 3.20A). Compared to the ICS two weeks after the prime immunization the responses were not reduced (Fig. 3.20). Thus, either the initial responses were sustained or the VLP immunizations supported their maintenance. In contrast, the VLP immunizations did not seem to induce any de novo CD4 + T cell responses against Env, neither in the GagPol primed animals nor in the empty vector controls (Fig. 3.20A). A Env % of CD4+ T cells * ** ** * GagPol Env Mix Mock naive 0.0 IFN + nc nc + IL2 nc + nc + TNF nc nc + + B Gag IFN + nc nc + IL2 nc + nc + TNF nc nc + + Figure 3.20: CD4 + T cell responses after the DNA prime VLP boost immunization. Two weeks after the second VLP immunization animals were sacrificed and their spleens were collected for in vitro re-stimulation with MHC II restricted peptides derived from gp120 (A) and p24 (B). The cells were stained for surface expression of CD4 and for intracellular expression of IFNγ, IL2 and TNFα. For each population the background values of unstimulated cultures were subtracted. Depicted are the mean values + SEM of cells expressing at least one cytokine or all three together (nc = not considered). Statistical significance of differences was determined by one-way ANOVA followed by Tukey's post test (n = 3-6; * = p < 0.05 vs. naive; ** = p < 0.01 vs. naive). Even though the Env-specific CD4 + T cell responses were not reduced two weeks after the final immunization, Gag-specific responses were undetectable (Fig. 3.20B). In line with this observation, there were also no de novo responses against Gag detectable in the animals that did not receive a prime immunization with Hgp Syn. 77

86 Results Thus, although Gag-specific CD4 + T cells are most probably the mediators of intrastructural help, the presentation of Gag-derived epitopes on Env-specific B cells does not seem to be sufficient to sustain these responses at detectable levels in the spleen. A Env antibodies (log RLU/s) B Env antibodies (log RLU/s) C Env antibodies (log RLU/s) **** **** GagPol Env Mix ++++ **** ++++ **** GagPol Env Mix Mock naive Mock naive ++ ** GagPol Env Mix Mock ++++ **** ++++ **** IgG1 IgG2a naive GagPol Env Mix Mock naive GagPol Env Mix Mock naive **** **** **** **** Prime 1. Boost 2. Boost **** **** **** **** GagPol Env Mix Mock naive GagPol Env Mix Mock naive GagPol Env Mix Mock naive Figure 3.21: Humoral immune responses against HIV-1 Env and Gag after DNA prime VLP boost immunization. IgG1 and IgG2a antibody responses against gp120 (A, B, C) and p55 (D, E, F) were analyzed by an antigen-specific ELISA. The respective antibody levels were determined four weeks after the DNA prime immunization at a 1:100 dilution (A, D) and two weeks after the first (B, E) and second (C, F) VLP immunization at a 1:1000 dilution and depicted as means + SEM. Data is derived from two independent experiments with a total of 8-12 animals per group. Statistical significance of differences was determined by one-way ANOVA followed by Tukey's post test (* = p < 0.05 vs. naive; ** = p < 0.01 vs. naive; *** = p < vs. naive; **** = p < vs. naive; + = p < 0.05 vs. Mock; ++ = p < 0.01 vs. Mock; +++ = p < vs. Mock; ++++ = p < vs. Mock). D Gag antibodies (log RLU/s) E Gag antibodies (log RLU/s) F Gag antibodies (log RLU/s) **** ++++ **** ++++ **** ++++ **** +++ ** GagPol Env Mix Mock naive +++ *** GagPol Env Mix Mock naive Prime ++++ **** 1. Boost ++++ **** 2. Boost ++++ **** ++++ **** ++++ **** GagPol Env Mix Mock naive ++++ **** GagPol Env Mix Mock naive 78

