STRUCTURE-ACTIVITY-RESISTANCE RELATIONSHIPS OF NOVEL NUCLEOSIDE AND NUCLEOTIDE HIV-1 REVERSE TRANSCRIPTASE INHIBITORS. Brian David Herman

Transcription

1 STRUCTURE-ACTIVITY-RESISTANCE RELATIONSHIPS OF NOVEL NUCLEOSIDE AND NUCLEOTIDE HIV-1 REVERSE TRANSCRIPTASE INHIBITORS by Brian David Herman BS, Allegheny College, 2005 Submitted to the Graduate Faculty of the School of Medicine Molecular Virology and Microbiology Graduate Program in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2012

2 UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE This dissertation was presented by Brian David Herman It was defended on July, 9, 2012 and approved by Nicolas Sluis-Cremer, Ph.D. Associate Professor, Dissertation Director Department of Medicine School Medicine, University of Pittsburgh John W. Mellors, M.D. Professor, Committee Member Department of Medicine School Medicine, University of Pittsburgh Zandrea Ambrose, Ph.D. Assistant Professor, Committee Member Department of Medicine School Medicine, University of Pittsburgh Saleem A. Khan, Ph.D. Professor, Committee Member Department of Microbiology and Molecular Genetics School Medicine, University of Pittsburgh Michael Trakselis, Ph.D. Assistant Professor, Committee Member Department of Chemistry School of Arts and Sciences, University of Pittsburgh ii

3 STRUCTURE-ACTIVITY-RESISTANCE RELATIONSHIPS OF NOVEL NUCLEOSIDE AND NUCLEOTIDE HIV-1 REVERSE TRANSCRIPTASE INHIBITORS Brian David Herman, PhD University of Pittsburgh, 2012 Copyright by Brian David Herman 2012 iii

4 Nicolas Sluis-Cremer, Ph.D. STRUCTURE-ACTIVITY-RESISTANCE RELATIONSHIPS OF NOVEL NUCLEOSIDE AND NUCLEOTIDE HIV-1 REVERSE TRANSCRIPTASE INHIBITORS Brian David Herman, Ph.D. University of Pittsburgh, 2012 ABSTRACT Nucleos(t)ide reverse transcriptase inhibitors (N(t)RTI) are essential components of combination antiretroviral therapy for treatment of human immunodeficiency virus type-1 (HIV-1) infection. N(t)RTI are analogs of natural 2 -deoxyribonucleos(t)ides that lack a 3 -hydroxyl. Once metabolized by host kinases to the active form, their incorporation into viral DNA by HIV-1 reverse transcriptase (RT) results in chain termination of DNA synthesis. N(t)RTI efficacy is undermined primarily by rapid selection of resistant/cross-resistant HIV-1 variants. Consequently, the development of novel N(t)RTI with activity against a broad range of N(t)RTIresistant HIV-1 is of critical importance. Rational design of novel N(t)RTI with knowledge of analog structure-activity-resistance relationships with the RT target enzyme is the most promising approach. We hypothesized that uncovering knowledge of how N(t)RTI base, sugar, and phosphate structures influence activity and resistance phenotypes would aid in the rational design of new N(t)RTI with improved activity and resistance profiles. Therefore, a combination of biochemical, antiviral, molecular modeling, and cellular pharmacology analyses provided a iv

5 detailed characterization of structure-activity-resistance relationships for inhibition of wild-type and NRTI-resistant HIV-1 by novel N(t)RTI. First, we studied two novel nucleoside phosphonate NtRTI, (R)-6-[2-phosphonylmethoxy]propoxy]-2,4-diaminopyrimidine (PMEO-DAPym) and (5- (6-amino-purin-9-yl)-4-fluoro-2,5-dihydro-furan-2-yloxymethyl)phosphonate (GS-9148). We showed the diphosphate (-DP) form, PMEO-DAPym-DP acts as a purine mimetic that is recognized by RT as an adenosine analog and unambiguously incorporated across from thymine (DNA) or uracil (RNA). Studies indicated that PMEO-DAPym-DP and GS-9148-DP were superior to tenofovir-dp against both discrimination and excision RT resistance mechanisms. Next, we examined structure-activity-resistance relationships of 6-modified, 3 -azido-2,3 - dideoxyguanosine (3 -azido-ddg) NRTI analogs. In RT-mediated DNA synthesis assays the triphosphate (-TP) form of each analog behaved as an adenosine mimetic for incorporation by HIV-1 RT. Importantly, the structure-activity relationships for incorporation and ATP-mediated excision were different, suggesting that new analogs can be designed that are efficiently incorporated but poorly excised by RT. RS-788, a 5 -monophosphate prodrug of 3 -azido-2,3 - dideoxy-2,6-diaminopurine (3 -azido-2,6-da-p), displayed potent activity against multi-nrtiresistant HIV-1 and unique cellular metabolism. RS-788 was metabolized ~1:1 to both 3 -azido- 2,6-DA-P and 3 -azido-ddg, thus delivering two distinct metabolites, each of which are potent RT chain-terminators that are incorporated opposite different bases, thymine and cytosine, respectively. Combinations of 3 -azido-2,6-da-p+3 -azido-ddg synergistically inhibited multi- NRTI-resistant RT DNA synthesis. v

6 TABLE OF CONTENTS 1.0 INTRODUCTION HIV CLASSIFICATION EPIDEMIOLOGY HIV-1/AIDS TRANSMISSION AND PATHOGENESIS HIV-1 STRUCTURE AND VIRAL LIFE CYCLE ANTIRETROVIRAL THERAPY Antiretroviral drug targets and classes Combination antiretroviral therapy HIV-1 REVERSE TRANSCRIPTASE Steps of HIV-1 reverse transcription RT Structure Nucleic acid substrate binding Mechanism of nucleotide binding and incorporation Pre-steady state kinetics of nucleotide incorporation NRTI PHOSPHORYLATION AND MECHANISM OF RT INHIBITON NRTI Phosphorylation Mechanism of NRTI Inhibition NRTI RESISTANCE SELECTION AND MECHANISMS vi

7 1.8.1 Nucleotide discrimination NRTI-MP excision Antagonism between the discrimination and excision mechanisms FDA-APPROVED NRTI Zidovudine (AZT) and Stavudine (d4t) Didanosine (ddi) Abacavir (ABC) Zalcitabine (ddc), lamivudine (3TC), and emtricitabine (FTC) Tenofovir (TFV) Limitations of the currently approved NRTI NOVEL NRTI DEVELOPMENT Novel NRTI design through structure-activity-resistance relationships Second generation phosphonate NtRTIs: PMEO-DAPY derivatives and GS The 3 -azido-2,3 -dideoxypurine analogs HYPOTHESIS AND SPECIFIC AIMS CHAPTER ONE. THE ACYCLIC 2,4-DIAMINOPYRIMIDINE NUCLEOSIDE PHOSPHONATE ACTS AS A PURINE MIMETIC IN HIV-1 REVERSE TRANSCRIPTASE DNA POLYMERIZATION PREFACE ABSTRACT INTRODUCTION MATERIALS AND METHODS Reagents Steady-state assays using homopolymeric T/Ps vii

8 3.4.3 Steady-state assays using heteropolymeric T/P Pre-steady-state assays Excision assays Molecular modeling Steady state DNA synthesis by human DNA polymerases α, β, and γ RESULTS Inhibition of HIV-1 RT-mediated DNA synthesis by PMEO-DAPym-DP in the presence of homopolymeric T/Ps Inhibition of HIV-1 RT-mediated DNA synthesis by PMEO-DAPym-DP in the presence of heteropolymeric T/Ps Pre-steady-state incorporation of PMEO-DAPym-DP by WT, K65R, K70E, and M184V HIV-1 RT ATP-mediated excision of PMEO-DAPym by WT and mutant HIV-1 RT Molecular modeling Inhibition of human DNA polymerase α-, β-, and γ-mediated DNA synthesis by PMEO-DAPym-DP DISCUSSION CHAPTER TWO. MECHANISM OF DISCRIMINATION OF GS-9148-DP BY K70E/D123N/T165I RT PREFACE ABSTRACT INTRODUCTION MATERIALS AND METHODS Reagents Pre-steady-state assays RESULTS viii

9 4.6 DISCUSSION CHAPTER THREE. SUBSTRATE MIMICRY: HIV-1 REVERSE TRANSCRIPTASE RECOGNIZES 6-MODIFIED-3 -AZIDO-2,3 -DIDEOXYGUANOSINE- 5 -TRIPHOSPHATES AS ADENOSINE ANALOGS PREFACE ABSTRACT INTRODUCTION MATERIALS AND METHODS Reagents Inhibition of HIV-1 RT DNA synthesis under steady-state conditions by the 6-modified-3 -azido-ddgtp analogs Pre-steady-state incorporation of 6-modified-3 -azido-ddgtp analogs Excision of the 6-modified-3 -azido-ddg monophosphate (MP) analogs by WT or TAM-containing HIV-1 RTs Molecular modeling RESULTS Steady-state incorporation of 6-modified 3 -azido-ddgtp nucleotides by HIV-1 RT Pre-steady-state incorporation of 6-modified 3 -azido-ddgtp nucleotide analogs by HIV-1 RT Activity of the 6-modified-3 -azido-ddgtp analogs against HIV-1 RT containing NRTI discrimination mutations Excision of 6-modified-3 -azido-ddg-5 -MP analogs by WT and TAM containing HIV-1 RT Molecular models of 3 -azido-2,6-da-p-tp and 3 -azido-6-cl-p-tp in the active site of HIV-1 RT Molecular models for ATP-mediated excision of the 6-modified-3 -azidoddg-5 -MP analogs ix

10 5.6 DISCUSSION CHAPTER FOUR. RS-788, A PRODRUG OF 3 -AZIDO-2,6-DIAMINO-2,3 - DIDEOXYPURINE: UNIQUE METABOLISM, EXCELLENT RESISTANCE PROFILE, AND SYNERGISTIC INHIBITION OF HIV-1 RT PREFACE ABSTRACT INTRODUCTION MATERIALS AND METHODS Cells, viruses, and NRTI for intracellular metabolism and drug susceptibility studies Quantification of the intracellular metabolites of 3 -azido-2,6-da-p, 3 - azido-ddg, and RS-788 in P4/R5 cells Drug susceptibility assays for WT and NRTI-resistant HIV Reagents for Steady RT DNA synthesis assays Steady-state RT DNA synthesis assays with 3 -azido-2,6-da-p-tp, 3 - azido-ddg-tp, and their fixed-ratio combinations Synergy analysis using the median-effect principle Synergy analysis using normalized isobolograms RESULTS Intracellular pharmacology of 3 -azido-2,6-da-p, 3 -azido-ddg, and RS-788 in P4/R5 cells Antiviral activity of 3 -azido-2,6-da-p, 3 -azido-ddg, and RS-788 against WT and NRTI-resistant HIV Inhibition of HIV-1 RT DNA synthesis by combinations of 3 -azido-2,6-da- P-TP and 3 -azido-ddg-tp Median-effect analysis indicates synergistic inhibition of RT DNA synthesis by 3 -azido-2,6-da-p-tp+3 -azido-ddg-tp combinations x

11 6.5.5 Normalized isobologram plots indicate synergistic inhibition of RT DNA synthesis by 3 -azido-2,6-da-p-tp+3 -azido-ddg-tp combinations DISCUSSION SUMMARY AND FINAL DISSCUSSION PMEO-DAPYM: A PURINE DISGUISED AS A PYRIMIDINE GS-9148: SUGAR MODIFICATION LEADS TO DIVERGENT RESISTANCE MECHANISMS BASE-MODIFIED ANALOGS OF 3 -AZIDO-2,3 -DIDEOXYGUANOSINE: SUBSTRATE MIMICRY RS-788: COMBINATION THERAPY FROM ONE PRODRUG? GENERAL PERSPECTIVES AND FUTURE DIRECTIONS BIBLIOGRAPHY xi

12 LIST OF TABLES Table 3.1 Inhibition of HIV-1 RT mediated DNA synthesis by PMEO-DAPym-DP and other nucleoside analogs using hompolymeric T/Ps Table 3.2 Km and Ki values for PMEO-DAPym-DP and PMEA-DP against HIV-1 RT on homopolymeric T/Ps Table 3.3 Pre-steady state kinetic incorporation values of PMEO-DAPym-DP for WT and drugresistant HIV-1 RT Table 3.4 Excision rates and dead-end complex formation by WT and mutant RT Table 4.1 Pre-steady state kinetic values for GS-9148-DP incorporation by WT and drugresistant HIV-1 RT Table 5.1 Inhibition of steady-state WT and mutant HIV-1 RT DNA synthesis by Table 5.2 Pre-steady-state kinetic values for incorporation of 6-modified-3 -azido-ddgtp analogs by WT HIV-1 RT Table 6.1 Activity, cytotoxicity, and selectivity index of 3 -azido-ddg, 3 -azido-2,6-da-p and RS-788 in peripheral blood mononuclear (PBM) cells Table 6.2 Levels of NRTI-TP and dntp detected in P4/R5 cells incubated with 50 µm 3 -azidoddg, 3 -azido-2,6-da-p, or RS-788 for 4 hours Table 6.3 Antiviral activity of RS-788, 3 -azido-2,6-da-p, and 3 -azido-ddg against WT and NRTI-resistant HIV-1 in P4/R5 cells Table 6.4 Inhibition of steady state WT, T69SSS, and Q151Mc RT DNA synthesis by 3 -azido- 2,6-DA-P-TP, 3 -azido-ddg-tp, and their combinations Table 6.5 Average combination index (CI) values for inhibition of WT, T69SSS, and Q151M c RT DNA synthesis by combinations of 3 -azido-2,6-da-p-tp+3 -azido-ddg-tp Table 6.6 Normalized 50% effect average deviation from additivity (ADA) values of 3 -azido- 2,6-DA-P-TP+3 -azido-ddg-tp combinations against WT, 69SSS, and Q151M c RT DNA synthesis xii

13 LIST OF FIGURES Figure 1.1 A generalized graph of HIV-1 disease progression showing the relationship of CD4+ T lymphocyte decay and plasma viral load over time Figure 1.2 HIV-1 genome organization, viral proteins, and mature virion structure Figure 1.3 Structures of the FDA approved NRTI Figure 1.4 Mechanism of HIV-1 reverse transcription Figure 1.5 Structure of HIV-1 in complex with a DNA/DNA template/primer substrate Figure 1.6 Steps required for nucleotide addition (A) and the molecular mechanism of nucleotide incorporation (B) Figure 1.7 Molecular model of the RT active site showing the pre-incorporation complex of a bound dntp substrate (red) Figure 1.8 General scheme of NRTI phosphorylation to the NRTI-MP, NRTI-DP, and NRTI-TP forms Figure 1.9 Molecular mechanism of NRTI discrimination by HIV-1 RT Figure 1.10 Molecular mechanisms of HIV-1 RT primer unblocking by ATP-mediated NRTI- MP excision Figure 1.11 Formation of a stable, dead-end RT/T-P-NRTI-MP/dNTP complex Figure 3.1 Structures of select acyclic nucleoside phosphonate derivatives Figure 3.2 Structural similarity between the PME-diaminopurine (DAP) derivative and PMEO- DAPym Figure 3.3 Double reciprocal plots for HIV-1 RT inhibition by PMEO-DAPym-DP using poly(ru)/oligo(da) and MnCl2-dATP or poly(rc)/oligo(dg) and MnCl2-dGTP as substrates.. 70 xiii

14 Figure 3.4 Incorporation of PMEO-DAPym-DP as an adenosine analog by WT HIV-1 RT in DNA/DNA (panel A) or RNA/DNA (panel B) T/P Figure 3.5 Autoradiograms (panel A) and rates (panel B) for ATP-mediated excision of PMEO- DAPym, TFV, and PMEA by WT and mutant HIV-1 RT Figure 3.6 A model of PMEO-DAPym-DP bound at the DNA polymerase active site of HIV-1 RT Figure 3.7 Inhibition of human polymerase α (A), β (B), and γ (C) steady state DNA synthesis by PMEO-DAPym-DP Figure 4.1 Structures of GS-9148, tenofovir (TFV), GS-9148-diphosphate (GS9148-DP), tenofovir-diphosphate (TFV-DP), and datp Figure 5.1 Structures of 6-modified-3 -azido-dideoxyguanosine analogs Figure 5.2 The 6-Modified-3 -azido-ddgtp analogs are recognized and incorporated by WT HIV-1 as adenosine analogs Figure 5.3 ATP-mediated excision of 6-modified-3 -azido-ddgmp analogs by WT (A), TAM67 (B), or TAM41 (C) HIV-1 RT Figure 5.4 Molecular models of 3 -azido-ddgtp (A), 3 -azido-6-cl-p-tp (B), 3 -azido-ddatp (C), and 3 -azido-2,6-da-p-tp (D) in the DNA polymerase active site of WT HIV-1 RT Figure 5.5 Molecular models of the excision products of 3 -azido-dda (A), 3 -azido-2,6-da-p (B), 3 -azido-6-aa-p (C), and 3 -azido-6-cl-p (D) in the DNA polymerase active site of HIV-1 RT containing TAMs Figure 6.1 Structures and intracellular pharmacology in PBM cells of 3 -azido-2,6-da-p and RS Figure 6.2 Intracellular pharmacology of 3 -azido-2,6-da-p and RS-788 in P4/R5 cells Figure 6.3 Fold-change in the susceptibility of NRTI-resistant HIV-1 to RS-788, 3 -azido-2,6- DA-P, and 3 -azido-ddg compared to WT HIV Figure 6.4 Fraction-affected versus combination index plots for 3 -azido-2,6-da-p-tp+3 -azidoddg-tp combinations Figure 6.5 Normalized 50% effect isobolograms for of 3 -azido-ddg-tp-tp+3 -azido-ddg-tp combinations xiv

