PERSONAL USE ONLY. Evaluation of the genetic background of standardimmunosuppressant-related

Transcription

1 Ann Translant, 2009; 14(3): Received: Acceted: Published: Background: Material/Methods: 18 Results: Conclusions: Evaluation of the genetic background of standardimmunosuressant-related toxicity in a cohort of 200 aediatric renal allograft reciients a retrosective study Ryszard Grenda 1, Sylwester Prokurat 1, Andrzej Ciechanowicz 2, Barbara Piątosa 3, Piotr Kaliciński 4 1 Deartment of Nehrology, Kidney Translantation and Hyertension, Children s Memorial Health Institute, Warsaw, Poland 2 Deartment of Laboratory Diagnostics and Molecular Medicine, Pomeranian Medical University, Szczecin, Poland 3 Histocomatibility Laboratory, Children s Memorial Health Institute, Warsaw, Poland 4 Deartment of Surgery and Organ Translantation, Children s Memorial Health Institute, Warsaw, Poland Source of suort: The study was suorted by the Ministry of Science and Higher Education grant No 2 P05E Summary Original Paer Immunosuressant toxicity is a limiting factor for the efficacy and safety of longterm theray. Whether it stems solely from drug exosure, remains unclear. Overall, 207 children and adolescents at the mean age of 11±4.4, with rimary renal allograft were analyzed. Immunosuression regimens included CsA or TAC, combined with AZA or MMF and steroids. Drug-secific toxicities were diagnosed by renal biosy and/or clinical criteria. Genotying for MDR1, CYP3A5, IL1B, IL1RN, IL-6, IL-10, MCP-1, TGFB1, CCR5, VEGF and TNF-alha gene olymorhisms was erformed with the use of PCR and PCR-RFLP techniques. Nehrotoxicity was seen in 38.5% of atients treated with CsA and 29.5% with TAC, while gingival hyertrohy was observed in 28% of CsA atients. Myelotoxicity was found in 3% of AZA-treated and 6.4% of MMF-treated atients. No significant correlation was seen between the atient s age, gender, tye of re-translantation dialysis, donor age, graft origin or cold ischemia time, and the occurrence of drug-related toxicity. For CNIs, the drug exosure and the duration of treatment did not rove of significance either. TAC-associated nehrotoxicity correlated with the CCR5 gene olymorhism, as the wt/δ32 genotye was found in 21% of atients with no detected toxicity (<0.041) and in none of the nehrotoxicity cases. The resence of this genotye was also associated with significantly better graft function at 1 year ost-translant (GFR ±28.40 vs ±29.96; =0.022). An association was seen between the MMF-induced myelotoxicity and the TNF-alha G(-308)A olymorhism (<0.005), but the MMF exosure was higher in atients who develoed toxicity. Genetic background should be regarded one of the risk factors for immunosuressant-related toxicity in renal translantation.

2 Ann Translant, 2009; 14(3): Key words: Full-text PDF: Word count: 1735 Tables: 5 Figures: References: 21 Author s address: BACKGROUND Post-translantation immunosuression is associated with the occurrence of common adverse events, including an increased risk of viral infections or osttranslant lymhoroliferative disease, as well as secific drug-related toxicity. Theraeutic drug monitoring is regarded as an imortant tool aimed to otimize immunosuression, although, desite the maintenance of drug exosure control, many atients still suffer from secific adverse events. There are many factors that may be taken into consideration here, for instance: the individual drug metabolism, atient s comliance with the regimen, harmacological interactions and age-related suscetibility to secific toxic mechanisms. Notably, genetic background is now considered one of the more attractive yet controversial asects of this roblem [1 4]. The aim of the study was to evaluate the genetic background of standard-immunosuressantrelated toxicity in aediatric atients with rimary renal allograft. MATERIAL AND