87 Results Analysis of the humoral immune response on day 28 revealed the expected IgG1 predominance for the Env-specific antibodies. There was no difference between the groups that received the Env expression plasmid alone or in combination with the GagPol expression plasmid (Fig. 3.21A). In contrast, the Gag-specific antibody levels were balanced with a slight excess of IgG2a over IgG1. The co-application of the Env expression plasmid seemed to reduce the overall antibody response against Gag slightly, but the difference did not reach statistical significance (Fig. 3.21D). The first VLP immunization led to anamnestic Gag-specific IgG1 and IgG2a responses. Although the pattern was comparable to the one after the prime immunization (3.21D), the negative effect of the Env expressing plasmid in the mixed DNA vaccine modality seemed to be stronger after the DNA prime and VLP boost immunization protocol than after two DNA immunizations (3.4D). Nevertheless, IgG2a was still the predominant subtype in both groups (Fig. 3.21E). The second VLP immunization neither affected the antibody levels, nor their pattern. Surprisingly, some Env primed animals developed Gag-specific IgG1 response (Fig. 3.21F). Although the group that received the two VLP immunizations after the empty pcdna plasmid prime did not develop any Gag-specific antibody responses, the IgG1 response against Gag in the Env primed group slightly missed statistical significance (p = 0.057). The first VLP booster immunization also resulted in anamnestic Env-specific antibody responses in both groups that previously received the Env expression plasmid. Although Env-specific IgG2a responses were induced in these groups, IgG1 was still the predominant subclass. In contrast, already after the first VLP immunization the GagPol primed animals showed a significant, albeit low increase in Env-specific IgG2a, indicating ISH. This IgG2a response appeared in the absence of significant IgG1 levels (Fig. 3.21B). The second VLP immunization boosted all Envspecific antibody responses. Consequently, the highest antibody levels were observed in both groups that received an Env prime immunization, with IgG1 still being the predominant subclass. Additionally, the two VLP immunizations in the mock primed group induced only low Env-specific IgG2a levels, but substantial IgG1 responses. In contrast, the GagPol primed animals demonstrated the same Envspecific IgG1 response as the mock primed group, but substantially higher IgG2a levels against Env. In consequence, Env-specific IgG2a responses in GagPol primed mice were significantly higher than in animals that only received the VLP 79

88 Results immunizations (Mock) and almost comparable to the groups that were primed against Env (Fig. 3.21C). Ratio IgG2a/IgG * * GagPol Env Mix Mock Figure 3.22: Env-specific IgG2a/IgG1 ratios after DNA prime VLP boost immunization. The individual ratios were calculated with untransformed RLU/s values derived from ELISA with sera collected after the second VLP boost and used at a 1:10000 dilution. The bars represent geometric mean values. Statistical significance of differences was determined with Kruskal-Wallis test followed by Dunn's post test (* = p < 0.05 vs. Mock). The effect of intrastructural help was exemplified by calculating the Env-specific IgG2a/IgG1 ratios. Both groups that were primed against Env as well as the control group that received the empty pcdna plasmid during the prime immunization, showed ratios below one after the second VLP booster immunization, corroborating the notion that all tested Env immunogens induced predominantly IgG1 antibodies. In contrast, only the group that was primed against GagPol exhibited a ratio above one (Fig. 3.22). Thus, the selective increase of Env-specific IgG2a by intrastructural help resulted in a balanced humoral immune response or even a slight excess of IgG2a Verification of the intrastructural help mechanism CD4 + T helper cells specific for epitopes derived from internal structural proteins are responsible for the intrastructural help observed for influenza and hepatitis B virus (195, 198). To verify that intrastructural help by CD4 + T helper cells specific for Gag- or even GagPol-derived epitopes are also responsible for the selective increase in Env-specific IgG2a after VLP immunization, an adoptive transfer experiment was performed (Fig. 3.23). 80

89 Results d Donor mice DNA ELISA ICS Recipient mice Transfer VLP ELISA VLP ELISA Figure 3.23: Immunization schedule for the adoptive transfer experiment to verify the ISH mechanism. BALB/c mice were immunized with 20 µg of Hgp Syn (GagPol) or 20 µg pcdna3.1 (Mock) by intramuscular DNA electroporation. On day 34 the animals were sacrificed and their inguinal and popliteal lymph nodes and spleens were collected. Successful priming was verified by ICS of splenocytes. Subsequently, CD4 + T cells were isolated by negative selection from pooled splenocytes and lymphocytes and adoptively transferred into syngeneic recipients. Two hours after the transfer and three weeks later, the recipients were boosted with VLPs containing 400 ng of Env via the foot pads. Four weeks after the DNA prime immunization, two weeks after the first and one week after the second VLP immunization the humoral immune responses against Gag and Env were determined by antigen-specific ELISA. Mice were primed by intramuscular DNA electroporation with Hgp Syn or pcdna as an empty vector control. Successful immunization was verified by Gag-specific ELISA four weeks after the DNA prime. The immunized animals mounted balanced humoral immune responses against Gag, with equal levels of Gag-specific IgG1 and IgG2a. Both were significantly increased compared to pcdna immunized animals, which expectedly did not develop detectable antibodies against Gag (Fig. 3.24A). A Gag antibodies (log RLU/s) ** **** GagPol Mock GagPol Mock IgG1 IgG2a B % of CD4+ T cells 0.04 *** * *** ** IFN + nc nc + IL2 nc + nc + TNF nc nc + + GagPol Mock Figure 3.24: Gag-specific antibody and CD4 + T cell responses after the DNA prime immunization. IgG1 and IgG2a antibody responses against p55 were analyzed by an antigenspecific ELISA four weeks after the DNA prime immunization at a 1:100 dilution (A). Depicted are the means + SEM of six animals per group. On day 34 after the prime immunization, an in vitro restimulation of splenocytes was performed (B). The cells were subsequently surface stained for CD4 expression and intracellularly stained for IFNγ, IL2 or TNFα expression. For each population the background values of unstimulated cultures were subtracted. Depicted are the mean values + SEM of cells expressing at least one cytokine or all three together (nc = not considered). Statistical significance of differences was determined by two-tailed unpaired t test (n = 6; * = p < 0.05 vs. naive; ** = p < 0.01 vs. naive; *** = p < 0.001). 81