15 ACKNOWLEDGEMENTS First and foremost, I thank my dissertation advisor, Dr. Nicolas Sluis-Cremer. He believed in me from beginning and has been an excellent mentor and teacher throughout the past five years. He allowed me to work on a multidisciplinary research project and to collaborate with researchers from multiple institutions. Dr. Sluis-Cremer gave me the academic freedom to pursue independent lines of research but was always available to provide guidance whenever I found a roadblock. He encouraged me to attend and present my work at several international research conferences. Dr. Sluis-Cremer also gave me the opportunities to publish first-author, peerreviewed manuscripts in well respected academic journals, as well as a first-author book chapter. My experience working with Dr. Sluis-Cremer has broadened and enhanced my academic, research, interpersonal, and communication skills. His mentorship has guided me to become the scientist I am today, for that I am truly grateful. I also thank my committee members Dr. John Mellors, Dr. Zandrea Ambrose, Dr. Saleem Khan, and Dr. Michael Trakselis. They provided excellent guidance to enable me to achieve my research goals. I would like to thank Drs. Mellors and Ambrose, in particular, for stimulating conversations about virology and always pushing me to achieve more. I also owe my gratitude to Dr. Saleem Khan for being an outstanding advocate for all graduate students and being a friend xv

16 and mentor outside of my research career. I thank Dr. Trakselis for providing additional insight about enzyme kinetics and biochemistry. I am eternally grateful to past and present members of the Sluis-Cremer laboratory and other members of our HIV research group. They have given advice and assistance with experiments countless times and produced a laboratory environment that is relaxed yet productive. I especially thank Jeff Meteer, Dr. Jessica Brehm, and Dianna Koontz for guidance with cell culture and virology. I owe my heartfelt gratitude to Dr. Jessica Radzio for being one of the best co-workers and friends a person could have. I also thank my fellow MVM, MMG, and interdisciplinary biomedical graduate students that provided excellent conversations and perspectives from many disciplines. I am grateful to many professors and teachers throughout my academic career that have provided a strong scientific education and outstanding mentorship, especially Dr. JoAnne Flynn, Dr. Brandi Baros, Dr. Anthony LoBello, Carol Wack, and Bill Wesley. Finally, I want to thank my friends, especially Greg Schwartz, and the brothers of Delta Tau Delta Alpha Chapter, especially Dr. John Krempecki, who were always there for moral support. I thank my fiancé Meredith Ponczak for being with me every day through this long journey. I especially thank her for her love and emotional support when times were tough. Most of all, I want to thank my parents David and Teddi Herman and my brother Brad Herman for their ever-present love, encouragement, and confidence in me throughout my pursuit of higher education. xvi

17 1.0 INTRODUCTION In 1983, the human immunodeficiency virus (HIV) was independently discovered by research groups led by Robert Gallo and Luc Montagnier as the etiologic agent of acquired immunodeficiency syndrome (AIDS) (1, 2). Only two years later, Samuel Broder and colleagues showed that the nucleoside analog 3 -azido-thymidine (AZT, zidovudine) had inhibitory activity against HIV replication targeting the viral enzyme reverse transcriptase (RT) (3-5). This seminal discovery demonstrated that HIV replication could be suppressed by small molecule chemotherapeutic agents, and provided the basis for the field of antiviral therapeutics. However, the rapid development of viral resistance to antiviral medications remains a significant challenge to successful antiviral therapy. Therefore, there is a continued need to develop novel drugs. This introductory chapter will discuss key aspects of HIV virology, RT structure and function, antiretroviral therapeutics focusing on nucleoside/nucleotide inhibitors of HIV-1 reverse transcriptase (NRTI), and antiviral drug resistance. 1.1 HIV CLASSIFICATION HIV is a Lentivirus from the family Retroviridae that originated in West and Central sub-saharan Africa from closely related non-human primate simian immunodeficiency viruses (SIV) (2, 6, 7). HIV is classified into two groups, type 1 (HIV-1) and type 2 (HIV-2). HIV-1 is most closely 1

18 related to SIV endemic in chimpanzees (SIVcpz) and is believed to have entered the human population through multiple primate to human zoonotic transmissions (7, 8). HIV-2 likely originated from viruses carried by the sooty mangabey (SIVsmm) (9, 10). The more virulent HIV-1 is responsible for worldwide human infections while HIV-2 is largely confined to sub-saharan Africa (11). HIV-1 is divided into three groups M (major), O (outlier), and N (non-major/non-outlier) based on the viral envelope (env) gene (12, 13). Group M HIV-1 is the most prevalent worldwide and is genetically subdivided into nine clades (clades A-K) which are largely geographically distinct (13). 1.2 EPIDEMIOLOGY HIV-1 infection has grown to a worldwide pandemic. As of 2010, the WHO estimates 34 million people are living with HIV-1 (11). Of those, 16 million are women and 2.5 million are children under the age of 15. Approximately 2.6 million people were newly infected with HIV in 2010 and more than 30 million people have died from HIV/AIDS-related disease since the beginning of the pandemic. Sub-Saharan Africa is the most heavily affected region, accounting for more 68% of HIV-1 infections and 66% of AIDS-related deaths (11). Approximately 5% of the population in sub-saharan Africa was living with HIV-1 in The second most afflicted region is south and south-east Asia with approximately 12% of worldwide infections. India alone accounts for more than 2.4 million cases. The most heavily impacted regions occur in the developing world where low income countries have limited access to antiviral medications. In 2003, it was estimated that 2

19 > 7% of HIV-1 infected individuals in sub-saharan Africa had access to antiretroviral drugs. Initiatives by the World Health Organization, UNAIDS, and PEPFAR have increase access to 37% of those in need by 2010 (11). The lowest prevalence of HIV infection is in west and central Europe with about 0.2% of the population infected. In the United States and Canada, approximately 1.5 million people are infected with HIV-1, representing ~ 0.5% of the adult population. In 2009, there were ~ 70,000 people newly infected with HIV-1 in the United States and Canada and about 26,000 AIDSrelated deaths (11). 1.3 HIV-1/AIDS TRANSMISSION AND PATHOGENESIS HIV-1 is transmitted through direct contact with blood, semen, vaginal fluid, or breast milk of infected persons (14, 15). The most common route of infection is through sexual contact with an infected person (15). Infections also result from intravenous drug use, blood transfusions, and mother-to-child-transmission (intrapartum, peripartum, or via breast feeding). Instances of these infections have decreased substantially due to greater awareness, blood bank screening, and improved prenatal treatment, respectively (11). Following exposure, HIV-1 infects host lymphocytic cells harboring the cell surface protein CD4. HIV-1 infection proceeds through three clinical stages of disease (Figure 1.1): acute infection, secondary infection (clinical latency), and AIDS (15, 16). Acute HIV-1 infection (also referred to as primary infection) lasts approximately 2-4 weeks post-transmission and is characterized by influenza-like illness. Common symptoms include fever, lymphadenopathy, 3

20 Figure 1.1 A generalized graph of HIV-1 disease progression showing the relationship of CD4+ T lymphocyte decay and plasma viral load over time. The CD4+ T lymphocyte count is indicated in blue of the left axis, while the number of HIV-1 RNA copies per milliliter of plasma is indicated in red on the right axis. The landmarks of clinical disease progression are indicated in black. This figure was adapted from references (15, 16). pharyngitis, rash, myalgia, and malaise. Acute infection is associated with a sharp spike in viral load (up to > 1 million HIV-1 RNA copies / ml of plasma) with a concurrent drop in target CD4+ T cells (14, 15). Acute symptoms wane as the host immune system elicits a cytotoxic T cell response, resulting in viral load reduction and partial recovery of CD4+ T cell counts. Recent studies suggest that it is during the initial acute phase of infection that viral reservoirs of latently infected cells are established (17, 18). The specific cell types or tissue compartments that harbor latent HIV-1 are not fully recognized and there is currently substantial debate about how these reservoirs contribute to persistent viremia. HIV-1 replication continues during asymptomatic infection, resulting in a steady decrease in CD4+ T cells over a period of 1 to 10 years (15). 4

21 Without intervention, the clinical development of AIDS occurs once CD4+ T cell counts drop below 200 cells per ml. The severe impairment of the immune system renders the individual highly susceptible to opportunistic infections or cancer. Following the onset of AIDS, patients succumb to opportunistic infections which commonly include pneumocystis pneumonia, tuberculosis, and candidiasis or cancers such as Kaposi s sarcoma and lymphoma (15, 19). 1.4 HIV-1 STRUCTURE AND VIRAL LIFE CYCLE The roughly spherical 110 nm HIV-1 virions are composed of a conical capsid core surrounded by a host cell membrane-derived lipid envelope (Figure 1.2) (20). The capsid core is composed of approximately 1500 molecules of the viral p24 capsid (CA) protein (21). The HIV-1 capsid core encloses two copies of the positive-sense single-stranded RNA genome that are 5 -methyl- GDP capped and 3 -polyadenylated (20). The RNA genomes are tightly bound and stabilized by the nucleocapsid (NC) protein. The virion also contains cellular components, the essential viral enzymes protease (PR), reverse transcriptase (RT), and integrase (IN), and the accessory proteins Vif, Vpr, Nef, and Vpu. The matrix (MA) protein coats the interior of the viral envelope, which is studded with envelope glycoproteins composed of trimers of the gp120 surface protein (SU) and gp41 transmembrane protein (TM) complex. 5

22 Figure 1.2 HIV-1 genome organization, viral proteins, and mature virion structure. The genome structure and protein products were adapted from reference (20). The virion structure was adapted from reference (18). 6

23 The 9.2 kb HIV-1 RNA genome encodes three primary genes gag, pol, and env, as well as six accessory genes tat, rev, vif, vpr, vpu, and nef (Figure 1.2) (20). In the proviral form, the HIV-1 genome, like all retroviruses, contains two copies of the long terminal repeat (LTR) at the 5 - and 3 - ends of the genome. The LTRs are composed of the segments U3 (derived from a unique sequence at the 3 end), R (repeated sequence at both ends), and U5 (derived from a unique sequence at the 5 end) (20). The HIV-1 replication cycle begins when the virion gp120 envelope glycoprotein recognizes and binds the cell surface protein CD4 on host lymphocytes (22, 23). Viral entry requires additional binding to one co-receptor molecules (24). The seven-transmembrane, G- protein-coupled, receptors CCR5 and CXCR4 are most commonly used as HIV-1 entry coreceptors, however others such as CCR8 have also been identified (25-27). Early in HIV-1 infection, viruses predominantly infect CD4+ cells expressing the co-receptor CCR5. During the course of infection, viruses often switch cell entry tropism to infect cells expressing the coreceptor CXCR4 (26, 27). Tight binding of gp120 to CD4 and a co-receptor triggers a conformational change exposing the gp41 viral fusion protein which inserts into the host cell membrane. The resulting fusion of the virus and host membranes releases the viral core into the host cell cytoplasm (24-27). 7

24 Although evidence suggests reverse transcription may begin within the virion, the availability of host cytoplasmic dntp pools facilitates the completion of reverse transcription. (described in detail below) (28). The full-length double-stranded DNA product of reverse transcription together with viral integrase, MA and Vpr and various cellular proteins form the pre-integration complex (PIC) (29). The PIC is transported into the cell nucleus where the viral DNA is inserted into a host chromosome through the action of viral integrase and several host factors (30). Viral genes are expressed from the integrated proviral DNA by the host transcription machinery including RNA polymerase II (31). Proviral transcription is initiated at the U3 region of the 5 LTR that contains numerous binding sites for viral regulators such as Tat (transactivator of transcription), Rev (regulator of viral gene expression), and Nef (negative factor) as well as host transcription factors, including Sp1, NFκB, AP-1, and NFAT. Following transcription initiation, Tat binds the stem-loop TAR element at the 5 end of the nascent mrna and promotes transcription elongation (31). Proviral transcription results in the production of a genome length mrna which can serve as the message for viral polyprotein translation or can be modified to serve as a new RNA genome to be incorporated into a virion (31). The full length mrna transcript contains multiple splice sites to allow for the generation of over 40 unique viral transcripts for the expression of the nine viral genes. The full length (unspliced) mrna serves as the message for translation of the Gag and Gag- Pol precursor polyproteins by host ribosomes. During Gag translation, a -1 ribosomal frameshifting mechanism allows for the production of the Gag- Pol polyprotein (31, 32). This mechanism produces approximately one Gag- Pol polyprotein for every Gag polyproteins. 8

25 The Env polyprotein undergoes multiple glycosylation events in the endoplasmic reticulum and is then trafficked to and inserted into the cellular membrane (33). Full-length RNA genomes interact with the Gag polyprotein through packaging sequences to be transported to the assembling virion at the cell membrane (33, 34). The Gag- Pol polyprotein is also transported via interactions with Gag (33). Virion budding is promoted when RNA/Gag complexes bind the cytoplasmic tail of membrane associated Env proteins. Assembled immature viral particles are released from the cell membrane and the action of the HIV-1 protease begins the maturation process (33). The viral protease first auto-cleaves from the Gag- Pol precursor polyprotein. Further proteolysis of the Gag- Pol precursor liberates the mature RT and IN enzymes. Proteolytic cleavage of the Gag precursor polyprotein yields the mature structural proteins CA, MA, and NC, while cleavage of the Env polyproteins produces the gp41 and gp120 envelope proteins (20, 33). The proteolytic liberation of the mature HIV-1 structural proteins promotes the condensation of the core into its characteristic bullet shape, thus producing mature, infectious viral progeny. 1.5 ANTIRETROVIRAL THERAPY At the beginning of the AIDS epidemic in the early 1980s, HIV-1 infection meant near certain mortality within 1 year from the onset of AIDS. The grave need to curtail this rapidly progressing epidemic led to the development of the RT inhibitor 3 -azido-3 -deoxythymidine (zidovudine, AZT) in 1985 (3-5). This was only two years after the identification of HIV-1 as the etiologic agent of AIDS. AZT, the first drug for the treatment of any viral infection, became clinically available as a monotherapy in 1987 (35). Since then 24 additional antiretroviral drugs 9

26 have been approved by the United States FDA, rendering HIV-1 a chronic manageable infection, in which patients receiving therapy can now live many healthy years before the onset of AIDS (19, 35) Antiretroviral drug targets and classes The FDA-approved antiretrovirals are divided into 6 classes that target 4 key steps in the HIV-1 life cycle: viral entry, reverse transcription, integration, and protein processing/maturation (35, 36). The first steps in the HIV-1 life cycle, viral attachment and membrane fusion are targeted by two classes of drugs known collectively as entry inhibitors. The first class of entry inhibitors are CCR5 antagonists, represented by one FDA approved antiretroviral, maraviroc. Maraviroc binds the viral chemokine co-receptor CCR5, thus preventing gp120 mediated viral attachment (37). Maraviroc, however, has no efficacy against CXCR4-tropic viruses and susceptible viruses can easily become resistant via point mutations in gp120. The viral envelope fusion inhibitor enfuvirtide (T-20) represents the second class of entry inhibitors. Enfuvirtide acts as a peptidomimetic of the HIV-1 gp41 fusion peptide to prevent fusion of the viral and cell membranes (36, 38). Enfuvirtide is reserved for treatment experienced patients because proteolysis of the drug in the gastrointestinal tract requires administration by twice daily intravenous injections. Reverse transcription is inhibited by 12 FDA approved drugs from two classes (36, 39): nucleoside/nucleotide reverse transcriptase inhibitors (NRTI) and non-nucleoside reverse transcriptase inhibitors (NNRTI). The FDA approved NRTI (Figure 1.3) include one monophosphate nucleotide, tenofovir (TFV; [FDA approved as the prodrug tenofovir disoproxil 10

27 Figure 1.3 Structures of the FDA approved NRTI. 11

28 fumarate, TDF]), and 7 nucleosides; zidovudine (AZT), stavudine (d4t), lamivudine (3TC), emtricitabine (FTC), zalcitabine (ddc), didanosine (ddi), and abacavir (ABC). For the remainder of this work the abbreviation NRTI will refer to both nucleoside and nucleotide analogs while the abbreviation NtRTI will be used when specifically referring to nucleotide analogs. NRTI are analogs of natural 2 -deoxribonucleotides that must be metabolized by host cell enzymes to their active triphosphate forms. NRTI-triphosphates (NRTI-TP) compete with cellular dntps for incorporation by RT into HIV-1 DNA. Once incorporated into DNA, NRTI result in chaintermination of viral DNA synthesis due to the lack of a 3 -OH group (39). NRTI mechanisms of action and resistance will be described in detail below. The five NNRTI, efavirenz (EFV), etravirine (ETV), nevirapine (NVP), delavirdine (DLV), and rilpivirine (RPV) are allosteric, non-competitive inhibitors that bind RT in a specific hydrophobic pocket near the polymerase active site (40, 41). NNRTI binding perturbs active site residues, resulting in decreased nucleotide incorporation (41). Single amino acid substitutions in RT can induce resistance and broad cross-resistance to each member of this drug class (42). Following reverse transcription, the viral cdna must be integrated into the host chromosome. Integration is blocked by inhibitors of the HIV-1 encoded integrase enzyme. The integrase inhibitor raltegravir was FDA approved in 2007 for treatment-experienced patients and has been subsequently approved for treatment-naïve patients (36, 43). Raltegravir competitively inhibits the strand transfer step of integration by binding the divalent metal cations in the integrase active site. Integrase inhibitors result in decreased HIV-1 DNA integration. The discovery of novel integrase inhibitors with improved efficacy is an active area of investigation. The final step in producing infectious HIV-1 particles is viral maturation through the proteolytic processing of precursor polypeptides by the virally encoded protease. Protease 12