METHODS toxicity of immunosuressive drugs genetic background renal translantation htt:// Ryszard Grenda, Deartment of Nehrology, Kidney Translantation and Hyertension, Children s Memorial Health Institute, Aleja Dzieci Polskich 20, Warszawa, Poland, r.grenda@czd.l The study enrolled 207 children and adolescents at the mean age of 11±4.4, who had received rimary renal allograft (181 from deceased and 26 from living related donors) in the years , and who were analyzed retrosectively. Immunosuression regimens included cyclosorine (CsA) or tacrolimus (TAC), combined with azathiorine (AZA) or mycohenolate mofetil (MMF) and steroids. Overall, 167 atients received CsA, 61 TAC, 156 MMF, and 66 AZA. Secific toxicities of calcineurin inhibitors (CNIs) and antiroliferative drugs were identified basing on the erformed biosy and/or clinical criteria. Chronic nehrotoxicity was diagnosed by renal biosy and/or observed consistent deterioration of renal function, accomanied by hyeruricaemia and/or tubular acidosis uon the exclusion of other ossible causes. Myelotoxicity was evidenced by leukoenia (defined as WBC < /L) found on at least two consecutive outatient visits, with other ossible causes excluded. The glomerular filtration rate (GFR) was calculated from the Schwartz formula [5]. Genotying for a number of gene olymorhisms in MDR1, CYP3A5, IL1B, IL1RN, IL-6, IL-10, MCP-1, TGFB1, CCR5, VEGF and TNF-alha was erformed with the use olymerase chain reaction (PCR) and olymerase chain reaction-restriction Fragment Length Polymorhism (PCR- RFLP) techniques. Primer sequences and analysis arameters are resented in Table 1. Statistical analysis The normality of variable distribution was examined with the use of the Kolmogorov-Smirnov test (K-S test) and the Shairo-Wilk test. For normally distributed variables, the comarison of medians in different grous was done using the Mann-Whitney U test. The correlation analysis was erformed with the non-arametric ANOVA test. The study rotocol, including the genetic material evaluation, was designed in adherence to the Declaration of Helsinki and aroved by the local Bioethics Committee. A written informed consent was obtained from all the arents, and informed consent or assent from the adolescent atients, as alicable. RESULTS Grenda R et al Evaluation of the genetic background Nehrotoxicity was found in 38.5% of atients treated with CsA and 29.5% with TAC, while myelotoxicity was observed in 3% and 6.4% of atients receiving AZA and MMF, resectively. The atient s age, gender, tye of re-translan- 19

3 Original Paer Ann Translant, 2009; 14(3): Table 1. PCR and restriction digest analysis arameters. Polymorhism PCR rimer sequence (5 3 ) PCR roduct Restriction enzyme analysis Restriction digest fragments Genotyes CCR2 G190A CGGTGCTCCCTGTCATAAAT 215 BseGI [65 C/24 h] allele 190A = 215 AA (79.67%) GAGCCCACAATGGGAGAGTA allele 190G = AG (18.67%) GG (1.66%) CCR5 wt/δ32 GATAGGTACCTGGCTGTCGTCCAT 227 (wt) Δ32/Δ32 (0.40%) ACCAGCCCCAAGATGACTATCT 195 (Δ32) wt/δ32 (19.29%) wt/wt (80.31%) CYP3A5 A6986G CATGACTTAGTAGACAGATGA 293 SsI [37 C/16 h] allele 3* = *3/*1 (9.20%) GGTCCAAACAGGGAAGAAATA allele 1* = *3/*3 (90.80%) IL1B C(-31)T AGAAGCTTCCACCAATACTC 234 AluI [37 C/24 h] allele (-31)C = 234 CC (9.62%) AGCACCTAGTTGTAAGGAAG allele (-31)T = CT (43.10%) TT (47.28%) IL1RN VNTR CCCCTCAGCAACACTCC 154 (*1) - - *3/*1 (1.75%) GGTCAGAAGGGCAGAA 240 (*2) *3/*3 (52.63%) 325 (*3) *3/*4 (37.72%) 410 (*4) *3/*5 (5.26%) 500 (*5) *4/*4 (2.64%) 595 (*6) IL-6 G(-174)C CAAGACATGCCAAAGTGCTGAGT 182 NlaIII [37 C/ 24 h] allele (-174)G = 182 GG (30.53%) GTGGGGCTGATTGGAAACCTTAT allele (-174)C = GC (51.53%) CC (17.94%) IL-10 G(-1082)A CGGGGGCGGATGGGTAATTTTCA 293 Eam1104I [37 C/24 h] allele (-1082)G = 293 AA (5.60%) GGGACAGGCGAGGCTCAGGCC allele (-1082)A = AG (24.00%) GG (77.40%) MCP-1 A(-2581)G GCTCCGGGCCCAGTATCT 597 PvuII [37 C/24 h] allele (-2581)A = 597 AA (44.76%) GACCGCATTCAATTTCCCTTTAT allele (-2581)G = AG (46.44%) GG (4.60%) MDR1 C3435T TGTTTTCAGCTGCTTGATGG 197 Sau3AI [37 C/24 h] allele 3435T = 197 CC (18.0%) AAGGCATGTATGTTGGCCTC allele 3435C = CT (55.2%) TT (26.8%) TNF-alha G(-308)A TGGAGGCAATAGGTTTTGAGGGTC 294 PagI [37 C/24 h] allele (-308)A = AA (79.80%) AGGAGGGCGGGGAAAGAATCAT allele (-308)G = 294 AG (19.70%) GG (0.50%) 20 TGFB1 C(-509)T CAGACTCTAGAGACTGTCAG 419 BsuI (Eco8II) [37 C/16 h] allele (-509)T = 419 CC (26.08%) GTCACCAGAGAAAGAGGAC allele (-509)C = CT (50.24%) TT (23.68%)

4 Ann Translant, 2009; 14(3): Table 2. Analysis of clinical and genetic factors in CNI-induced nehrotoxicity. Parameter CsA no nehrotoxicity N= 66 tation dialysis, donor age, graft origin or cold ischemia time roved not to be of significance in any drug-related toxicity. For CNIs, the drug exosure, calculated as dose/blood trough level, and the duration of treatment were not found to be significant factors either. CsA nehrotoxicity N= 64 TAC-associated nehrotoxicity correlated with the CCR5 gene olymorhism, as the wt/δ32 genotye was found in 21% of atients with no observed toxicity (<0.041) and in none of those who develoed nehrotoxicity. The results are resented in Table 2. c 2 analysis revealed significant correlation between lack of tacrolimus nehrotoxicity and resence of Δ32/wt CCR5 allele (=0.015) (Table 3). Moreover, the occurrence of the CCR5 wt/δ32 genotye was associated with a significantly better renal allograft function at one year ost translantation (=0.022, ANOVA). The results are TAC no nehrotoxicity N= 28 TAC nehroto-xicity N= 18 Age 11±5 12±4 11±5 11±5 Gender 31 females (47%) 35 males (53%) 27 females (42%) 37 males (58%) 12 females (43%) 16 males (57%) 5 females (28%) 13 males (72%) 27 HD (47%) 29 HD (45%) 8 HD (27%) 8 HD (44%) HD vs. PD 31 PD (41%) 30 PD (47%) 19 PD (68%) 10 PD (56%) Donor age 17±12 19±13 17±13 15±11 Deceased vs. living related donor Cold ischemia time (hours) Drug exosure: dose/kg/blood level (mg/ng/ml) CCR5 Δ32 olymorhism 55 deceased (83%) 11 living related (17%) 56 deceased (88%) 8 living related (12%) 24 deceased (86%) 4 living related (14%) 16 deceased (89%) 2 living related (11%) 23±11 24 ±10 24±10 23± ± ± ± ± wt/wt 54 (84%) wt/δ32 8 (13%) wt/δ33 2 (3%) wt/wt 46 (78%) wt/δ32 13 (22%) wt/δ33 0 (0%) wt/wt 22 (79%) wt/δ32 6 (21%) wt/wt 17 (100%) wt/δ32 0 (0%) * All other gene olymorhisms were not significant for CNIs nehrotoxicity. HD haemodialysis; PD eritoneal dialysis; not significant. Table 3. Correlation between tacrolimus nehrotoxicity and CCR5 gene olymorhism (χ 2 test). CCR5 Toxicity Number/% No toxicity Number/% value wt/wt 22/53.6% 19/46.4% =0.015 wt/δ32 0/100% 7/0% CCR5 Grenda R et al Evaluation of the genetic background GFR (ml/min/1.73 m 2 ) (Schwartz formula) wt/wt ±29.96 shown in Table 4. For other CNIs, secific toxicity, manifested as gingival hyertrohy, was found in 28% of atients treated with CsA, but no correlation with any gene olymorhism was seen. Furthermore, it was observed that the TNF-alha G(-308)A olymorhism was associated with the MMF-induced myelotoxicity (<0.005), although the exosure to MMF was higher in atients who develoed toxicity. The results are resented in Table 5. χ Table 4. Correlation between the CCR5 wt/δ32 olymorhism and graft function at one year ost translantation (ANOVA). wt/δ ±