90 Results Five weeks after the DNA prime immunization the animals were sacrificed and their popliteal and inguinal lymph nodes and their spleens were collected. To verify the induction of Gag-specific CD4 + T cells a sample of the splenocytes from each animal was subjected to ICS. The DNA immunization induced significant numbers of IFNγ, IL2 and TNFα producing CD4 + T cells. Almost all of them were polyfunctional as they produced at least two, most of them all three cytokines together (Fig. 3.24B). Their overall numbers were two to three times lower compared to day 14 post immunization (Fig. 3.18), indicating that they have already entered the contraction phase. Singulettes Lymphocytes CD4+ T cells 97% FSC-A SSC-A CD4 FITC FSC-H FSC-A CD19 APC Figure 3.25: Purity analysis of the CD4 + T cell preparation. Pooled splenocytes and lymphocytes from inguinal and popliteal lymph nodes collected on day 34 after the DNA immunization were subjected to CD4 + T cell isolation by negative selection. Before adoptive transfer, their purity was determined by flow cytometry. The cells were surface stained for CD4 (FITC) and CD19 (APC), to exclude contamination with B cells. Dead cells were excluded by fixable viability dye staining. Live cells were gated on singulettes (left dot plot) and lymphocytes (middle dot plot) according to their front and sideward scatter. 97% of the resulting lymphocyte population was CD4 + and CD19 - (right dot plot). Shown is a representative result for both groups. Next, the lymphocytes from both lymph nodes and spleens were pooled by group and CD4 + T cells were isolated by negative selection. The purity of the cell preparation was determined by flow cytometry to be 97%, before they were adoptively transferred into syngeneic recipients (Fig. 3.23). The purified CD4 + T cells were evenly distributed among the recipient animals of the respective groups. Subsequent to the transfer, the animals received a first and three weeks later a second VLP boost. Already two weeks after the first VLP immunization the Envspecific IgG2a antibodies showed a trend towards increased levels in the animals that received the CD4 + T cells from GagPol immunized mice. There was no effect of the CD4 + T cell transfer on the Env-specific IgG1 responses (Fig. 3.26A). The second VLP immunization boosted the overall antibody levels against Env, with still 82

91 Results no apparent effect of the different CD4 + T cells transferred on the IgG1 levels. For Env-specific IgG2a responses, recipients of GagPol-primed CD4 + T cells demonstrated a substantial increase, which resulted in a statistically significant difference compared to the control animals (Fig. 3.26B). In consequence, the transfer of CD4 + T cells from GagPol primed mice also led to a significantly increased Env-specific IgG2a/IgG1 ratio after the two VLP immunizations (Fig 3.26C). A B C Env antibodies (log RLU/s) GagPol Mock GagPol IgG1 IgG2a Mock Env antibodies (log RLU/s) GagPol Mock Figure 3.26: Humoral immune responses against HIV-1 Env in CD4 + T cell recipients after the VLP immunizations. IgG1 and IgG2a antibody responses against gp120 in the CD4 + T cell recipients were analyzed by an antigen-specific ELISA. The respective antibody levels were determined two weeks after the first VLP immunization at a 1:100 dilution (A) and one week after the second VLP immunization at a 1:1000 dilution (B) and depicted as means + SEM. Statistical significance of differences was determined by two-tailed unpaired t test (n = 5-6; ** = p < 0.01 vs. Mock). In addition, individual IgG2a/IgG1 ratios of Env-specific antibodies were calculated for the sera collected one week after the second VLP immunization (C). The bars represent the geometric mean value. Statistical significance of differences was determined by two-tailed Mann-Whitney test (n = 5-6; ** = p < 0.01 vs. Mock). ** GagPol Mock Ratio IgG2a/IgG ** GagPol Mock Intrastructural help for Gag-specific B cells? As described above, the prime immunization against Env seemed to increase the Gag-specific antibody response after the second VLP immunization (Fig. 3.24F). Although this was only a trend, it barely missed statistical significance (adjusted p value = vs. Mock). In addition, IgG1 responses against Gag were selectively increased, making the assumption likely that CD4 + T cells mediated this effect. For intrastructural help by Env-specific T cells for Gag-specific B cells to occur, the B cell receptor (BCR) must be able to reach Gag proteins that are somehow linked to Env proteins. Since the membrane of the VLPs should shield the Gag proteins from BCR engagement there are only two likely explanations for ISH to take place. First, Gagderived proteins could be exposed on the surface of VLPs, or second, VLP debris in which Env and Gag proteins are still attached to each other could be present in the VLP preparation. Some early reports indicated that p24 proteins can be expressed 83