29 inhibitors (PI) mimic natural protease substrates and block the action of HIV-1 protease (35, 36, 44). Protease inhibition thus prevents the maturation of infectious virions. FDA approved protease inhibitors include indinavir, saquinavir, fosamprenavir, ritonavir, darunavir, atazanavir, tipranovir, lopinavir, and nelfinavir. Most protease inhibitors cause adverse side effects and have poor bioavailability (36, 44). The PI ritonavir also inhibits the cytochrome P-450 CYP3A4 enzyme which is responsible for metabolism of most PI (45). Thus, current FDA guidelines suggest the co-administration of ritonavir with other PIs to minimize metabolism and improve bioavailability and half-life Combination antiretroviral therapy The initial use of AZT as monotherapy quickly led to the development of viral populations with decreased drug susceptibility (46, 47). Multiple studies have shown that treatment regimens including two NRTIs with an NNRTI or a PI suppress HIV-1 replication without the emergence of drug resistance (36, 48, 49). Thus, the use of three or more antiretrovirals from different drug classes in combination, termed highly active antiretroviral therapy (HAART) became the treatment standard in HAART decreased resistance development, reduced patient morbidity, and improved survival (36, 39). To this day, standard antiretroviral treatment regimens include two NRTIs with at least one NNRTI, PI, or integrase inhibitor. The requirement of multiple drug combination therapy provides a heavy pill burden on HIV-1 patients that often require multiple daily doses at various intervals. To ease patient pill burden and increase regimen adherence several fixed-dose combination pill formulations have been developed (36). These include Combivir (AZT+3TC), Trizivir (ABC+3TC+AZT), Truvada (TDF+FTC), Epzicom (ABC+3TC), and Kaletra (lopinavir boosted with ritonavir). The three 13

30 drug combination Atripla (TDF+FTC+EFV) was the first once daily antiretroviral pill including 2 NRTIs and an NNRTI that can fully suppress HIV-1 replication in some patients. Atripla was followed by the approval in 2011 of the multi-class triple combination Complera (TDF+FTC+RPV). The recently developed 4-drug combination Quad pill containing the novel integrase inhibitor elvitegravir, the novel pharmacoenhancer cobicistat (a CYP3A4 inhibitor that boosts levels of other drugs but has no antiviral activity itself), tenofovir, and emtricitabine represents the first once daily dual-target combination pill (50). The Quad pill is expected to be approved by the FDA in the summer of HIV-1 REVERSE TRANSCRIPTASE Successful retrovirus replication requires the conversion of the positive sense, single-stranded RNA genome to double stranded cdna that is competent for incorporation into the host chromosome (51). The RNA-directed DNA synthesis or reverse transcription activity necessary for this process is not required for the growth of eukaryotic cells. Therefore, this step provides a unique viral characteristic that can be targeted for inhibition of viral replication. Reverse transcription was first observed in Rous sarcoma virus by Baltimore and Temin in 1970 (52, 53). In order to complete the complex reverse transcription process, the HIV-encoded reverse transcriptase enzyme is capable of both RNA- directed and DNA-directed DNA synthesis, ribonuclease H cleavage (RNase H, H for hybrid), and strand transfer activity. 14

31 1.6.1 Steps of HIV-1 reverse transcription The multi-step process of HIV-1 reverse transcription will be described in detail here (Figure 1.4): 1) Reverse transcription begins with minus strand DNA synthesis by RNA-dependent DNA polymerase (RDDP) activity of RT (54). A host trna Lys3 hybridized to the RNA genome at a primer binding site (PBS) near the 5 end serves as the initial primer (55). RT elongates the minus strand to the 5 end of the genome, producing a product termed minus strand strong stop DNA (-ssdna). The RNA template of the subsequent RNA/DNA heteroduplex is simultaneously removed by the RNase H activity of RT. 2) RNase H removal of template RNA and subsequent dissociation of -ssdna is essential for minus strand DNA transfer and annealing to a homologous repeat region near the 3 end of the genomic RNA template (56, 57). This strand transfer may occur intra- or inter-molecularly (58). Intermolecular strand transfer provides a source of recombination and genetic diversity during reverse transcription (59). 3) Minus strand elongation with concurrent RNase H cleavage results in a complete cdna. RNase H cleavages during cdna synthesis leave 3 and central polypurine tract (PPT) sequences uncleaved which serve as primers for plus strand DNA initiation (60). Highly specific RNase H cleavages occur at the 3 and 5 ends of the PPT through specific RNase H primer grip contacts with mismatched and unpaired residues in the PPT (61-66). Correct cleavage of the 3 PPT is essential to properly produce the integrase recognition site for proviral integration (65). 15

32 Figure 1.4 Mechanism of HIV-1 reverse transcription. The steps required to produce the full length integration competent HIV-1 double-stranded viral DNA are described in detail in Section This figure was adapted from (51). 16

33 4) Initiation of plus strand DNA synthesis proceeds from the PPT (65-67). After incorporation of exactly 12 nucleotides, the PPT RNA:DNA junction resides in the RNase H primer grip, which promotes RT pausing and dissociation (67, 68). RT then rebinds the substrate in polymerase-independent manner (described below) to specifically cleave the PPT RNA:DNA junction. The enzyme can then dissociate once again and reassociate in a polymerase-dependent confirmation to continue plus strand elongation to the to the 5 cdna template end and the attached trna Lys3 primer. The first 18 ribonucleotides of the trna Lys3 primer serve as the template for the plus strand PBS sequence (67). RT pausing at a modified trna Lys3 ribonucleotide at position 19 allows specific RNase H cleavage at the DNA/tRNA Lys3 interface to release trna Lys3 (68, 69). 5) The complementary PBS sequences at the ends of the plus and minus strands facilitate a second strand transfer event (69, 70). If this transfer occurs in an intramolecular fashion the complex becomes circularized. 6) Bidirectional DNA synthesis elongates the plus strand ultimately resulting in a complete double stranded genome with identical LTR sequences on each end (51). Due to the presence of internally primed DNA fragments (such as from the central PPT), plus strand elongation occurs in a discontinuous fashion (67-69). A combination of RT mediated strand displacement synthesis and gap repair/ligation by cellular enzymes results in the full length, double stranded, integration-competent DNA genome (51) RT Structure The requirement of reverse transcription for HIV-1 replication and the lack of reverse transcriptase activity in host cells make RT an ideal drug target. The structure and function of 17

34 Figure 1.5 Structure of HIV-1 in complex with a DNA/DNA template/primer substrate. The fingers (orange), palm (green), and thumb (red) subdomains make up the polymerase domain of the p66 subunit of RT. The p66 connection and RNase H domains are colored in yellow and blue, respectively. The RT p51 subunit is lacking the C-terminal RNase H domain and is colored in grey. The structure was drawn using PyMol based on the PDB Coordinates 1RTD from Huang et al (77). 18

35 HIV-1 RT has been intensely studied to inform antiretroviral drug discovery. RT is expressed as part of the Gag- Pol precursor polyprotein and is cleaved by HIV-1 protease to release the polymerase (31, 33). HIV-1 RT is a large multidomain heterodimer of 66 kda (p66) and 51 kda (p51) subunits comprised of 560 and 440 amino acids, respectively (Figure 1.5) (71-74). Early studies revealed that the 51 kda subunit is a C-terminal proteolytic truncation of the p66 subunit (73, 75, 76). RT was first crystallized in 1992 by the laboratory of Thomas Steitz, shedding light on the structure and function of each subunit (76). This study revealed that p51 is structurally distinct from p66 and that it may serve primarily as a structural scaffold for the catalytic domains of p66. Furthermore, the crystal structure identified spatially distinct polymerase (residues 1-318) and RNase H (residues ) domains of p66 linked by a connection domain (residues ). The RT polymerase domain is structurally homologous to other polymerases, including the previously crystallized E. coli DNA Pol I Klenow fragment (71, 76). This structure is described as a right hand containing palm, finger, and thumb subdomains, which form a nucleic acid binding cleft at the polymerase active site. The RNase H domain, resembles the E. coli RNase HI enzyme (71, 76). The polymerase and RNase H catalytic active sites are approximately 60 Å apart, spanning 18 nucleotides of a bound nucleic acid substrate (63, 71). Numerous additional studies of the three dimensional structure of HIV-1 RT co-crystallized with various nucleic acid substrates and inhibitors have helped to elucidate RTs catalytic mechanisms of action (63, 71, 76-85). 19

36 Figure 1.6 Steps required for nucleotide addition (A) and the molecular mechanism of nucleotide incorporation (B). 20

37 1.6.3 Nucleic acid substrate binding In order for polymerase or RNase H catalysis to occur, RT must first bind its RNA/DNA or DNA/DNA nucleic acid substrate (Figure 1.6A). Upon substrate binding, the thumb subdomain rotates outward to an open conformation (71, 83). RT preferentially binds most nucleic acid substrates in a conformation (polymerase competent) in which the primer 3 -OH is situated adjacent to the polymerase active site, termed the priming site (P-site). Specific contacts between the polymerase domain and the primer and template strands are essential for proper substrate positioning during catalysis (71). The p66 palm subdomain forms a primer grip region composed of residues that form the β12 and β13 sheets (62, 71, 83, 86). The p51 subunit also makes contact with the primer near the base of the palm in p66. The template strand is stabilized through contacts in the fingers and palm subdomains (71, 83). The bound nucleic acid substrate spans the polymerase and RNase H domains therefore important contacts are also made by the connection and RNase H domains of p66 as wells as by p51 (87). An RNase H primer grip region makes multiple contacts with an RNA/DNA hybrid substrate to allow cleavage of the RNA template (87). To facilitate the variety of RNase H cleavage activities required during reverse transcription, RT is capable of binding nucleic acid substrates in multiple conformations (88, 89). As described above, the polymerase competent (or polymerase dependent) binding mode has the primer 3 -OH situated in the polymerase P-site with the RNase active site 18 nucleotides downstream. This binding mode allows for polymerase dependent RNase H activity during processive DNA synthesis (83, 88). Alternatively, RT can bind an RNA/DNA hybrid with the RNA template 5 end in the polymerase active site thus positioning the RNase H active site 13-21

38 19 nucleotides from the 5 end (89-91). This binding mode, called RNase H competent (or polymerase independent) binding is responsible for the highly specific RNase cleavages at both ends of the PPT during reverse transcription. RT can also bind the nucleic acid substrate irrespective of the primer 3 - or template 5 -termini (92). Template/primer binding in this manner results in random internal cleavage of the RNA template. Certain HIV-1 sequences and RNA secondary structures lead to directed cleavage events when RT is bound in this mode (92). Multiple biochemical and kinetic studies have examined the binding affinity of RT for nucleic acid substrates (57, 83, 86-89, 91, 93). Binding affinity was dependent on several factors including hybrid structure (DNA/DNA or RNA/DNA), substrate length, and template sequence. Generally, the kinetic binding constants (K d ) for RT binding to RNA/DNA and DNA/DNA substrates were approximately 5-20 nm (93, 94) Mechanism of nucleotide binding and incorporation RT binding to a template/primer substrate (in the polymerase competent mode) situates the primer 3 -OH terminus in the P-site and exposes the binding site for an incoming dntp, called the N-site, or nucleotide site. (Figures 1.6 and 1.7). Multiple structural studies of [RTtemplate/primer/dNTP or NRTI] complexes have elucidated the molecular mechanisms of dntp binding and incorporation (76, 77, 83-85). The RT polymerase active site in the palm subdomain contains the catalytic triad residues D110, D185, and D186 (Figure 1.7). Residues D185 and D186 are part of the YXDD motif conserved among all retroviruses, with X being methionine for HIV-1 (83). The catalytic triad aspartate residues coordinate two divalent metal cations (likely 22

39 Figure 1.7 Molecular model of the RT active site showing the pre-incorporation complex of a bound dntp substrate (red). The positions of the priming site (P-site) with the primer 3 -residue (P-3, blue) and the nucleotide binding site (N-site) with a bound dntp (red) are indicated. The catalytic triad residues D110, D185, and D186 (green) coordinate the two magnesium ions shown in purple. Residues K65 L74, Y115, Q151, and M184, shown in yellow, contact the incoming dntp and are often mutated to confer resistance through the discrimination mechanism. The template residues (T) that are base paired with the primer 3 -residue and the incoming dntp are shown in orange. The structure was drawn using PyMol based on the PDB Coordinates 1RTD from Huang et al (77). 23

40 Mg 2+ in vivo) supporting the proposed two metal ion model for the phosphoryl transfer reaction by RT and other polymerases (77, 79). Residues K65, R72, L74, Y115, Q151 and M184 form the N-site for dntp binding and base pairing with the corresponding template base. Residues K65 and R72 interact with the incoming dntp β and γ phosphates, respectively, while residue Q151 contacts the 3 -OH of the incoming dntp. The 2 -position of the dntp is in particularly close proximity to residue Y115, which is believed to confer specificity for dntp over rntp (95, 96). Structural and kinetic studies support an induced fit model where dntp binding at the N- site and appropriate template base pairing causes a conformational change where the fingers subdomain clamps down on the template/primer and dntp (77, 97-99). The resulting closed polymerase complex has the dntp α phosphate aligned for nucleophilic attack by the primer 3 - hydroxyl (Figure 1.6B). This reaction forms the phosphodiester bond between the primer and dntp while producing pyrophosphate. The opening of the fingers subdomain allows pyrophosphate release, template/primer translocation for processive polymerization, or RT dissociation (77, 83). Incorporation fidelity has been attributed to the conformational change dependence on correct dntp binding and base pairing (96, 98, 100) Pre-steady state kinetics of nucleotide incorporation Steady state kinetic assays demonstrate that RT dissociation and template/primer rebinding is rate limiting during DNA synthesis (83). However, pre-steady state or transient kinetic studies, where RT is pre-bound with the template/primer substrate, allow for the measurement of the kinetic binding constant (K d ) and incorporation rate (k pol ) of single nucleotide addition (98, 100). These studies demonstrate that the rate limiting step of single nucleotide incorporation is the conformational change to a closed ternary complex rather than dntp binding or catalysis. 24

41 The binding constants of dntp vary with respect to base. However, in general dntps bind with K d values in the low micromolar range. Studies have shown that dntps may bind more efficiently with DNA/DNA substrates than with RNA/DNA substrates (98, 100). However, the incorporation rates of bound dntp are approximately 2-fold higher for incorporation in RNA/DNA hybrids compared to DNA/DNA hybrids. Pre-steady state analyses of NRTI-TP incorporation compared to the analogous dntp are used to evaluate the relative ability of NRTI- TP to compete for binding and incorporation by RT. 1.7 NRTI PHOSPHORYLATION AND MECHANISM OF RT INHIBITON In order to be orally bioavailable and readily transported across cell membranes, NRTI are administered as prodrugs in the form of nucleosides (lacking phosphates) or chemically shielded monophosphate nucleotides in the case of NtRTI. NRTI and NtRTI must undergo successive phosphorylation by host enzymes to produce the NRTI-TP substrate required for incorporation by RT (36, 39, 101). Some NRTI prodrugs (e.g. ddi and ABC) also require additional modification by other cellular enzymes to produce the nucleotide form active against RT (discussed with respect to each NRTI below). Therefore, NRTI antiviral activity is not only dependent on activity against HIV-1 RT but also on their ability to serve as substrates for host phosphorylating enzymes. 25

42 1.7.1 NRTI Phosphorylation The general phosphorylation scheme required to produce the NRTI-TP RT substrate is presented in Figure 1.8. NRTI-MP is usually produced through the action of the constitutively active deoxynucleoside kinases responsible for endogenous nucleotide salvage or through phosphotransfer from 5 -nucleotidase ( ). Addition of the second phosphate to produce NRTI-DP is carried out by the nucleotide monophosphate kinases: thymidylate kinase, uridylatecytidylate kinase, adenylate kinases 1 5 and guanylate kinase (107). Production of NRTI-TP from NRTI-DP is readily catalyzed by many cellular enzymes but most commonly by nucleotide diphosphate kinase, phosphoglycerate kinase, pyruvate kinase and creatine kinase (108, 109). Conversely, many cellular dephosphorylating enzymes also act on mono-, di-, and tri-phosphate forms of NRTI (36). Therefore, the equilibrium of phosphorylation and dephosphorylation greatly influences intracellular NRTI-TP pools and subsequent antiviral activity. Figure 1.8 General scheme of NRTI phosphorylation to the NRTI-MP, NRTI-DP, and NRTI-TP forms. The NRTI-TP form acts as a competitive substrate with respect to the analogous dntp for incorporation by HIV-1 RT. A generic NRTI base (B) is depicted. 26