5 Original Paer Ann Translant, 2009; 14(3): Table 5. Analysis of clinical and genetic factors in AZA- and MMF-induced myelotoxicity. Parameter DISCUSSION AZA no myelotoxicity N=49 AZA myelotoxicity N=2 The rimary objective of this investigation was to exlore the hyothesis that selected immunosuressant-related toxicities may exhibit certain genetic associations. The erformed statistical analysis revealed that several clinical factors, such as the atient s age, gender, tye of re-translantation dialysis, donor age, graft origin and cold ischemia time, as well as for both calcineurin inhibitors the drug exosure and duration of treatment, were not significant factors in drug toxicity. The only significant association found was related to nehrotoxicity and showed a correlation with the occurrence of the CCR5 wt/δ32 genotye in 21% of atients who did not develo nehrotoxicity under the TAC treatment, and with its absence in those who manifested TAC-related toxicity. Chemokine recetor 5 (CCR5) lays an imortant role in the recruitment of monocytes and T cells in the inflammation rocess. A mutation in the CCR5 gene (CCR5 Δ32), leading to a non-functional recetor, has been shown to reduce the chemotactic resonse of monocytes in vitro, while in clinical ractice it has been identified as an indeendent factor associated with a lower risk of develoing the end-stage renal disease in IgA nehroathy. Thus, the CCR5 Δ32 olymorhism has been regarded as an indeendent rotective factor for the late rogression of MMF no myelotoxicity N=129 MMF myelotoxicity N=10 Age 12±3 12±6 11±5 11±6 Gender 23 females (47%) 2 females (100%) 26 males (53%) 0 males (0%) 53 females (41%) 76 males (59%) 3 females (30%) 7 males (70%) 22 HD (45%) 0 HD (0%) 46 HD (36%) 4 HD (40%) HD vs. PD 25 PD (51%) 2 PD (100%) 69 PD (54%) 6 PD (60%) Donor age 15±9 21±12 18±13 15± deceased (85%) 8 deceased (80%) Deceased vs. living related 46 deceased (94%) 2 deceased (100%) 19 living related 2 living related donor 3 living related (6%) 0 living related (0%) (15%) (20%) Cold ischemia time (days) 26±8 25±4 23±11 22±9 Drug exosure: dose/kg mg/day/kg TNF-alha G(-308)A olymorhism ± ± ± ± AA 30 (81%) AG 7 (19%) AA 2 (100%) AA 87 (84%) AG 16 (15%) GG 1 (1%) AA 4 (44%) AG 5 (56%) GG 0 (0%) * All other gene olymorhisms were not significant for AZA or MMF myelotoxicity. HD haemodialysis; PD eritoneal dialysis; not significant. 22 chronic renal damage in atients with ongoing glomeruloathy [6,7]. It was also suggested that the CCR5 gene olymorhism might rove of imortance in resect of renal graft rejection. Yigit and colleagues have demonstrated that the risk of acute rejection in Turkish renal translant atients might be associated with the resence of genetic variations in the chemokine recetor genes CCR and CCR2V641 [8]. Furthermore, Abdi and colleagues have shown a correlation between the risk of acute graft rejection in renal translantation and genetically determined variations in chemokine recetors CCR2 and CCR5 [9]. The strongest evidence seems to derive from the study by Fischereder and colleagues conducted on 1227 renal translant atients, in which the 20-year rimary renal graft survival was seen in 95% of those homozygous for CCR5 Δ32 as comared to 70% of those with the homozygous wildtye or heterozygous CCR5 wt/δ32 genotye [10]. The resent study demonstrates a utative rotective effect of the CCR5 Δ32 gene olymorhism in resect of the tacrolimus-induced nehrotoxicity and most likely stemming from this effect better renal allograft function at one year ost translantation. The exact mechanism of this otential rotection against chronic TAC nehrotoxicity in atients carrying the CCR5 Δ32 allele remains to be elucidated. However, it might be seculated 0.005

6 Ann Translant, 2009; 14(3): that a reduction in the chemotactic resonse of monocytes might be of significance for the minimization or inhibition of inflammation occurring in renal tissue directly and constantly exosed to the drug. Such a ro-inflammatory effect of CNIs, manifested by a significantly higher level of inflammatory markers, has been reorted in adult renal translant atients, and was indeendent of age, gender, time on dialysis, diabetes mellitus status or renal function, although it was more ronounced in CsA- than in TAC-treated atients [11]. A number of reorts