92 Results on the surface of infected cells (200, 201). Since the VLP membrane is host cell derived, this could also result in presence of p24 on the surface of the VLPs. 7-AAD - counts 7-AAD + HgpSyn anti-p24 + sek sek neg HgpSyn + pconb Figure 3.27: Anti-p24 surface staining of transfected 293T cells. 293T cells were transfected with Hgp Syn alone or in combination with pconbgp140g/cd. Two days later the cells were harvested and stained with a monoclonal anti-p24 antibody and the respective FITC-conjugated secondary antibody. To discriminate live from dead cells, 7-AAD was added to the cell suspension before flow cytometric analysis. 293T cells were gated according to their front and sideward scatter and divided in live (7- AAD - ) and dead/dying (7-AAD + ) cells. Both subgroups were analyzed separately for their p24-staining (black). As controls, unstained cells (light grey) and cells only stained with the secondary antibody (dark grey) were included. p24 (anti mouse-fitc) To analyze the expression of p24 on the cell surface, 293T cells were transfected with Hgp Syn alone or in combination with pconbgp140g/cd. Two days later the cells were harvested and surface stained with a monoclonal antibody against p24 and the respective FITC-conjugated secondary antibody. To verify that the staining occurred at the cell surface the cells were also stained with the non membrane-permeable fluorescent dye 7-actinoaminomycin D (7-AAD). A small proportion of Hgp Syn transfected cells could be specifically stained with the anti-p24 antibody, but this staining was restricted to 7-AAD + cells which already lost membrane integrity (Fig left panel). The co-expression of Env increased the proportion of p24 + cells substantially, but the staining was still selective for 7-AAD + cells, while 7-AAD - cells did not show any anti p24 staining (Fig right panel). Thus, the staining most probably occurred intracellularly and there was no indication of cell surface expression of p24. 84

93 Results A HgSyn VLPs HgpSyn VLPs B HgSyn VLPs HgpSyn VLPs anti p24 Triton X anti p24 Triton X kda 150 kda gp kda 50 kda p55 75 kda 50 kda 25 kda p24 25 kda Figure 3.28: Indirect immunoprecipitation and Western blot analysis of VLPs. Immature (Hg Syn ) and mature (Hgp Syn ) VLPs were produced by transfection of 293T cells with Hg Syn or Hgp Syn together with pconbgp140g/cd and purified from the conditioned supernatant by ultracentrifugation through a 20% sucrose cushion. The resulting VLPs were subjected to immunoprecipitation with anti-p24 coated protein G magnetic beads with or without prior Triton X-100 treatment. To control for unspecific binding, protein G beads without the anti-p24 antibody were used. After immunoprecipitation and washing, bound proteins were eluted by boiling the beads in SDS sample buffer and analyzed by SDS-PAGE and Western blot. Env proteins were detected with 2G12 followed by an HRP-conjugated anti-human antibody (A) and Gag-derived proteins were detected with the monoclonal anti-p24 antibody followed by an HRP-conjugated anti-mouse antibody only recognizing native immunoglobulins (B). The second explanation could be that some VLPs broke up after purification, leaving debris that still connects Gag and Env proteins. Since this debris is also devoid of an intact membrane, both proteins can be reached by BCRs. To analyze this, an immunoprecipitation of VLPs with an anti-p24 antibody was performed. Since p24 forms the capsid inside the viral particles, while the matrix protein is attached to the membrane to build the scaffold of the particle, VLPs were produced with the Gag expression plasmid Hg Syn. Hg Syn does not encode the viral protease and thus leads to the formation of immature viral particles in which the whole Gag protein is still attached to the membrane. This should lead to increased recovery of VLP debris by the anti-p24 antibody. In addition, to promote the disruption of the membrane and support the accumulation of debris, some VLPs were treated with Triton X-100. The incubation of the Hgp Syn VLPs with the magnetic beads alone did not lead to unspecific precipitation of viral proteins. In contrast, the Hg Syn VLPs showed low level unspecific binding, as indicated by a faint band at approximately 55 kda in the antip24 Western blot (Fig. 3.28A). Addition of the anti-p24 antibody to the immunoprecipitation increased the p24 recovery from Hgp Syn VLPs, but not the p55 recovery of Hg Syn VLPs. There was also no increased Env precipitation after addition of the anti-p24 antibody (Fig. 3.28B). Finally, prior incubation of the VLPs with Triton X-100 increased the p24 and the p55 recovery substantially (Fig. 3.28A). This also 85