43 1.7.2 Mechanism of NRTI Inhibition Once metabolized by host cell enzymes to their triphosphate forms, NRTI-TP inhibit RTcatalyzed proviral DNA synthesis by two mechanisms (83). First, they are competitive inhibitors for binding and/or catalytic incorporation with respect to the analogous dntp substrate. Second, they terminate further viral DNA synthesis due to the lack of a 3 -OH group. Obligate chain termination is the principal mechanism of NRTI antiviral action. NRTI-TP binding affinity and incorporation rate are generally similar to their analogous dntp counterparts (83). Notable exceptions will be discussed with regard to the specific NRTI. In theory, NRTI-TPs should be ideal antivirals. Each HIV virion carries only two copies of genomic RNA. There are about 20,000 nucleotide incorporation events catalyzed by RT during the synthesis of complete viral DNA, thus providing approximately 5000 chances for chain-termination by any given NRTI (20). Since HIV-1 RT lacks a formal proof-reading activity (51, 110), a single NRTI incorporation event should effectively terminate reverse transcription. In reality, however, NRTIs are less potent than might be expected. The two primary reasons responsible for this are: (i) HIV-1 RT can effectively discriminate between the natural dntp and NRTI-TP, and the extent of this discrimination can be increased dramatically by nucleic acid sequence; and (ii) HIV-1 RT can excise the chain-terminating NRTI-MP by using either pyrophosphate (pyrophosphorolysis) or ATP as a substrate (83). These two RT characteristics can be selectively enhanced by single amino acid substitutions thus providing the mechanisms for NRTI resistance (111). 27

44 1.8 NRTI RESISTANCE SELECTION AND MECHANISMS Populations of HIV-1 circulating within individual patients are highly diverse. Genetic diversity is driven by both replication errors resulting in mutation and genome recombination during reverse transcription (58, 59, 110). Mutations are easily generated in HIV-1 genomes for two key reasons; the high rate of viral replication and the lack of a formal proofreading activity in RT. Approximately virions per day are produced in a typical patient and estimates of RT error rate are as high as 5-10 misincorporations per genome per replication cycle ( ). Under selective pressure, such as from antiretroviral drugs, mutated species that provide a replication advantage quickly become dominant viral populations. Antiviral resistance is conferred by mutations that decrease the effectiveness of a drug to inhibit viral replication. Mutations in RT confer resistance to NRTI through two distinct molecular mechanisms: nucleotide discrimination (Figure 1.9) and the phosphorolytic removal (excision; Figure 1.10) of a chain-terminating NRTI-MP (111) Nucleotide discrimination The nucleotide discrimination mechanism of NRTI resistance involves the preferential incorporation of natural dntp substrates over NRTI-TP substrates (Figure 1.9). NRTI-resistant viruses maintain the ability to complete reverse transcription in the presence of drug by excluding NRTI-TP substrates while retaining the ability to incorporate natural dntp substrates 28

45 Figure 1.9 Molecular mechanism of NRTI discrimination by HIV-1 RT. Mutations that confer resistance to NRTI by the discrimination mechanism maintain the ability to incorporate natural dntp while selectively excluding NRTI-TP. NRTI-TP exclusion occurs by decreased NRTI-TP binding affinity (K d ) for the RT active site or decreased rate of NRTI incorporation (k pol ). 29

46 Figure 1.10 Molecular mechanisms of HIV-1 RT primer unblocking by ATP-mediated NRTI-MP excision. Nucleophilic attack of the chain-terminating NRTI-MP from an ATP pyrophosphate donor results in the release of an adenosine-nrti dinucleoside tetraphosphate and restores the primer 3 -OH for subsequent nucleotide incorporation. 30

47 with reasonable efficiency (39, 83, 111). Mutations conferring enhanced NRTI-TP discrimination selectively decrease NRTI binding efficiency or rate of catalysis while preserving binding and incorporation of the analogous dntp. NRTI discrimination mutations occur at residues in the fingers or palm of the polymerase active site including L74V, K65R, Q151M (in complex with other mutations) and M184V/I, some of which form the dntp binding pocket (80, ). These mutations affect NRTI and dntp binding and incorporation through direct interaction or via conformational distortions of the active site. These mutations and their discrimination phenotypes and mechanism toward specific NRTI will be discussed below NRTI-MP excision Although RT does not possess a distinct exonucleolytic proofreading mechanism, RT does have an innate ability to catalyze the reverse reaction to nucleotide incorporation, the pyrophosphorolytic removal of an incorporated nucleotide monophosphate (Figure 1.10), typically referred to as excision ( ). When a newly incorporated nucleotidemonophosphate sits in the N-site prior to RT translocation, it is susceptible to nucleophilic attack by an incoming pyrophosphate donor molecule such as inorganic pyrophosphate (PPi) or ATP (129, 130). This reaction results in the removal of incorporated nucleotide monophosphate from the primer. When PPi or ATP act as the pyrophosphate donor, a dntp or a dinucleotidetetraphosphate product is released, respectively. Nucleotide monophosphate removal, however, is greatly disfavored for wild-type RT during normal DNA synthesis due to the low binding affinity of PPi or ATP and the slow rate of pyrophosphorolysis compared to nucleotide incorporation (83, 128). Mutations in the RT polymerase domain primarily selected by AZT and d4t can enhance the ATP-mediated excision phenotype (46, 47, 133, 134). These mutations are 31

48 termed thymidine analog mutations (TAMs), or alternatively excision enhancing mutations, and will be discussed in detail below with regard to AZT and d4t resistance. TAMs selectively increase the ATP-mediated NRTI-MP excision from a chain-terminated primer (82-84, 135). Although slight discrimination has been observed in some cases, mutant RTs containing TAMs generally incorporate NRTI with similar efficiency as dntp (136). The primary mechanism by which TAMs confer resistance is through increased NRTI-MP removal from chain-terminated primers. In absence of the next complimentary dntp, most NRTI can be excised from the chainterminated primer (137). The mechanism of excision enhancement has been under considerable debate, but is now believed to be primarily due to increased binding affinity of the ATP pyrophosphate donor for most TAMs (82, 135, 138). The T215F/Y mutation in particular increases ATP binding because the F or Y side chains facilitate Pi-Pi stacking with the ATP adenine ring. Excision can only occur prior to RT translocation, while the incorporated NRTI-MP remains in the N-site. Cellular concentrations of dntp can promote RT translocation such that the terminating NRTI-MP moves to the P-site, thus freeing the N-site (83, 137, 139, 140). Binding of the next correct dntp to the N-site results in a stable closed conformation dead-end complex (Figure 1.11): the lack of a 3 -hydroxyl prevents incorporation of the incoming dntp, the terminating NRTI-MP cannot be excised from the primer, and the dntp bound at the N-site prevents retrograde translocation. The dead-end complex model may explain why cellular concentrations of the next complementary dntp inhibit the excision of most terminating NRTI- MP except AZT. It has been suggested that the bulky 3 -azido group of AZT protrudes into the N-site preventing dntp binding (82). Some studies have also suggested that primers terminated 32

49 Figure 1.11 Formation of a stable, dead-end RT/T-P-NRTI-MP/dNTP complex. Following NRTI-MP incorporation, translocation and binding of the next correct dntp results in a stable dead-end complex, in which further nucleotide incorporation and NRTI-MP excision are not possible. 33

50 with AZT-MP preferentially bind in the N-site (137). These explanations are not complete, however, because not all 3 -azido containing analogs are readily excised, suggesting that NRTI base and sugar moieties must also influence excision capacity ( ). The selection of multiple amino acid insertions following position 69 as well as several dipeptide insertions in the fingers subdomain in addition to TAMs (described in detail below) also destabilizes the dead-end ternary complex, thus allowing for improved excision of most chain-terminating NRTI-MP in the presence of the next dntp ( ) Antagonism between the discrimination and excision mechanisms The use of two NRTI together with an antiretroviral drug from another class is recommended for combination antiretroviral therapy because several studies have shown synergy between NRTI combinations, such as AZT/ddI and AZT/3TC ( ). The observed antiviral synergy of these combinations has been attributed to antagonism between the discrimination mutations K65R, L74V, and M184V and TAMs (81, 120, ). K65R, K70E, L74V, or M184V when present in combination with TAMs reverse the AZT resistance observed with TAMs alone. The rate of primer unblocking by ATP-mediated excision is decreased by the addition of K65R, K70E, L74V, and M184V in the background of TAMs (156, 158, 160, 161). Multiple hypotheses have been proposed to explain how these residues diminish excision activity. K65R and M184V may reposition or limit the flexibility of the chain-terminated primer in the active site (81, 155). L74V may alter the base pairing interaction of the NRTI with the template (77, 81). Additionally, TAMs also negatively affect the ability of K65R to discriminate between NRTI-TP and dntp by partially restoring the rate of incorporation (160). 34

51 The poor excision and discrimination phenotypes observed with viruses carrying both TAMs and discrimination mutations can be partially restored by the accumulation of additional mutations (152, ). These mutations, some of which are in the connection and RNase H domains, include E44A/D, T69D, V75M/T, V118I, H208Y, R211K, K219R, N348I, and G333D. 1.9 FDA-APPROVED NRTI NRTI remain an invaluable component of combination antiviral therapy that suppresses viral replication to undetectable levels, thus dramatically improving patient survival and quality of life. However, the rapid selection of NRTI resistance mutations that often confer cross-resistance to multiple NRTI remains the greatest challenge to their success. Much research effort has focused on understanding NRTI activity and resistance. This section will: i) provide a detailed review of the properties of the FDA-approved NRTI, including cellular phosphorylation and metabolism, inhibition of RT, and resistance mutations/mechanisms; and ii) discuss the limitations of the current NRTI to highlight the need for novel NRTI development Zidovudine (AZT) and Stavudine (d4t) Zidovudine (3 -azido-2,3 -dideoxythymidine, AZT) and stavudine (2,3 -didehydro-3 - deoxythymidine, d4t) were first synthesized in the 1960s as potential anticancer drugs, but were abandoned due to toxicity concerns (167). However, both were found to have potent and selective anti-hiv-1 activity at much lower concentrations (3-5). AZT was approved by the FDA for clinical use in 1987, thus becoming the first available antiviral drug. FDA approval of d4t 35

52 followed in AZT and d4t are both thymidine analogs that lack a 3 -hydroxyl group. The ribose ring 3 -hydroxyl of AZT has been replaced with an azido (-N3) group, whereas d4t contains an unsaturated 2,3 -didehyro ribose ring. AZT and d4t are both activated by sequential phosphorylation by thymidine kinase, dtmp kinase, and nucleotide diphosphate kinase to produce the nucleotide mono-, di-, and triphosphate forms (168). AZT is also subject to metabolism in the liver, kidney, and intestinal mucosa to produce the 5 -glucuronide and 3 - amino-thymidine which is highly toxic (169, 170). AZT-TP and d4t-tp also act as substrates for incorporation by mitochondrial polymerase γ resulting in a reduction of mitochondrial DNA and subsequent mitochondrial poisoning (171). AZT-TP and d4t-tp are incorporated by RT into viral DNA across from adenosine bases, resulting in chain-termination with submicromolar 50 % inhibitory concentrations (IC 50 ) (141). Pre-steady state studies show that AZT-TP and d4t-tp are good substrates for incorporation by RT (136). The binding affinities of AZT-TP and d4t-tp are similar to that of TTP with K d values of 2.0 μm, 2.7 μm, and 2.2 μm, respectively (172). The k pol values for TTP, AZT-TP, and d4t-tp are 9.2 sec -1, 8.8 sec -1, and 4.3 sec -1, respectively. Soon after its introduction, AZT monotherapy was shown to lead to rapid resistance development and subsequent therapeutic failure. (46, 47, 133, 134). Decreased AZT susceptibility was associated with the selection of the K70R mutation, which was followed by D67N and K219E/Q. Clinical isolates from patients failing AZT or d4t therapy were found to contain similar TAMs (173, 174). TAMs are typically selected in two patterns i) M41L, D67N, L210W, T215Y, and K219E/Q; and ii) M41L, D67N, K70R, T215F, and K219E/Q (174). These patterns are not exclusive, however, and the reasons they are selected together are not clear. The presence of each TAM in either pattern is not required for substantial resistance, but additional 36

53 TAMs usually results in increased resistance (83). The selection of TAMs is associated with very high levels of viral resistance resulting in up to a three log reduction in AZT or d4t susceptibility. TAMs also confer cross-resistance to all other NRTI (46). The selection of TAMs is often followed by the selection of additional mutations (E44D, A62V, V118I, H208Y, R211K, L214F, multiple insertions following T69, and multiple dipeptide insertions in the fingers subdomain) that further increase resistance and cross-resistance (144, 145, 162, 175). As described above, TAMs confer resistance by selectively increasing the excision of NRTI-MP from chain-terminated primers. RT containing TAMs are significantly more efficient at unblocking AZT-MP- and d4t-mp-terminated primers than WT RT ( , 141). The efficiency with which TAM-containing RTs excise incorporated AZT-MP or d4t-mp varies with the number of TAMs present and the template sequence (39, 83) Didanosine (ddi) Didanosine (ddi, 2,3 -dideoxyinosine) is a prodrug that is converted to ddatp, the active metabolite recognized by RT. Initially, 2,3 -dideoxyadenosine (dda) was evaluated as a clinical candidate but was ultimately discovered to cause nephrotoxicity (176, 177). Interestingly, dda was shown to be metabolized to ddi by adenosine deaminase and that the ddi metabolite is responsible for much of the antiviral activity of dda. Therefore, the administration of ddi avoids the dda associated nephrotoxicity (176, 178). Didanosine is phosphorylated to didanosine-mp by cytosolic 5'-nucleotidase, which uses either inosine monophosphate (IMP) or guanosine monophosphate (GMP) as phosphate donors (179). Didanosine-MP is then converted to ddamp by adenylosuccinate synthetase and 5' adenosine monophosphate-activated protein (AMP) kinase (178). The enzymes involved in phosphorylation of ddamp to ddadp and ddatp have not been 37

54 identified, although AMP kinase and NDP kinase have been proposed to play a role. Didanosine can be hydrolyzed by purine nucleoside phosphorylase (PNP) to release the hypoxanthine base (180). After metabolism and activation, ddatp can be incorporated by HIV-1 RT into the nascent viral DNA causing chain-termination. In cell culture assays, the concentrations of ddi required to inhibit HIV-1 replication by 50 % (EC 50 ) were between 0.1 μm and 4 μm depending on the assay system and cell type (178). ddatp binds RT with similar affinity as datp however, the rate of incorporation is > 5-fold slower for ddatp compared to datp (126). Clinical isolates from patients that received didanosine monotherapy for 1-2 years harbored the mutations L74V, K65R, M184V, as well as some TAMs with L74V being most prevalent (116). The L74V mutation confers at least 5-fold resistance to ddi compared to WT HIV-1 (116, 151). Pre-steady state incorporation assays with L74V RT indicate that the incorporation rate for ddatp is severely decreased (10-fold) compared to WT RT, indicating a discrimination phenotype (126, 181). The L74V mutation also causes reduced viral fitness due to decreased ability to incorporate natural dntps (126, 181). Additionally, AZT+ddI combination treatment can select a cluster of mutations with Q151M appearing first followed by A62V, V75I, F77L, and F116Y (182). Together these mutations are referred to as the Q151M complex (Q151M c ). This complex results in high level resistance to most NRTI (tenofovir is the exception) by the discrimination mechanism (183, 184). The rate of incorporation of each NRTI was significantly decreased compared to that of its counterpart dntp. It is believed that a loss of interaction between Q151 and the 3 -OH of the incoming dntp or NRTI is responsible for this mechanism (183). 38

55 1.9.3 Abacavir (ABC) Abacavir (1S,4R)-4-[2-amino-6-(cyclopropylamino)-9H-purin-9-yl]cyclopent-2-en-1- yl]methanol) is a prodrug of carbovir (2-Amino-1,9-dihydro-9-[(1R,4S)-4-(hydroxymethyl)-2- cyclopenten-1-yl]-6h-purin-6-one), a deoxyguanosine analog (185). Abacavir is phosphorylated to abacavir-mp by adenosine phosphotransferase (186). A yet unidentified cytosolic deaminase then converts abacavir-mp to carbovir-mp. Phosphorylation to the diphosphate derivative occurs via guanidinylate monophosphate kinase. The final phosphorylation step can be catalyzed by a number of cellular enzymes including 5 -nucleotide diphosphate kinase, pyruvate kinase, and creatine kinase (186). Abacavir is extensively catabolized in the liver and only 1.2% is excreted as unchanged abacavir in urine (187). Abacavir oxidation by alcohol dehyrogenases produces a 5 -carboxylic acid derivative and UDP glucuronosyltransferase yields the 5 -O-glucronide (187). Abacavir demonstrated equivalent activity to AZT against HIV-1 clinical isolates in peripheral blood lymphocytes with EC 50 values of 0.26 μm and 0.23 μm, respectively (185). CBV-TP potently and selectively inhibited HIV-1 RT with a Ki value of 21 nm. Both cell culture selection experiments and clinical isolates from patients treated with ABC identified the similar resistance mutations as those selected by ddi (188). The most frequent mutations selected by ABC were M184V and the combination of L74V+M184V. Both of these mutations alone conferred low-level resistance (2- to 4-fold over WT) to ABC. In combination, L74V+M184V conferred 11-fold ABC resistance over WT (188). Like L74V, M184V confers resistance to ABC and other NRTI through the discrimination mechanism( ). Discrimination by M184V has been more thoroughly characterized for 3TC and FTC so the molecular mechanism by which M184V discriminates NRTI will be discussed further below. 39