have demonstrated that the mechanism of azathiorine myelotoxicity was related to an interindividual variability in thiourine S-methyltransferase (TPMT) an enzyme catalyzing the S-methylation of thiourine drugs. Kurzawski and colleagues have shown that the incidence of leukoenia eisodes (defined as WBC < /L) was significantly higher in heterozygous atients (53.8%) as comared to those with the TPMT wild-tye genotye (23.5%) [12]. Similarly, the study by Fabre and colleagues conducted on 172 AZA-treated atients has demonstrated that, among the 12 individuals carrying one variant TPMT-coding allele (*3A, n=11; *3C, n=1), as many as 58% resented leukoenia, as comared to only 30% of homozygous wild-tye atients [13]. In the resent study, only two atients exhibited leukoenia under AZA theray, and no secific association with any analyzed genotye could be confirmed. Similarly, MMF toxicity might stem from the variability in genetically determined harmacokinetics, resent in the oulation. Lévesque and colleagues have demonstrated the effects of olymorhisms in the UGT1A8, UGT1A9, and UGT2B7 genes, encoding the enzymes roducing the henolic and acyl glucuronides of mycohenolic acid (MPA), on the interindividual variability seen in MMF harmacokinetics in healthy humans [14]. Similar observations were reorted by Baldelli and colleagues for a grou of atients ost renal translantation [15]. The reorts of otential effects of TNF-alha gene olymorhisms on an increased rate of acute graft rejection have been contradictory so far [16-18]. In the resent study, the association between the MMF-induced myelotoxicity and the TNF-alha G(-308)A olymorhism also remains unclear. It is known that activated T lymhocytes may roduce ro-aototic mediators, such as IFN-g, TNF-a, Fas ligand and TGF-b1, which in turn induces an accelerated aotosis of granulocytic rogenitor cells [19]. It is also known that neutroenic atients with severe infections have higher levels of ro-inflammatory cytokines, including TNF-a [20]. It should be emhasized at this oint that, in the resent study, the calculated drug exosure (drug dose/kg) in atients with myelotoxicity was significantly higher than in atients who did not develo this toxicity. Although monitoring of MPA blood levels is currently routine in clinical ractice, comlete data enabling a detailed and comrehensive analysis of MMF exosure was not available in the resent study due to its retrosective nature. Therefore, it is not ossible to conclude whether the observed genetic link between the TNF-alha G(-308)A olymorhism and the MMFinduced myelotoxicity was secific or incidental. Gingival hyertrohy is redominantly associated with the use of CsA. The reort by Kusztal and colleagues on the genetic background of this secific toxicity indicates a otential imortance of the CTLA-4 gene olymorhism in this rocess [21]. CTLA-4 was not examined in the resent study, and no correlation with any of the analyzed genes was found. We acknowledge several significant limitations of the resent study, including the low number of enrolled atients (n=207), retrosective nature if the conducted analysis, resence of many imortant clinical factors, and lack of data on the distribution of some of the genetic olymorhisms in the general Polish oulation. Thus, we believe that this reort should be treated as reliminary albeit a romising one, and that the suitability of the CCR5 Δ32 olymorhism as a marker for a ositive long-term outcome in renal translant atients should be verified in a large-scale multicentre rosective trial. CONCLUSIO The retrosective analysis of over 200 aediatric rimary renal allograft reciients revealed that the CCR5 Δ32 olymorhism might be associated with a rotective effect in chronic tacrolimus-related nehrotoxicity, also manifested as better allograft function. The significance of genetic background for toxicity induced by mycohenolate mofetil remains unclear due to the resence of confounding clinical factors. REFERENCES: Grenda R et al Evaluation of the genetic background 1. Wavamunno MD, Chaman JR: Individualization of immunosuression: concets and rationale Curr Oin Organ Translant, 2008; 13(6):