94 Results led to increased co-precipitation of gp140 in case of Hg Syn, but not in case of Hgp Syn VLPs (Fig. 3.28B). Thus, VLP debris generated by incubation with Triton X-100 contains structures that include Gag and Env proteins, which are probably still connected by membrane fragments. This is also the most likely explanation for the intrastructural help provided by Env-specific CD4 + T cells for Gag-specific B cells. Unfortunately, this could not be verified without Triton X-100 treatment for the VLPs used in vivo, probably due to an insufficient sensitivity of the in vitro assay Impact of ISH on the Fcγ-effector functionality of Env-specific antibodies Since the Fc domain of an antibody determines which secondary effector function it can mediate, it was analyzed if ISH also led to a different Env-specific effector function profile. The low affinity Fcγ receptors are the main mediators of these secondary effector functions. Due to their low affinity, several Fcγ receptor molecules have to encounter multiple antibodies to aggregate and trigger effector cell activation, as it is the case for surface antigen-specific antibodies that cover an infected cell. A B 293A P815 HIV MLV HIV MLV fluorescence bright Figure 3.29: Transduction efficacies of HIV-1 and MLV derived viral vectors. 293A (A) and P815 (B) cells were transduced with HIV-1 (left panels) or MLV (right panels) derived viral vectors expressing GFP. Four days later, GFP expression was analyzed under a fluorescence microscope. The contrast of the picture was enhanced with Adobe Photoshop in its entirety to visualize low level GFP expression. As a first step for the evaluation of the Fcγ-effector functionality of the immune sera, an Env presenting cell line was generated. The murine P815 cell line was 86

95 Results chosen, because these cells have been used in ADCC assays before and they have the same MHC I haplotype as BALB/c mice, which reduces background cytotoxicity by BALB/c effector cells in a functional assay. Unfortunately, P815 cells were not transfectable and the electroporation efficacy was too low to generate sufficient Env presenting cells. Therefore, a lentiviral vector based on HIV-1 and a retroviral vector based on MLV were produced with the VSV-G protein as an envelope to broaden their cell tropism. Both expressed the green fluorescence protein to detect successful transduction. P815 and 293A cells as a positive control were transduced and analyzed under the fluorescence microscope. The lentiviral vector successfully transduced the 293A cells with decent efficacy (Fig 3.29A left panel). Unfortunately, this was not the case for the P815 cells (Fig. 3.29B left panel). The MLV based vector was also able to transduce the 293A cells, albeit with slightly lower efficacy compared to the lentiviral vector (Fig. 3.29A right panel). Nevertheless, only the MLV vector was able to transduce the P815 cells (Fig. 3.29B right panel). 2G12 + sek sek neg counts 2G12 (anti human-pe) Figure 3.30: Anti-gp120 surface staining of transduced P815 cells. Parental (left) and pconbgp140g/cd transduced (right) P815 cells were surface stained for gp120 expression with 2G12 and a PE-conjugated anti-human secondary antibody (black) and analyzed by flow cytometry. As controls, unstained cells (light grey) and cells only stained with the secondary antibody (dark grey) were included. Next, the GFP expression cassette in the MLV vector plasmid was exchanged with the one encoding the ConBgp140G/CD envelope. P815 cells were transduced with the resulting vectors to produce Env-expressing P815Env cells. Due to the low transduction efficacy, the P815Env cells were cultured under selective pressure with G418-containing medium. Afterwards, proper surface expression of Env was verified by FACS analysis with the monoclonal Env-specific antibody 2G12 and a 87