56 1.9.4 Zalcitabine (ddc), lamivudine (3TC), and emtricitabine (FTC) Zalcitabine (2,3 -dideoxycytidine; ddc), lamivudine ((-)-3 -thia-2,3 -dideoxycytidine; 3TC) and emtricitabine ((-)-3 -thia-5-flouro-2,3 -dideoxycytidine; FTC) are the three cytidine analog NRTI and were FDA approved in 1992, 1994, and 1995, respectively (192). Zalcitabine never saw widespread application due to delayed peripheral neuropathy that progressed with cumulative dose and did not resolve with stoppage of use (193). Neuropathic cytotoxicity was later associated with potent inhibition of mitochondrial polymerase γ (194). ddc was subsequently removed from the market in 2006 (153). Like ddc, 3TC and FTC are cytidine analogs. However, both contain the unnatural L- enantiomer ribose with a sulfur atom replacing the C3 position. Emtricitabine has an additional 5-flouro modification to the cytosine ring. The modified sugar ring results in decreased affinity of 3TC-TP and FTC-TP compared to ddctp for polymerase γ (171). Lamivudine and emtricitabine are both metabolized to their respective 5'-mono- and di- and triphosphate derivatives by deoxycytidine kinase, deoxycytidine monophosphate kinase, and 5 -nucleoside diphosphate kinase, respectively ( ). 3TC and FTC demonstrate antiviral activity against HIV-1 in cell culture and their 5 - triphosphate forms are potent chain-terminators of DNA synthesis upon incorporation by HIV-1 RT ( ). Cell culture selection as well as sequencing of patient isolates identified the mutations M184V or I to confer decreased susceptibility to 3TC and FTC ( ). M184I is selected within two weeks in patients receiving 3TC which is replaced with M184V within two months (205). M184V conferred greater than 1400-fold resistance to 3TC and FTC and crossresistance to ddi and ABC (203). 40

57 The mechanism of M184V resistance has been extensively characterized with structural and kinetic studies. Multiple kinetic studies have demonstrated a severely reduced catalytic efficiency of incorporation of 3TC-TP and FTC-TP by HIV-1 RT containing the M184V mutation ( ). 3TC-TP and FTC-TP demonstrated drastically impaired binding to M184V RT (K d values increased 76- and 19- fold, respectively) compared to WT enzyme with relatively unchanged incorporation rates. The catalytic efficiencies of dctp binding and incorporation for M184V and WT RT were similar, indicating that M184V can effectively discriminate between dctp and 3TC-TP or FTC-TP ( ). A crystal structure of RT containing the M184I mutation revealed that branched side chains at position 184 (i.e. I and V) cause a steric clash with the L-enantiomer ribose of 3TC-TP or FTC-TP but not with the natural D- ribose of dctp (80). This explains why 3TC-TP and FTC-TP binding is diminished while dctp binding is maintained. Together, these findings describe the molecular mechanism of discrimination by which the M184V/I mutations confer resistance to 3TC and FTC Tenofovir (TFV) The acyclic nucleoside phosphonate tenofovir (R-9-(2-phosphonylmethoxypropyl)-adenine; (R)PMPA) has no sugar ring structure but contains an acyclic methoxypropyl linker between the base N9 atom and a non-hydrolyzable C-P phosphonate bond (206). Thus TFV represents the only currently approved NtRTI. Tenofovir is poorly absorbed by the oral route and is therefore administered as a lipophilic orally bioavailable prodrug, tenofovir disoproxil fumarate (TDF), a fumaric acid salt of the bis-isopropoxycarbonyloxymethyl ester of tenofovir (206). Degradation of TDF to its monoester and, subsequently, to tenofovir occurs readily in the intestinal mucosa by the action of carboxylesterases and phosphodiesterases, respectively (207). Tenofovir is 41

58 rapidly converted intracellularly to tenofovir-monophosphate (TFV-MP) and the active tenofovir-diphosphate (TFV-DP) forms by adenylate monophosphate kinase and 5 -nucleoside diphosphate kinase, respectively (208). Cell culture selection experiments identified K65R as the predominant resistance mutation which conferred 3- to 4- fold resistance to TFV compared to WT HIV-1 (209). It has been reported that the K70E mutation is also selected in HIV-1 patients receiving tenofovir in combination with other NRTI (210). However, the K65R and K70E mutations are antagonistic to one another and are not believed to exist on the same genome (211). The K65R mutation provides some level of cross-resistance to all approved NRTI except AZT (212). Both K65R and K70E mutations confer resistance to tenofovir via the discrimination mechanism (122, 160, 161, 212, 213). Unlike the discrimination of 3TC-TP and FTC-TP by M184V, the discrimination phenotype conferred by K65R and K70E toward TFV-DP is driven by decreased k pol, and not by significantly altered binding (122, 160, 161, 212, 213) Limitations of the currently approved NRTI Despite their important contribution to the success of combination antiretroviral therapy, the currently approved NRTI have significant limitations that include adverse events associated with drug toxicity, pharmacokinetic limitations (e.g. short intracellular half-life) or interactions with other antiretroviral drugs, and the selection of drug-resistant variants that are cross-resistant to other NRTI (36). The development of novel NRTI with considerations for these shortcomings is necessary for the continued success of the NRTI drug class. Treatment with NRTI is associated with both short- and long-term toxicities resulting in occasionally life-threatening adverse events (214). Toxicity associated adverse events often 42

59 result in lower drug regimen adherence by patients, thus reducing their anti-hiv-1 efficacy. Examples of acute toxicity from NRTI include: fatigue, dizziness and dyspepsia common with treatment of most NRTI, hypersensitivity reaction from ABC, nausea and vomiting with ddi and ZDV, anemia and neutropenia observed with ZDV treatment, pancreatitis and lactic acidosis in patients treated with ddi or d4t, acute renal failure and drug induced hepatitis are rare but have been observed with treatment of most NRTI ( ). Long term NRTI adverse events include: cardiovascular disease with ABC and ddi, peripheral and central neuropathy with d4t, ddi, ddc, ZDV, diabetes with ZDV, d4t, and DDI, Dyslipidemia with ZDV, d4t, and ABC, various hepatic pathologies with most NRTI, lipodystrophy with d4t and ZDV (214, ). It has been suggested that mitochondrial toxicity from inhibition of mitochondrial DNA polymerase γ represents a common mechanism responsible for many NRTI associated toxicities (223). Mitochondrial toxicity has been directly linked to myopathy and cardiomyopathy resulting from treatment with AZT (224, 225). Indeed, polymerase γ is potently inhibited by the active triphosphate forms of ddc, ddi (metabolized to ddatp), and d4t, however, the active forms of AZT, ABC, and TFV were found to be poor substrates for incorporation by polymerase γ (226). Recent evidence suggests that mitochondrial toxicity may also be due to inhibition of the thymidine phosphorylating enzymes causing indirect inhibition of mitochondrial DNA replication through reduction in mitochondrial TTP pools (227). Mitochondrial toxicity via polymerase γ inhibition or other mechanisms does not explain adverse events from treatment of NRTI such as by ABC and TDF that do not deplete mitochondrial DNA (228). Other mechanisms of NRTI toxicity include the involvement of the major histocompatability complex class 1 human leukocyte antigen 57.1 haplotype in ABC hypersensitivity and TFV accumulation in renal proximal tubules due to influx transport via the human organic anion transporter 1 in 43

60 TDF-associated renal toxicity. (215, 222). The previously identified mechanisms of NRTI toxicity do not explain all NRTI-related adverse events (214). As such, there is much to be learned about the mechanisms of NRTI-induced toxicity in order to inform the development of novel NRTI with improved safety. However, all novel NRTI under current development should be thoroughly evaluated with respect to their propensity to cause cellular and tissue toxicity via known mechanisms such as mitochondrial toxicity and bone marrow depletion. Antiretroviral combination therapy regimens often require patients to take 3 or more drugs daily, which often require multiple pills and multiple doses per day (229). This high therapeutic burden can lead to low patient adherence to antiretroviral regimens thus decreasing the antiretroviral effectiveness. As such, simplifying antiretroviral regimens through fixed-dose combinations that limit pill count and the development of drugs with pharmacokinetic properties amenable to once daily dosing (i.e. long half-life) is an important concern. The requirement of NRTI for intracellular phosphorylation to the active NRTI-TP form suggests that the intracellular concentration of NRTI-TP is more important for antiviral effectiveness than plasma half-life (230, 231). It has been demonstrated that intracellular concentrations of the active triphosphate metabolites of 3TC, FTC, and d4t, rather than levels of unchanged drugs in plasma, correlated with virologic response in HIV-infected patients (230, 232). The intracellular kinetics of activation and half-life of any NRTI-TP is subject to many cellular factors such as: cell activation state; cellular kinase expression levels, activation, and efficiency of NRTI substrate phosphorylation; cell cycle; activity of cellular dephosphorylating enzymes; and intracellular ratios of NRTI/deoxynucleoside, NRTI-MP/dNMP, NRTI-DP/dNDP, and NRTI-TP/dNTP (229) (233). For example, ZDV and d4t are phosphorylated to a greater extent and yield higher 44

61 ZDV-TP/dTTP and d4t/dttp ratios in activated lymphocytes, thus exerting more potent antiretroviral activity in activated cells than in resting cells (234, 235). Conversely, ddi, ddc, and 3TC produce higher NRTI-TP/dNTP ratios and exert more potent antiretroviral activity in resting cells (234, 235). Thus, characterization of the NRTI activation by cellular phosphorylating enzymes and other factors that influence NRTI-TP intracellular half-life must be considered in the development of novel NRTI. To facilitate once or twice daily dosing, novel NRTI should maintain the minimally antiviral effective intracellular NRTI-TP concentration over a period a hours. Another factor that restricts patient antiretroviral regimen options and effectiveness is intra- and inter-antiretroviral class drug-drug interactions. The shared and overlapping phosphorylation pathways for activation of many NRTI leads to intra-nrti drug class pharmacokinetic interactions by competition for phosphorylating enzymes when some NRTI are co-administered (233). For example, AZT and d4t are both phosphorylated to their MP and DP forms by thimidine kinase 1 and thymidylate kinase, respectively, however, AZT-and AZT- MP have stronger affinities for these enzymes (105). This pharmacokinetic interaction results in reduced cellular d4t-tp levels when AZT and d4t are co-administered in cell culture and antagonistic anti-hiv-1 activity in patients receiving AZT and d4t co-therapy (105, 236). A similar interaction has been observed for 3TC and ddc due to their common phosphorylation by deoxycitidine kinase (237). However, not all pharmacokinetic interactions between NRTI are detrimental. Despite competition between TFV and dda for the same phosphorylating enzymes, co-administration of TDF and ddi leads to higher intracellular and plasma levels, and a longer half-life of the active ddi metabolite ddatp (238). This is due to TFV-mediated inhibition of ddi/dda catabolism by purine nucleoside phosphorylase. NRTI are also subject to 45

62 pharmacokinetic interactions with drugs from other antiretroviral classes. For example, when ABC is co-administered with some PIs (e.g. atazanavir and lopinavir), ABC exposure is decreased up to 32 % via increased glucuronidation of ABC by uridine diphosphate glucuronyltransferase and subsequence ABC clearance (239, 240). Similarly, co-administration of TDF with some PIs (notably fosamprenavir and atazanavir) cause changes in TFV plasma and cellular levels, however the mechanism of this interaction is currently under debate (241). These studies illustrate the complex pharmacokinetic interactions of NRTI that must be given careful consideration when choosing which combination of NRTI to include in antiretroviral regimens. Possibly the most important factor affecting the efficacy of the currently approved NRTI is the rapid selection of drug-resistance mutations that can lead to regimen failure. The mechanisms of HIV-1 resistance to NRTI and the specific mutations conferring resistance have been described in detail in the previous sections. Here, I will describe why NRTI resistance posses a significant hurdle to the continued success of the NRTI drug class that must be overcome when developing novel NRTI. The increased access of NRTI-containing antiretroviral regimens along with the successful extension of life span of HIV-1 infected individuals has led to the increasing prevalence of resistance development to some NRTI within infected individuals as well as transmitted NRTI resistance (242). For example, in developing countries, where regimens containing 3TC, FTC, and ABC have become increasing available, the M184V mutation has been observed in 40 % to 85 % of patients failing antiretroviral therapy ( ). Transmitted drug resistance was evident in recent drug resistance surveys of antiretroviral naïve HIV-1 infected patients in America and Europe, where antiretroviral therapy is widely available. These studies identified HIV-1 drug resistance mutations (including resistance to NRTI) in 8 % to 20 % 46

63 of the untreated population ( ). In antiretroviral experienced patients complex combinations of mutations have been identified that confer broad spectrum resistance across multiple drug classes including NRTI, NNRTI, and PI (242, ). Furthermore, patient nonadherence to therapy regimens (often due to adverse events and the high therapy burden discussed above) leads to sub-inhibitory drug levels that promote the selection and survival of drug-resistant variants. In order to stay ahead of the complex and constantly changing antiviral resistance problem, novel NRTI development efforts must focus on analogs that have a low potential for cross-resistance from the current circulating resistant viruses NOVEL NRTI DEVELOPMENT Despite substantial investment and research, there is no vaccine for the prevention of HIV-1 infection (253). Efforts to prevent HIV-1 transmission using pre-exposure chemoprophylaxis, as well as research into strategies to cure HIV-1 infected individuals, are in their infancy (254, 255). Thus, combination antiretroviral therapy remains the best means to curtail the HIV-1 epidemic and improve patient quality of life. Potent combination antiretroviral therapy containing at least two NRTI has drastically decreased death rates and HIV-1 associated morbidities among infected individuals, and has contributed to decreased transmission rates by suppressing viral replication within infected persons (11, 250, 256). The limitations of current NRTI described in the previous section demonstrate the critical need to develop new NRTI that have excellent activity and safety profiles and exhibit little or no cross-resistance with existing drugs. This section will: i) illustrate 47

64 how a comprehensive mechanistic understanding of the molecular interactions of NRTI with RT can guide efforts to identify novel NRTI that are potent against NRTI-resistant HIV-1 and ii) introduce two recent NRTI discovery efforts that will provide the background for the work in this dissertation Novel NRTI design through structure-activity-resistance relationships The rational design of new drugs with considerations for target enzyme structural and specificity determinants has been a productive approach to drug discovery (257, 258). This approach has been employed in the development of novel HIV-1 protease inhibitors, however, a rational drug design approach has not been extensively applied to the development of novel NRTI (259, 260). The world-wide multidisciplinary research effort in the 27 years of the HIV-1 epidemic has provided a detailed molecular understanding of the mechanisms of HIV-1 reverse transcription, RT inhibition, and NRTI activity, resistance, and pharmacology (83). This extraordinary wealth of knowledge provides a distinct advantage for the development of novel NRTI using a rational design approach. The primary focus of this work is understanding NRTI structure-activity-resistance relationships in order to inform the development of novel NRTI that demonstrate low-cross resistance and potent activity against NRTI-resistant HIV-1. In order to develop new NRTI with little or no cross-resistance with existing NRTI, novel drug candidates must have potent activity against viruses carrying mutations that confer resistance via both the discrimination and excision mechanisms. Previous NRTI discovery efforts have largely relied on an empirical approach in which novel analogs are synthesized and evaluated for antiviral activity and toxicity, with, initially, little regard for activity against drug-resistant HIV-1. This approach provides 48

65 unpredictable results in terms of the activity of an investigational NRTI against drug-resistant HIV-1. A rational design approach in which novel analogs are synthesized based on an understanding of NRTI structural components that influence activity towards drug-resistant virus may prove more successful. In 2005, Sluis-Cremer et al. and Parikh et al. described two of the first studies comparing the activity of structurally diverse NRTI against drug-resistant HIV-1 viral replication or RT DNA synthesis (141, 212). These studies provided the novel insight that identified the 3 -azido- 2,3 -dideoxypurine nucleosides as a lead class of novel NRTI with potent activity against drugresistant HIV-1 and will be discussed in detail below. Structure-activity-resistance characterizations such as these may allow the optimization of lead investigational NRTI to overcome one or both of the RT resistance mechanisms. The following two sections provide the background for the work in this dissertation by introducing two classes of novel investigational NRTI and describe why their specific structure-activity-resistance profiles should be characterized Second generation phosphonate NtRTIs: PMEO-DAPY derivatives and GS Nucleoside phosphonate analogs are a structurally distinct class of antiviral compounds that were first developed by De Clercq and colleagues in 1986 (206). Analogs such as the NtRTI tenofovir (TFV) that was discussed above and adefovir (PMEA; 9-(2-phosphonylmethoxyethyl)adenine), an antiviral approved for the treatment of hepatitis B virus, contain no sugar ring and are considered acyclic nucleoside phosphonates (ANP) (206). A group of novel second generation acyclic nucleoside phosphonates, the 6-[2- (phosphonomethoxy)alkoxy]-2,4-diaminopyrimidines (PMEO-DAPy) was recently described by 49

66 Balzarini and colleagues (261, 262). These analogs differ from their parent compounds TFV and PMEA in that they contain a pyrimidine base with the phosphonate moiety linked via the C-6 position, whereas TFV and PMEA have a phosphonate linkage at the N-9 position of an adenine base. Several 5-substituted PMEO-DAPy derivatives were characterized and reported to inhibit a broad range of HIV-1 clinical isolates. These compounds also demonstrated greater activity against drug-resistant clinical isolates than the parent compounds TFV and PMEA. One compound a 5-Me-substituted PMEO-DAPy (PMEO-DAPym) analog demonstrated the most potent inhibition of replication of all the clinical isolates tested (EC 50 against WT = µg/ml) (262). Clinical isolates containing the K65R mutation demonstrated some resistance to PMEO-DAPym but to a lesser extent than for tenofovir. Additionally, PMEO-DAPym was more effective against HIV-1 isolates containing TAMs than TFV and PMEA (262). These encouraging activity and resistance phenotypes warrant a detailed characterization of the molecular mechanisms of RT inhibition and resistance of PMEO-DAPym-DP. The structureactivity-resistance information obtained from these studies may allow further optimization of the promising qualities of this lead compound. Recently, the novel phosphonate NtRTI, (5-(6-amino-purin-9-yl)-4-fluoro-2,5-dihydrofuran-2-yloxymethyl)phosphonic acid (GS-9148), was described by Cihlar and colleagues ( ). GS-9148 differs structurally from the acyclic analogs TFV, PMEA, and PMEO-DAPym in that it contains a fluoro-modified-didehydro-ribose sugar ring, as well as an alternative phosphonate linkage. TFV and PMEA, and GS-1948 share a common adenine base. The phosphonoamidate prodrug of GS-9148, called GS-9131, demonstrated potent antiviral activity against a broad group of clinical HIV-1 isolates in cell culture (mean EC 50 = 37 nm) (263, 266). GS-9148, also had potent activity against purified WT RT (steady state inhibitory constant, K i = 50