7 Original Paer Ann Translant, 2009; 14(3): Filler G: Calcineurin inhibitors in ediatric renal translant reciients. Paediatr Drugs, 2007; 9(3): Mourad M, Wallemacq P, De Meyer M et al: Biotransformation enzymes and drug transorters harmacogenetics in relation to immunosuressive drugs: imact on harmacokinetics and clinical outcome. Translantation, 2008; 85(Sul.7): S Utecht KN, Hiles JJ, Kolesar J: Effects of genetic olymorhisms on the harmacokinetics of calcineurin inhibitors. Am J Health Syst Pharm, 2006; 63(23): Schwartz GJ, Haycock GB, Edelmann CM Jr, Sitzer A: A simle estimate of glomerular filtration rate in children derived from body length and lasma creatinine Pediatrics, 1976; 58(2): Panzer U, Schneider A, Steinmetz OM et al: The chemokine recetor 5 Delta32 mutation is associated with increased renal survival in atients with IgA nehroathy. Kidney Int, 2005; 67(1): Berthoux FC, Berthoux P, Mariat C et al: CCchemokine recetor five gene olymorhism in rimary IgA nehroathy: the 32 b deletion allele is associated with late rogression to end-stage renal failure with dialysis. Kidney Int, 2006; 69(3): Yigit B, Bozkurt N, Berber I et al: Analysis of CC chemokine recetor 5 and 2 olymorhisms and renal translant survival. Cell Biochem Funct, 2007; 25(4): Abdi R, Tran TB, Sahagun-Ruiz A et al: Chemokine recetor olymorhism and risk of acute rejection in human renal translantation. J Am Soc Nehrol, 2002; 13(3): Fischereder M, Luckow B, Hocher B et al: CC chemokine recetor 5 and renal-translant survival. Lancet, 2001; 357: Lauzurica R, Pastor MC, Bayes B et al: Subclinical inflammation in renal translant reciients: imact of cyclosorine microemulsion versus tacrolimus. Translant Proc, 2007; 39(7): Kurzawski M, Dziewanowski K, Gawrońska-Szklarz B et al: The imact of thiourine s-methyltransferase olymorhism on azathiorine-induced myelotoxicity in renal translant reciients. Ther Drug Monit, 2005; 27(4): Fabre MA, Jones DC, Bunce M et al: The imact of thiourine S-methyltransferase olymorhisms on azathiorine dose 1 year after renal translantation. Transl Int, 2004; 17(9): Lévesque E, Delage R, Benoit-Biancamano MO et al: The imact of UGT1A8, UGT1A9, and UGT2B7 genetic olymorhisms on the harmacokinetic rofile of mycohenolic acid after a single oral dose in healthy volunteers. Clin Pharmacol Ther, 2007; 81(3): Baldelli S, Merlini S, Perico N et al: C-440T/T- 331C olymorhisms in the UGT1A9 gene affect the harmacokinetics of mycohenolic acid in kidney translantation. Pharmacogenomics, 2007; 8(9): Park JY, Park MH, Park H et al: TNF-alha and TGF-beta1 gene olymorhisms and renal allograft rejection in Koreans. Tissue Antigens, 2004; 64(6): Hahn AB, Kasten-Jolly JC, Constantino DM et al: TNF-alha, IL-6, IFN-gamma, and IL-10 gene exression olymorhisms and the IL-4 recetor alha-chain variant Q576R: effects on renal allograft outcome. Translantation, 2001; 72(4): Brabcova I, Petrasek J, Hribova P et al: Genetic variability of major inflammatory mediators has no imact on the outcome of kidney translantation. Translantation, 2007; 84(8): Palmblad J, Paadaki HA: Chronic idioathic neutroenias and severe congenital neutroenia Curr Oin Hematol, 2008; 15(1): Ihendyane N, Sarrelid E, Wretlind B et al: Viridans stretococcal seticaemia in neutroenic atients: role of roinflammatory cytokines. Bone Marrow Translant, 2004; 33(1): Kusztal M, Radwan-Oczko M, Kościelska-Kasrzak K et al: Possible association of CTLA-4 gene olymorhism with cyclosorine-induced gingival overgrowth in kidney translant reciients Translant Proc, 2007; 39(9):