67 0.8 µm) (263). GS-9148 displayed a favorable resistance profile against NRTI-resistant HIV-1 strains. Notably, K65R, K70E, and M184V, individually and in every combination had no effect on the activity of GS-9148 compared to WT and TAMs conferred modest resistance to GS-9148 (263). Cell culture selection experiments yielded resistant variants with the novel combination of resistance mutations K70E/D123N/T165I that are not selected by other NRTI and are infrequently observed in treatment-naïve and treatment-experience patients (267, 268). The low cross-resistance with existing NRTI and the selection of a unique resistance pattern warrant a mechanistic understanding of GS-9148-DP activity against WT and drug-resistant RT. Transient kinetic analyses will be used in this dissertation to examine the mechanisms of inhibition of GS DP against WT RT and RT containing the novel resistant mutations K70E/D123N/T165I The 3 -azido-2,3 -dideoxypurine analogs Two studies published in 2005 provide the rationale for pursuing 3 -azdio-2,3 -dideoxypurines as a lead class of novel NRTI with potent activity against viruses carrying discrimination mutations and those carrying excision enhancing mutations (i.e. TAMs) (141, 212). Parikh et al. examined the antiviral activity of a structurally diverse panel of approved and investigational NRTIs that differed by enantiomer, sugar/pseudosugar, and base against HIV-1 carrying the K65R mutation to determine how NRTI structure affects activity (212). The results indicated that NRTI sugar/pseudosugar structure and base identity but not enantiomer influenced antiviral activity against K65R HIV-1. Importantly, NRTIs containing 3 -azido-modified sugars remained active against K65R HIV-1 while NRTI with other sugar/pseudosugar structures demonstrated 51

68 up to 77-fold decreased susceptibility to K65R compared to WT HIV-1. The 3 -azido-2,3 - dideoxynucleosides with thymine and adenine bases had similar activity against K65R HIV-1 as WT HIV-1 in MT-2 cells. The 3 -azido-2,3 -dideoxynucleosides with guanine and cytosine bases had 2.0-fold and 2.5-fold reduced activity against K65R HIV-1 in MT-2 cells, respectively, but these reductions compared to WT were not significant (p-value = 0.09 for 3 -azido-2,3 - dideoxyguanosine) or borderline significant (p-value = 0.05 for 3 -azido-2,3 -dideoxycytidine). This study demonstrates that NRTI base and sugar structure influence antiviral activity against drug-resistant HIV-1. Furthermore, these results suggest that novel NRTI with 3 -azido-sugars may also demonstrate superior activity against viruses carrying the multi-nrti discrimination mutation K65R. In the second study, Sluis-Cremer et al. examined the 3 -azido-2,3 -dideoxynucleosides containing the four DNA nucleobases for activity against AZT-resistant HIV-1 viral replication and RT DNA synthesis (141). In antiviral activity assays in MT-2 cells, 3 -azido-2,3 - dideoxycytidine and AZT demonstrated 10.7-fold and 11.7-fold reduced activity, respectively, against HIV-1 containing TAMs (D67N/K70R/T215F/K219Q) compared to WT HIV-1. However, 3 -azido-2,3 -dideoxyadenosine and 3 -azido-2,3 -dideoxyguanosine demonstrated only 1.2-fold and 1.3-fold reduced activity, respectively, against HIV-1 containing TAMs compared to WT HIV-1. Furthermore, RT DNA synthesis assays showed that TAMs increase the ATP-mediated pyrophosphorylytic excision of the monophosphate forms of AZT and 3 -azido- 2,3 -dideoxycytidine but not the excision of the monophosphate forms of 3 -azido-2,3 - dideoxyadenosine and 3 -azido-2,3 -dideoxyguanosine. These results clearly demonstrate that TAMs confer resistance to 3 -azido-2,3 -dideoxypyrimidine nucleosides (i.e. thymine and cytosine bases) but not to 3 -azido-2,3 -dideoxypurine nucleosides (i.e. adenine and guanine 52

69 bases). Contrary to the accepted dogma at the time, this study demonstrated that the 3 -azido group is not the sole determinant of the RT excision phenotype, but the NRTI base also influences activity against RT containing TAMs. Together these two structure-activity-resistance studies identified 3 -azido-2,3 - dideoxypurine analogs a novel lead class of NRTI with potent activity against HIV-1 containing the discrimination mutation K65R and HIV-1 containing multiple TAMs. A later study by Sluis- Cremer et al. further demonstrated that 3 -azido-2,3 -dideoxyguanosine (3 -azido-ddg) exhibits potent activity against HIV-1 variants that contain the discrimination mutations K65R, L74V or M184V and against HIV-1 that contains multiple thymidine analog mutations (TAMs) that enhance nucleotide excision (172). Furthermore, 3 -azido-ddg does not exhibit cytotoxicity in primary lymphocytes or epithelial and T-cell lines, and does not decrease the mitochondrial DNA content of HepG2 cells. With the exception of FTC that contains a 5 fluoro modification, the active metabolites of all FDA approved NRTI contain natural DNA nucleobases. Given that natural base identity can influence NRTI activity towards drug-resistant RT, it is expected that base modification will also impact NRTI activity. However, the molecular interactions of base-modified analogs with WT or NRTI-resistant HIV-1 RT have not been extensively studied. Accordingly, we synthesized a series of novel base modified 3 -azido-2,3 -dideoxypurine analogs (143). In this dissertation, the structure-activity-resistance relationships of these analogs was characterized in order to identify base modifications that may further improve 3 -azido-2,3 -dideoxypurine activity against NRTI-resistant HIV-1. 53

70 2.0 HYPOTHESIS AND SPECIFIC AIMS Hypothesis Nucleoside/nucleotide reverse transcriptase inhibitors (NRTI/NtRTI) remain an indispensible component of combination antiretroviral therapy. However, NRTI efficacy can be undermined by toxicity and the selection of resistance mutations, which often confer cross-resistance to other NRTI. Consequently, the development of novel NRTI with improved safety and resistance qualities is of critical importance. The rational design of novel therapeutics with considerations for target enzyme structural and specificity determinants has been the most productive approach to drug discovery. Uncovering specific knowledge of how NRTI base, sugar, and phosphate structure influence activity, resistance, and toxicity will inform the rational design and development of new analogs that demonstrate favorable resistance and pharmacologic properties. This information will be obtained through the following specific aims: Specific Aims 1. Use steady-state and transient kinetic analyses to examine the mechanism(s) of action and resistance of two second-generation phosphonate NtRTI-diphosphates against WT and drug-resistant HIV-1 RT. 2. Identify structure-activity-resistance relationships of novel base modified 3 -azido-2,3 - dideoxypurine nucleosides using a combination of biochemical and antiviral assays. 54

71 3.0 CHAPTER ONE. THE ACYCLIC 2,4-DIAMINOPYRIMIDINE NUCLEOSIDE PHOSPHONATE ACTS AS A PURINE MIMETIC IN HIV-1 REVERSE TRANSCRIPTASE DNA POLYMERIZATION Brian D. Herman 1, Ivan Votruba 2, Antonin Holý 2, Jeffrey Meteer 1, Nicolas Sluis-Cremer 1, and Jan Balzarini 3 1 Department of Medicine, Division of Infectious Diseases, University of Pittsburgh, Pittsburgh, PA, 15261, USA; 2 Institute of Organic Chemistry and Biochemistry, Academy of Sciences of the Czech Republic, CZ Prague, Czech Republic; and 3 Rega Institute for Medical Research, K.U. Leuven, B-3000 Leuven, Belgium 55

72 3.1 PREFACE This chapter is adapted in part from a manuscript originally published in the Journal of Biological Chemistry; Herman, B. D., Votruba, I., Holý, A., Sluis-Cremer, N., and J. Balzarini. (2010). The Acyclic 2,4-Diaminopyrimidine Nucleoside Phosphonate Acts as a Purine Mimetic in HIV-1 Reverse Transcriptase DNA Polymerization. J Biol Chem 285(16): pp by The American Society for Biochemistry and Molecular Biology, Inc. Furthermore, this work was presented in part as a poster at The 9 th Annual Symposium on Antiviral Drug Resistance: Targets and Mechanisms, November 16-19, 2008 Richmond, VA. USA. Herman, B. D., Meteer, J., Balzarini, J., and N. Sluis-Cremer. Mechanism of action and resistance to PMEO-5-methyl-DAPy, a novel pyrimidine nucleotide reverse transcriptase inhibitor. The work presented in this chapter is in partial fulfillment of dissertation Aim 1. Brian Herman performed all work with the exception of the steady-state kinetic analyses on homopolymeric template/primers, which were performed by Ivan Votruba. 3.2 ABSTRACT The acyclic pyrimidine nucleoside phosphonate (ANP) phosphonylmethoxyethoxy-diaminopyrimidine (PMEO-DAPym) differs from other ANPs in that the aliphatic alkyloxy linker is bound to the C-6 of the 2,4-diaminopyrimidine base through an ether bond, instead of the traditional alkyl linkage to the N-1 or N-9 of the pyrimidine or purine base. In this study, we have analyzed the molecular interactions between PMEO-DAPym-diphosphate (PMEO- 56

73 DAPym-DP) and the active sites of WT and drug-resistant HIV-1 RT. Pre-steady-state kinetic analyses revealed that PMEO-DAPym-DP is a good substrate for WT HIV-1 RT: its catalytic efficiency of incorporation (k pol /K d ) is only 2- to 3-fold less than that of the corresponding prototype purine nucleotide analogs PMEA-DP or TFV-DP. HIV-1 RT recognizes PMEO- DAPym-DP as a purine base instead of a pyrimidine base and incorporates it opposite to thymine (in DNA) or uracil (in RNA). Molecular modeling demonstrates that PMEO-DAPym-DP fits into the active site of HIV-1 RT without significant perturbation of key amino acid residues and mimics an open incomplete purine ring that allows the canonical Watson-Crick base pairing to be maintained. PMEO-DAPym-DP is incorporated more efficiently than TFV-DP by mutant K65R HIV-1 RT and is not as efficiently excised as TFV by HIV-1 RT containing TAMs. Overall, the data revealed that PMEO-DAPym represents the prototype compound of a novel class of pyrimidine acyclic nucleoside phosphonates that are recognized as a purine nucleotide and should form the rational basis for the design and development of novel purine nucleo(s)(t)ide mimetics as potential antiviral or antimetabolic agents. 3.3 INTRODUCTION Acyclic nucleoside phosphonates (ANPs) are nucleotide analogs that are characterized by the presence of a phosphonate group linked to a pyrimidine or purine base through an aliphatic linker (269). ANPs can be functionally divided into different structural subclasses (Figure 3.1) that include: (i) the phosphonylmethoxyethyl (PME) derivatives (e.g. PMEA (adefovir)); (ii) the phosphonylmethoxypropyl (PMP) derivatives (e.g. TFV ((R)PMPA) and (S)FPMPA); and (iii) the hydroxyphosphonylmethoxypropyl (HPMP) derivatives (e.g. (S)HPMPA and (S)HPMPC 57

74 NH 2 NH 2 NH 2 NH 2 N N N N N N N O O P O N O N O O P O N O N O O P O N O N OH (or F) O O P O O O N OH PMEA (adefovir, ADV) (R)PMPA (tenofovir, TFV) (S)HPMPA (S)FPMPA (S)HPMPC NH 2 NH 2 NH 2 N N N H 2 N O O P O N O O H 2 N O O P O N O O H 2 N O O P O N O O OH (or F) PMEO-DAPym (R)PMPO-DAPym (S)HPMPO-DAPym (S)FPMPO-DAPym Figure 3.1 Structures of select acyclic nucleoside phosphonate derivatives. The structures of PME (PMEA), PMP ((R)PMPA), and HPMP ((S)HPMPA, (S)FPMPA and (S)HPMPC) ANP derivatives and the corresponding PMEO-, (R)PMPO-, (S)HPMPO-, and (S)FPMPO-diamino pyrimidines (DAPym) are shown. 58

75 (cidofovir)) ( ( ). Analogs of each subclass are endowed with a characteristic and specific antiviral activity spectrum (274). For example, the PME-purine derivatives are active against several DNA viruses (i.e. herpesviruses, poxviruses and hepatitis B virus (HBV)) and retroviruses (e.g.hiv-1), whereas the PMP-purine derivatives display antiviral activity against retroviruses and HBV only. The HPMP-purine derivatives are active against a broad variety of DNA viruses (i.e. herpesviruses, poxviruses, and adenoviruses), whereas the cytosine derivative (S)HPMPC represents the sole HPMP-pyrimidine derivative that shows selective activity against cytomegalovirus and poxviruses. Interestingly, the PME- and PMP-pyrimidine derivatives do not exhibit antiviral activity. Thus, minor structural modifications in the side chain and also the identity of the base have a marked impact on the ANP antiviral activity spectrum. All of the ANPs described above are metabolized to a diphosphate form in the cell and act as competitive inhibitors (alternative substrates) of the virus-encoded DNA polymerase (270, ). The ANP-diphosphate binds to the active site of the viral polymerase and competes with the corresponding natural nucleotide (i.e. datp for (S)HPMPA, PMEA, (S)FPMPA and TFV and dctp for (S)HPMPC) for subsequent incorporation into the growing DNA chain. Recently, a new structural subclass of ANP, the acyclic phosphonylmethoxyethoxy- and phosphonylmethoxypropoxy-diaminopyrimidines (designated PMEO- and PMPO-DAPym) derivatives, was identified (262, ). These ANPs differ from the other subclasses by the presence of an aliphatic alkyloxy linker bound to the C-6 of a 2,4-diaminopyrimidine base through an ether bond instead of the traditional alkyl linker bond to the N-1 of a pyrimidine or the N-9 of a purine (Figures 3.1, 3.2). Interestingly, and in contrast to the PME- and PMPpyrimidines, the PMEO- and PMPO-pyrimidine ANP derivatives exhibit pronounced activity against both retroviruses and HBV (283). Of further interest, these analogs display an antiviral 59

76 NH 2 NH 2 N H 2 N N N O O P O O PME-DAP N N H 2 N N O O O P O O PMEO-DAPym Figure 3.2 Structural similarity between the PME-diaminopurine (DAP) derivative and PMEO-DAPym. activity spectrum that is similar to the PME- and PMP-purines. Therefore, it was speculated that there was structural similarity between the 2,6-diaminopurine (DAP) PME-derivative (PMEDAP) and the PMEO-DAPym derivatives (280). This was supported by molecular modeling and superimposition of their optimized three-dimensional structures which demonstrated that the 2,4-diamino-substituted pyrimidine could be regarded as an open-ring analog of the purine system in the 2,6-diaminopurine ANPs (Figure 3.2) (283). In this study, we have analyzed the molecular interactions between PMEO-DAPym-DP and the active site of HIV-1 reverse transcriptase (RT) using both steady-state and pre-steadystate kinetic analyses. The in vitro activity of PMEO-DAPym-DP against WT and drug-resistant recombinant purified HIV-1 RT was also compared to the PME-purine (i.e. PMEA-DP) and PMP-purine (i.e. TFV-DP) analogs. Importantly, we show for the first time that the acyclic pyrimidine nucleoside phosphonate derivative PMEO-DAPym-DP is incorporated into the growing DNA chain by HIV-1 RT as a purine nucleotide analog but not as a pyrimidine nucleotide analog. Therefore, PMEO-pyrimidine derivatives successfully mislead the viral DNA polymerase and act as purine nucleotide mimetics. Also, we obtained kinetic evidence that PMEO-DAPym may have a therapeutic edge over TFV in terms of its level of phenotypic drug 60

77 resistance. Additionally, we examined the ability of PMEO-DAPym-DP, PMEA-DP, and TFV- DP to directly inhibit steady-state DNA polymerization in vitro by recombinant, purified human DNA polymerases alpha (Pol α), beta (Pol β), and gamma (Pol γ). Interestingly, PMEO-DAPym- DP was recognized and incorporated by Pol α, resulting in chain-termination, but was not incorporated by Pol β or Pol γ. The identification of modified pyrimidine analogs opens new perspectives for developing novel types of such ambiguous pyrimidine nucleo(s)(t)ides with antiviral or antimetabolic potential. 3.4 MATERIALS AND METHODS Reagents The WT HIV-1 RT EC used in the steady-state kinetic experiments that utilized homopolymeric template/primers (T/Ps) was derived from an HIV-1 (SF2 strain) pol gene fragment coding for the RT (Pro156-Leu715). The stock solution was 0.36 mg/ml. The WT, K65R, K70E, M184V, M41L/L210W/T215Y (TAM41), and D67N/K70R/T215F/K219Q (TAM67) HIV-1 RTs used in the steady-state and pre-steady-state kinetic experiments that utilized heteropolymeric T/Ps were purified as described previously (284, 285). The protein concentration of these enzymes was determined spectrophotometrically at 280 nm using an extinction coefficient (ε280) of M 1 cm 1, and by Bradford protein assays (Sigma- Aldrich, St. Louis, MO). The RNA- and DNA-dependent DNA polymerase activities of the purified WT and mutant enzymes were essentially identical (data not shown). Purified human DNA polymerases α. Β, and γ were purchased from CHIMERx (Milwaukee, WI). TFV 61

78 diphosphate (TFV-DP) and PMEA diphosphate (PMEA-DP) were purchased from Moravek Biochemicals (Brea, CA). PMEO-DAPym-DP was synthesized and provided by A. Holý (Prague, Czech Republic). ATP, dntps, and ddntps were purchased from GE Healthcare (Piscataway, NJ), and [γ-32p]atp was acquired from PerkinElmer Life Sciences (Boston, MA). RNA and DNA heteropolymeric oligonucleotides were synthesized by IDT (Coralville, IA). The templates poly(rc), poly(ra), poly(ri) and poly(ru) as well as the primers oligo(dg)12-18, oligo(dt)12-18, oligo(dc)12-18, and oligo(da)12-18 were from Pharmacia (Uppsala, Sweden). The homopolymeric T/P substrates poly(rc)/oligo(dg), poly(ra)/oligo(dt), poly(ri)/oligo(dc) and poly(ru)/oligo(da) were prepared by mixing 0.15 mm of template with an equal volume of mm primer Steady-state assays using homopolymeric T/Ps Reactions (50 µl in volume) were carried out in a 50 mm Tris-HC1 (ph 7.8) buffer that contained 5 mm dithiothreitol, 300 mm glutathione, 0.5 mm EDTA, 150 mm KC1, 5 mm MgC1 2 or 5 mm MnCl 2, 1.25 µg of BSA, 0.06% Triton X-100, an appropriate concentration of [ 3 H]-dTTP, [ 3 H]-dGTP, [ 3 H]-dCTP or [ 3 H]-dATP (2 µci/assay), varying concentrations of ANP analog, and a fixed concentration of poly(ra)/oligo(dt) (0.015 mm), poly(rc)/oligo(dg) (0.1 mm), poly(ri)/oligo(dc) (0.015 mm) or poly(ru)/oligo(da) (0.015 mm). Reactions were initiated by the addition of 1 µl of RT and were incubated for 15 min at 37 C. Reactions were then terminated by the addition of 100 µl of 150 µg/ml calf thymus DNA, 2 ml of 0.1 M Na 4 P 2 O 7 (in 1 M HCl), and 2 ml of 10% (v/v) trichloroacetic acid. The solutions were kept on ice for 30 min after which the acid-insoluble material was washed and analyzed for radioactivity. For IC 50 determinations, fixed concentrations of 1.25 µm [ 3 H]dTTP, 2.5 µm [ 3 H]dGTP, 1.75 µm 62

79 [ 3 H]dATP, or 2.5 µm [ 3 H]dCTP were used. For the Ki determinations with respect to the natural substrates, a fixed concentration of T/P was used (as indicated above). For the Ki determinations with respect to T/P, varying concentrations of the T/P were used in the presence of a fixed concentration of 1.25 µm [ 3 H]dTTP, 2.5 µm [ 3 H]dGTP, 1.75 µm [ 3 H]dATP or 2.5 µm [ 3 H]dCTP. The steady state kinetic constants Ki and Km were calculated using the Michaelis- Menten equation derived from double reciprocal (Lineweaver-Burke) plots Steady-state assays using heteropolymeric T/P The ability of PMEO-DAPym-DP to inhibit HIV-1 RT DNA synthesis was also evaluated using heteropolymeric DNA/DNA and RNA/DNA T/Ps. Briefly, reactions were carried out in 50 mm Tris (ph 7.5), 50 mm KCl, 10 mm MgCl 2 containing 20 nm T/P, 0.5 µm each dntp and various concentrations of PMEO-DAPym-DP (0 to 40 µm). The sequences of the T/P substrates are provided in Figure 3.4, and the DNA primers were 5 -radiolabeled with [γ- 32 P]ATP as described previously (141). Reactions were initiated by the addition of 200 nm WT RT, incubated for 10 min at 37 C and then quenched using 20 µl of gel loading buffer (98 % deionized formamide containing 1 mg/ml each of bromophenol blue and xylene cyanol). Control reactions included the addition of either TFV-DP or PMEA-DP. Samples were then denatured at 95 C for 10 min and polymerization products were separated from substrates by denaturing gel electrophoresis using 14 % acrylamide containing 7 M urea. Gels were analyzed using phosphorimaging with a GS525 Molecular Imager and Quantity One Software (Biorad Laboratories, Inc., Hercules, CA). The concentrations required to inhibit the formation of final product by 50 % were calculated using non-linear regression from three independent experiments. 63

80 3.4.4 Pre-steady-state assays A rapid quench instrument (Kintek RQF-3 instrument, Kintek Corporation, Clarence, PA) was used for pre-steady-state experiments with reaction times ranging from 20 ms to 60 s. The typical experiment was performed at 37 C in 50 mm Tris-HCl (ph 7.5) containing 50 mm KCl, 10 mm MgCl 2 and varying concentrations of nucleotide. All concentrations reported refer to the final concentrations after mixing. HIV-1 RT (200 nm) was pre-incubated with 20 nm T/P substrate, prior to rapid mixing with nucleotide and divalent metal ions to initiate the reaction that was quenched with 50 mm EDTA. The sequences of the template and 5 -radiolabeled primer were 5 - CTCAGACCCTTTTAGTCAGAATGGAAATTCTCTAGCAGTGGCGCCCGAACAGGGACA -3 and 5 -TCGGGCG CCACTGCTAGAGA-3, respectively. The quenched samples were then mixed with an equal volume of gel loading buffer and products were separated from substrates as described above. The disappearance of substrate (20mer) and the formation of product (21mer) were quantified using a Bio-Rad GS525 Molecular Imager (Bio-Rad Laboratories, Inc., Hercules, CA). Data were fitted by nonlinear regression with Sigma Plot software (Systat Software, Inc., San Jose, CA) using the appropriate equations (286). The apparent burst rate constant (k obs ) for each particular concentration of dntp was determined by fitting the time courses for the formation of product (21mer) using the following equation: [21mer] = A[1-exp(- k obs t)], where A represents the burst amplitude. The turnover number (k pol ) and apparent dissociation constant for dntp (K d ) were then obtained by plotting the apparent catalytic rates (k obs ) against dntp concentrations and fitting the data with the following hyperbolic equation: k obs = (k pol [dntp])/([dntp] + K d ). Catalytic efficiency was calculated as the ratio of turnover number over dissociation constant ([k pol /K d ]). Selectivity for natural dntp versus ANP was 64

81 calculated as the ratio of catalytic efficiency of dntp over that of ANP ([(k pol /K d ) dntp /(k pol /K d ) ANP ]). Resistance was calculated as the ratio of selectivity of the mutant over that of WT ([(selectivity) Mutant /(selectivity) WT ]) Excision assays A 26 nucleotide DNA primer (P; 5 -CCTGTTCGGGCGCCACTGCTAGAGAT-3 ) was 5 - radiolabeled with [γ- 32 P]ATP and chain-terminated with either PMEO-DAPym-DP, TFV-DP or PMEA-DP as reported previously (141). This chain-terminated primer was then annealed to a DNA template (5 - CTCAGACCCTTTTAGTCAGAATGGAAATTCTCTAGCAGTGGCGCCCGAACAGGGACA -3 ). ATP-mediated excision assays were carried out by first incubating 20 nm T/P with 3 mm ATP, 10 mm MgCl 2, 1 μm datp, and 10 μm ddgtp in a buffer containing 50 mm Tris-HCl (ph 7.5) and 50 mm KCl. Reactions were initiated by the addition of 200 nm WT or mutant RT. Aliquots were removed at defined times, quenched with sample loading buffer, denatured at 95 C for 10 min, and then the product was resolved from substrate by denaturing polyacrylamide gel electrophoresis and analyzed, as described above. Dead-end complex formation was evaluated using the same assay set-up described above. However, the concentration of the next correct dntp (i.e. datp) was varied from µm and reactions were quenched after 60 min Molecular modeling Molecular models were constructed using the X-ray crystallographic coordinates for the RT/T/P/TFV-DP ternary complex (PDB, 1T05) (85). PMEO-DAPym-DP was docked into the 65

82 DNA polymerization active site and energy minimization experiments were carried out using Molecular Operating Environment (Chemical Computing Group, Montreal, Quebec, Canada). Charges were calculated using the Gasteiger method, and iterative minimizations were carried out using the AMBER 99 force field until the energy difference between iterations was less than kcal/mol per Å Steady state DNA synthesis by human DNA polymerases α, β, and γ The ability of PMEO-DAPym-DP to inhibit DNA synthesis by human polymerases α, β, and γ was evaluated using the heteropolymeric DNA/DNA T/Ps indicated in Figure 3.7. The DNA primers were 5 -radiolabeled with [γ- 32 P]ATP and annealed to the template as described previously (141). Preliminary experiments were performed to identify the T/P substrate and reaction conditions that provided the best activity from each human polymerase (data not shown). DNA synthesis reactions for Pol α were carried out in a reaction buffer containing 60 mm Tris (ph 8.0), 5 mm Mg Acetate, 1mM DTT, 0.1 mm spermine, and 0.3 mg/ml BSA. DNA synthesis reactions for Pol β and Pol γ were carried out in the same reaction buffer but in the absence of spermine and with 10 mm MgCl 2 instead of 5 mm Mg Acetate. A solution of the appropriate reaction buffer containing 20 nm T/P, 10 µm each dntp and various concentrations of PMEO-DAPym-DP (0 to 60 µm) was mixed with 3 units of Pol α, 2 units of Pol β, or 2 units of Pol γ to initiate the reaction. One unit is defined as the amount of enzyme required to incorporate 1 nmol (Pol α and Pol β) or 1 pmol (Pol γ) total nucleotide into the acid-insoluble form in 60 min at 37 C. Control reactions included the addition of either TFV-DP or PMEA- DP. Reactions were incubated for 60 min at 37 C and then quenched using 20 µl of gel loading buffer (98 % deionized formamide containing 1 mg/ml each of bromophenol blue and xylene 66

83 cyanol). Samples were then denatured at 95 C for 10 min and polymerization products were separated from substrates by denaturing gel electrophoresis using 14 % acrylamide containing 7 M urea. Gels were analyzed using phosphorimaging with a GS525 Molecular Imager and Quantity One Software (Biorad Laboratories, Inc., Hercules, CA). The concentrations required to inhibit the formation of final product by 50 % were calculated using non-linear regression from three independent experiments. 3.5 RESULTS Inhibition of HIV-1 RT-mediated DNA synthesis by PMEO-DAPym-DP in the presence of homopolymeric T/Ps The ability of PMEO-DAPym-DP to inhibit HIV-1 RT mediated DNA synthesis was first evaluated using four different homopolymeric T/Ps (Table 3.1). PMEA-DP and the 2,3 - dideoxynucleotide derivatives ddatp, ddttp and AZT-TP were included as controls in these experiments. Reactions were carried out using either MgCl 2 or MnCl 2 as the divalent metal ion. In general, MgCl 2 -mediated DNA polymerization reactions proceeded 10- to 100-fold more efficiently than MnCl 2 -mediated reactions when poly(rc)/oligo(dg), poly(ra)/oligo(dt) or poly(ri)/oligo(dc) were used as the T/P substrate. By contrast, efficient DNA synthesis on the poly(ru)/oligo(da) T/P was only observed when MnCl 2 was used as the divalent metal ion (data not shown). PMEO-DAPym-DP showed pronounced submicromolar inhibitory activity (IC 50 = 0.26 µm), that was similar to PMEA-DP (IC 50 = 0.12 µm) or ddatp (IC 50 = 0.23 µm), when poly(ru)/oligo(da) and MnCl 2 -datp were used as substrates. By contrast, AZT-TP and ddttp 67

84 Table 3.1 Inhibition of HIV-1 RT mediated DNA synthesis by PMEO-DAPym-DP and other nucleoside analogs using hompolymeric T/Ps. IC 50 (µm) a Poly(rC)/oligo(dG) [ 3 H]dGTP Poly(rU)/oligo(dA) [ 3 H]dATP Poly(rA)/oligo(dT) [ 3 H]dTTP Poly(rI)/oligo(dC) [ 3 H]dCTP MgCl 2 MnCl 2 MgCl 2 MnCl 2 MgCl 2 MnCl 2 MgCl 2 MnCl 2 PMEO- DAPym-DP > ± 3.3 N.D. b 0.26 ± 0.10 > 200 > 200 > 200 > 200 PMEA-DP > ± 21 N.D. b 0.12 ± 0.06 > 100 > 100 > 100 > 100 ddatp > ± 13 N.D. b 0.23 ± 0.17 > 100 > 100 > 100 > 100 ddttp > 100 > 100 N.D. b > ± ± > 100 > 100 AZT-TP > 100 > 100 N.D. b 67 ± ± ± > ± 7 a Concentration (µm) required to inhibit the RT reaction by 50%. The concentration of MgCl 2 or MnCl 2 in the reaction mixture was 5 mm. Data are the means ± standard deviations of 2 to 3 independent experiments. b N.D., not detectable. 68

85 were required at 257- and > 385-fold higher concentrations, respectively, to inhibit these reactions in the presence of this T/P (Table 3.1). Interestingly, whereas PMEO-DAPym-DP did not inhibit reactions on the poly(ra)/oligo(dt) or poly(ri)/oligo(dc) T/P substrates at 200 µm, the compound was found to exert a 62-fold weaker inhibition (IC 50 = 16 μm) when poly(rc)/oligo(dg) and MnCl 2 -dgtp were used as substrates than when poly(ru)/oligo(da) T/P was used. No inhibition was noticed at 100 µm when MnCl 2 was replaced by MgCl 2. PMEA-DP and ddatp did not show pronounced inhibitory activity (IC 50 = µm) under similar assay conditions (Table 3.1). Additional studies demonstrated that PMEO-DAPym-DP acted as a competitive inhibitor of MnCl 2 -[ 3 H]dATP or MnCl 2 -[ 3 H]dGTP binding, and as a linear mixedtype inhibitor of poly(ru)/oligo(da) or poly(rc)/oligo(dg) binding (Figure 3.3). The steady state Michaelis-Menten binding (K m ) and inhibitory (K i ) constants determined from these experiments are provided in Table 3.2. Taken together, these data demonstrate that HIV-1 RT recognizes and incorporates PMEO-DAPym-DP as an adenine nucleotide derivative. The fact that PMEO-DAPym-DP was also weakly incorporated by HIV-1 RT into the poly(rc)/oligo(dg) T/P substrates when MnCl 2 was used as the divalent metal ion suggests that this nucleotide might also base pair with cytosine. Alternatively, it is well known that nucleotide misincorporation is more readily facilitated by MnCl 2 in comparison with MgCl 2, because MnCl 2 can partially compensate for the rate-limiting chemistry step that governs misincorporation reactions (287). Also, homopolymeric T/P substrates represent more artificial reaction conditions than heteropolymeric T/P substrates, making the latter more relevant to the physiological situation. 69

86 Figure 3.3 Double reciprocal plots for HIV-1 RT inhibition by PMEO-DAPym-DP using poly(ru)/oligo(da) and MnCl2-dATP or poly(rc)/oligo(dg) and MnCl2-dGTP as substrates. The assay conditions are described in the Materials and Methods. PMEO-DAPym-DP was determined to be a competitive inhibitor of datp (A) and dgtp (B) binding and a linear mixedtype inhibitor of poly(ru)/oligo(da) (C) or poly(rc)/oligo(dg) (D) binding. The K i values determined from these experiments are provided in Table

87 Table 3.2 Km and Ki values for PMEO-DAPym-DP and PMEA-DP against HIV-1 RT on homopolymeric T/Ps. Competing entity Competing entity Inhibitor Poly(rU)/oligo(dA) datp Poly(rC)/oligo(dG) dgtp PMEO- DAPym-DP K m (μm) a K i (μm) a K m (μm) K i (μm) K m (μm) K i (μm) K m (μm) K i (μm) 1.2 ± 0.1 b 0.41 ± ± ± ± ± ± ± 1.2 PMEA-DP 1.2 ± ± ± ± ± ± ± ± 5.7 a K m and K i values were calculated from the kinetic data in Figure 3.3 using linear regression analysis. b Data are the means ± standard deviations of 2 to 3 independent experiments. 71

88 3.5.2 Inhibition of HIV-1 RT-mediated DNA synthesis by PMEO-DAPym-DP in the presence of heteropolymeric T/Ps In order to determine the incorporation profile of PMEO-DAPym-DP, we next examined inhibition HIV-1 RT-mediated DNA polymerization on heteropolymeric DNA/DNA and RNA/DNA T/Ps with MgCl 2 as the divalent metal cation (Figure 3.4). In these experiments, TFV-DP and PMEA-DP were included as controls. Consistent with the studies described above, we found that HIV-1 RT recognized PMEO-DAPym-DP as a purine but not a pyrimidine nucleotide analog and incorporated it opposite to thymine in the DNA template or uracil in the RNA template. As expected, its incorporation resulted in chain-termination of DNA synthesis. The concentration of PMEO-DAPym-DP required to inhibit HIV-1 RT-catalyzed DNA synthesis by 50 % (IC 50 ) was calculated to be 3.5 µm and 15 µm on the DNA/DNA and RNA/DNA template/primer substrates, respectively. By comparison, the IC 50 values for TFV-DP and PMEA-DP were calculated to be 0.79 µm and 0.78 µm for the DNA/DNA, and 1.83 µm and 1.21 µm for the RNA/DNA T/P substrates, respectively. In these assays, PMEO-DAPym-DP was not incorporated opposite to the alternative pyrimidine cytosine, even when MnCl 2 was used as the divalent metal ion (data not shown). 72

89 Figure 3.4 Incorporation of PMEO-DAPym-DP as an adenosine analog by WT HIV-1 RT in DNA/DNA (panel A) or RNA/DNA (panel B) T/P. The sequences of the DNA/DNA and RNA/DNA T/P are indicated above each autoradiogram. 73

90 3.5.3 Pre-steady-state incorporation of PMEO-DAPym-DP by WT, K65R, K70E, and M184V HIV-1 RT Pre-steady-state kinetic analyses were carried out to elucidate, in detail, the interactions between PMEO-DAPym-DP and the polymerase active site of HIV-1 RT (Table 3.3). Because PMEO- DAPym-DP behaves as an adenine nucleotide analog, we again included TFV-DP and PMEA- DP as controls. In addition, we examined the activity of PMEO-DAPym-DP against RTs containing the K65R and K70E mutations that are associated with TFV and PMEA resistance, respectively (288, 289). The M184V mutation, which may confer hypersusceptibility to TFV, was also examined. The results (Table 3.3) show that the catalytic efficiency of incorporation (k pol /K d ) of PMEO-DAPym-DP for WT HIV-1 RT is approximately 2- to 3-fold less than the k pol /K d values determined for PMEA-DP or TFV-DP. This decrease in the k pol /K d value for PMEO-DAPym-DP (relative to PMEA-DP and TFV-DP) is driven predominantly by a slower rate of nucleotide analog incorporation (k pol ) and not by a diminished binding affinity (K d ) for the DNA polymerase active site of RT. As reported previously, the catalytic efficiency of incorporation of TFV-DP is decreased and 2.5-fold by the K65R and K70E mutations in RT (122, 161). Consistent with previously published cross-resistance data (288, 289), both the K65R and K70E mutations in HIV-1 RT also conferred resistance to PMEA-DP. Similar to TFV-DP, this resistance was driven primarily by a selective decrease in the rate of PMEA-DP incorporation (k pol ) and not by a decrease in the nucleotide binding affinity (K d ). 74

91 Table 3.3 Pre-steady state kinetic incorporation values of PMEO-DAPym-DP for WT and drug-resistant HIV-1 RT. datp ANP k pol (s -1 ) K d (µm) k pol /K d (µm -1 s -1 ) k pol (s -1 ) K d (µm) k pol /K d (µm -1 s -1 ) Selectivity b Resistance c PMEO-DAPym-DP WT 24.4 ± 3.9 a 3.2 ± ± ± K65R 12.6 ± ± ± ± K70E 18.0 ± ± ± ± M184V 14.8 ± ± ± ± TFV-DP WT 24.4 ± ± ± ± K65R 12.6 ± ± ± ± K70E 18.0 ± ± ± ± M184V 14.8 ± ± ± ± PMEA-DP WT 24.4 ± ± ± ± K65R 12.6 ± ± ± ± K70E 18.0 ± ± ± ± M184V 14.8 ± ± ± ± a Values represent the means ± standard deviations of three independent experiments. b Selectivity is (k pol /K d ) dntp /(k pol /K d ) ANP. c Resistance (n-fold) is selectivity mutant /selectivity WT. 75

92 Both the K65R and K70E mutations in RT also conferred resistance to PMEO-DAPym-DP via a similar mechanism (i.e. selective decrease in k pol ). However, PMEO-DAPym-DP displayed better incorporation activity against K65R RT than TFV-DP. In this regard, a previous study reported that PMEO-DAPym exhibited better antiviral activity (lower levels of phenotypic drug resistance) against a panel of clinical virus isolates that contained multiple drug resistance mutations, including K65R, than did either PMEA or TFV (262). Furthermore, these data highlight that subtle changes in the side chains and identity of the base have a marked impact on the ANP anti-hiv-1 activity spectrum ATP-mediated excision of PMEO-DAPym by WT and mutant HIV-1 RT HIV-1 RT has the intrinsic ability to rescue DNA synthesis from a blocked primer by ATPmediated phosphorolytic excision of the DNA chain-terminating nucleotide (130). This ATPmediated excision activity of HIV-1 RT is selectively increased by TAMs (131, 132), but can be diminished by other mutations, including K65R and K70E (122, 161). Accordingly, we next investigated the ability of WT, K65R, K70E and TAM-containing RT to excise PMEO-DAPym from a DNA chain-terminated template/primer. Two RT enzymes that contained different patterns of TAMs (i.e. M41L/L210W/T215Y (TAM41) and D67N/K70R/T215F/K219Q (TAM67)) were included in this study. In addition, TFV- and PMEA-chain terminated DNAs were included as controls. The results (Figure 3.5, Table 3.4) demonstrate that, in comparison 76

93 Figure 3.5 Autoradiograms (panel A) and rates (panel B) for ATP-mediated excision of PMEO-DAPym, TFV, and PMEA by WT and mutant HIV-1 RT. For panel B, data represent the means ± standard deviations of two independent experiments. 77

94 Table 3.4 Excision rates and dead-end complex formation by WT and mutant RT. RT Excision Rate a (min -1 ) IC 50 for DEC formation b (µm) PMEO - TFV PMEA PMEO -DAPym TFV PMEA DAPym WT ± ± ± ± ± ± 1.8 TAM67 c ± 0.02 (3.7) e ± 0.01 (3.1) ± 0.01 (3.2) 79.0 ± ± ± 4.6 TAM41 d ± 0.02 (3.6) ± 0.01 (2.1) ± 0.01 (2.6) 78.3 ± ± ± 7.5 a Values represent the means ± standard deviations from two independent experiments. b Values represent means ± standard deviations from three independent experiments. c TAM67: D67N/K70R/T215F/K219Q d TAM41: M41L/L210W/T215Y e Values in parentheses indicate fold change compared to WT RT. 78

95 with the WT enzyme, both TAM41 and TAM67 HIV-1 RT exhibited increased capacities to excise all three ANPs. However, the excision of PMEA and PMEO-DAPym by TAM41 RT occurred less efficiently than that of TFV. In contrast to the RTs containing TAMs, the mutant K70E and K65R RT enzymes exhibited poor excision activity that was independent of the DNA chain-terminating nucleotide analog. Previous studies have shown that the next complementary nucleotide can inhibit ATP-mediated chain terminator removal (81). To determine the magnitude and nature of this inhibition against PMEO-DAPym, PMEA, and TFV, we determined the IC 50 of the next complementary nucleotide for the ATP-dependent removal of each of the acyclic nucleoside phosphonate analogs. The results (Table 3.4) show that the inhibitory concentrations of the next complementary dntp were found to be somewhat higher for TFV compared with either PMEA or PMEO-DAPym. Taken together, these data suggest that PMEO-DAPym is a less efficient substrate for ATP-mediated excision than TFV. These findings may suggest that PMEO-DAPym may eventually be superior to TFV as an antiretroviral drug in respect of phenotypic drug resistance levels Molecular modeling A molecular model of PMEO-DAPym-DP bound at the DNA polymerase active site of HIV-1 RT was generated by docking this compound into the RT-T/P-TFV-DP structure (PDB coordinates 1T05) (85). The model (Figure 3.6A) shows that PMEO-DAPym-DP can reside in the DNA polymerase active site of RT without significant perturbation of its key residues (i.e. K65, R72, D110, Y115, D185, D186 and Q151). In fact, overlay of the RT-T/P-TFV-DP structure with our model suggests that the active site architecture is essentially unchanged including the YMDD motif that is essential for catalysis (Figure 3.6B). In addition, the model shows that the 79

96 Figure 3.6 A model of PMEO-DAPym-DP bound at the DNA polymerase active site of HIV-1 RT. PMEO-DAPym-DP was docked into the RT-T/P-TFV-DP ternary structure (PDB co-ordinates 1T05; A). No significant disruption of the active site residues was observed. An overlay of the RT-T/P-PMEO-DAPym-DP model with the RT-T/P-TFV-DP structure (B) demonstrates that PMEO-DAPym-DP mimics an incomplete purine ring and allows canonical Watson-Crick base pairing. 80

97 C-6 phosphonate linkage allows the pyrimidine ring in PMEO-DAPym to mimic an open incomplete purine ring that allows the canonical Watson-Crick base pairing to be maintained Inhibition of human DNA polymerase α-, β-, and γ-mediated DNA synthesis by PMEO-DAPym-DP We also examined the potential for PMEO-DAPym-DP to inhibit steady state DNA synthesis by the human DNA polymerases α, β, and γ (Figure 3.7 ). PMEO-DAPym-DP was recognized and incorporated as an A-analog by DNA Pol α, resulting in chain termination. DNA synthesis by Pol α was also inhibited by PMEA-DP but not by TFV-DP. Human Pol β DNA synthesis was inhibited by TFV-DP (IC 50 = 20.3 μm) and PMEA-DP (IC 50 = 28.8 μm) but was not inhibited by PMEO-DAPym-DP. PMEO-DAPym-DP, TFV-DP, PMEA-DP were not substrates for incorporation by DNA Pol γ. 81

98 Figure 3.7 Inhibition of human polymerase α (A), β (B), and γ (C) steady state DNA synthesis by PMEO-DAPym-DP. The DNA/DNA T/P used is indicated in each panel and the reaction conditions are provided in the Materials and Methods section. 82

99 3.6 DISCUSSION In the present study, we demonstrate that HIV-1 RT efficiently recognizes PMEO-DAPym-DP as a purine (i.e. adenine) nucleotide derivative but not as a pyrimidine nucleotide derivative. Our modeling and docking studies in HIV-1 RT confirm the similarities between PMEO-DAPym-DP and TFV-DP in terms of a mimetic of an incomplete purine ring (DAPym) and are in full agreement with the obtained kinetic data. This is a striking observation and the first demonstration that a pyrimidine nucleotide analog can be unambiguously recognized as an adenine nucleotide derivative for both binding and incorporation into the growing DNA chain by HIV-1 RT. Moreover, such a wrongly-incorporated nucleotide derivative shows a less efficient increase of excision from the terminated DNA chain by mutant RTs than TFV. Such drugs may make it more difficult for the virus to escape drug pressure and may eventually exert lower phenotypic drug resistance levels, as has been experimentally shown in cell culture when PMEO- DAPym is compared to TFV (262). PMEO-DAPym-DP was also recognized as adenosine by human pol α for incorporation across from thymine, suggesting that the molecular mimicry phenotype extends beyond HIV-1 RT. 83

100 4.0 CHAPTER TWO. MECHANISM OF DISCRIMINATION OF GS-9148-DP BY K70E/D123N/T165I RT Brian D. Herman 1, Kirsten White 2, Michael Miller 2, and Nicolas Sluis-Cremer 1 1 Department of Medicine, Division of Infectious Diseases, University of Pittsburgh, Pittsburgh, PA, 15261, USA; 2 Gilead Sciences, Inc., Foster City, CA, USA 84

101 4.1 PREFACE The work presented in this chapter is in partial fulfillment of dissertation Aim 1 and was conducted as part of a research contract with Gilead Sciences, Inc., Foster City, CA, USA. Brian Herman performed all experiments described in this chapter. 4.2 ABSTRACT GS-9148 is a novel adenosine analog phosphonate NtRTI that demonstrates potent antiviral activity and favorable toxicity and resistance profiles. In cell culture selection experiments, viruses with decreased susceptibility to GS-9148 harbored a novel set of resistance mutations. The RT mutation K70N was initially selected, which was later replaced with K70E followed by the addition of D123N and T165I. The K70E/D123N/T165I combination represents a novel set of resistance mutations that are not selected by other NRTI and are infrequently observed in treatment-naïve and treatment-experience patients. We have used pre-steady state assays to determine the single nucleotide kinetic binding and incorporation parameters of GS-9148-DP by WT RT and RT containing the mutations K70N, K70E, D123N/T165I, and K70E/D123N/T165I. The results indicated that K70E/D123N/T165I RT has a decreased catalytic efficiency (k pol /K d ) of GS-9148-DP incorporation compared to WT RT. This decreased catalytic efficiency was driven by substantially weaker GS-9148-DP binding to the active site of K70E/D123N/T165I RT relative to WT RT (2.3-fold difference in K d ) with no effect on incorporation rate. This is different from the mechanisms of decreased catalytic efficiency toward TFV-DP; i) we observed changes in both TFV-DP binding and incorporation for K70E/D123N/T165I RT compared to 85

102 WT, ii) the previously characterized K65R and K70E mutations display predominantly decreased TFV-DP incorporation rates with little effect on binding. Our data indicate that the novel set of resistance mutations selected by GS-9148 confer decreased susceptibility to the drug by an alternative mechanism. Furthermore, these data reaffirm the importance of nucleotide base as a resistance determinant. 4.3 INTRODUCTION GS-9148 [(5-(6-amino-purin-9-yl)-4-fluoro-2,5-dihydro-furan-2-yloxymethyl)phosphonic acid] is a novel adenosine analog phosphonate NtRTI with a 2,3 -dihydrofuran ring structure that also contains a 2 -fluoro group modification (Figure 4.1) (263). GS-9148 demonstrated potent activity against HIV-1 replication in multiple cell types and the active form GS diphosphate (GS-9148-DP) was a competitive inhibitor of RT with respect to datp (K i = 0.8 μm) resulting chain-termination of DNA synthesis. GS-9148-DP had poor activity against human DNA polymerases α, β, and γ with selectivity indices with respect to activity against RT human polymerase HIV-1 (calculated as IC 50 / IC RT 50 ) of 19, > 76, and > 130, respectively (263, 266). GS-9148 demonstrated a favorable resistance profile against multiple NRTI-resistant HIV-1 strains. The RT mutations K65R, L74V, and M184V individually or in combination did not reduce the antiretroviral activity of GS Additionally, viruses with multiple TAMs resulted in a smaller decrease in susceptibility to GS-9148 compared to most other NRTI. Furthermore, GS-9148 demonstrated encouraging biological properties, including a low potential for mitochondrial toxicity, minimal cytotoxicity in multiple cell types and synergistic antiviral activity in combination with other antiretrovirals (263, 264, 266, 290). 86

103 Figure 4.1 Structures of GS-9148, tenofovir (TFV), GS-9148-diphosphate (GS9148-DP), tenofovir-diphosphate (TFV-DP), and datp. 87

104 Cell culture selection experiments with GS-9148 resulted in the emergence of two different resistance pathways: Q151L or the combination of K70E/D123N/T165I (267, 268, 291). The Q151L mutation resulted in high-level resistance to GS-9148, but it was present infrequently due to a replication deficiency (291). In the alternative pathway, K70N was selected first which was later replaced with K70E and the additional mutations D123N and T165I (267, 268). By the end of the selection 100 % of the sequenced clones contained the K70E mutation with 80 % and 90 % also containing D123N and T165I, respectively. The K70N and K70E mutations are present in NRTI-experienced patients with frequencies of 0.2 % and 0.3%, respectively (267, 268). D123N and T165I are polymorphisms that occur in approximately 9% and 5% of NRTI-experienced patients. However, the combination of K70E/D123N/T165I that was selected by GS-9148 has not been observed in treatment-naïve or treatment experienced patients. This suggests that GS-9148 selects a unique pathway to viral resistance that is selected by other NRTI and is not found in patient-derived clinical isolates. The K70N and K70E mutations alone did not confer decreased HIV-1 susceptibility to GS-1948, however the combination K70E/D123N/T165I resulted in 3.3-fold resistance compared to WT HIV-1 (267). This combination also showed low-level cross-resistance (2-3- fold compared to WT) to TFV, ddi, ABC, and D4T. Interestingly, the K70E/D123N/T165I mutations conferred 6.7-fold resistance to FTC but hypersusceptibility to AZT (0.4- fold) compared to WT HIV-1 (267). Steady-state kinetic analyses demonstrated that K70E, K70N, and K70E/D123N/T165I decreased the catalytic efficiency (K i /K m ) of GS-9148-DP incorporation by RT 2.4-, 2.6-, and 4.0-fold, relative to WT, respectively (267). These results suggest that these mutations, like K65R, confer resistance via a discrimination mechanism by decreased binding/incorporation of GS-9148-DP compared to WT. Also like K65R, the K70E, K70N, and 88

105 K70E/D123N/T165I mutations decreased the excision of NRTI-MP from chain-terminated primers. As described previously, the K65R mutation confers a discrimination phenotype toward TFV-DP and other NRTI-TP, primarily due to a decreased k pol with minimal changes in nucleotide binding (122, 160, 212). While K70E/D123N/T165I displayed a similar discrimination phenotype as K65R in steady-state assays, the specific contributions of incorporation rate or nucleotide binding affinity for this novel mutant combination is not known. Furthermore, it is unknown what role the previously unidentified mutations D123N and T165I might play. Accordingly, this chapter will describe the pre-steady state assays used to determine the single nucleotide kinetic binding and incorporation parameters of GS-9148-DP compared to TFV-DP by RT containing the mutations K70N, K70E, D123N/T165I, and K70E/D123N/T165I. 4.4 MATERIALS AND METHODS Reagents The wild-type (WT), K70N, K70E, D123N/T165I, and K70E/D123N/T165I HIV-1 RTs were constructed, over-expressed in E. coli, and purified as described previously (284, 285). The protein concentration of these enzymes was determined spectrophotometrically at 280 nm using an extinction coefficient (ε280) of M 1 cm 1, and by Bradford protein assays (Sigma- Aldrich, St. Louis, MO). The RNA- and DNA-dependent DNA polymerase activities of the purified WT and mutant enzymes were essentially identical (data not shown). Tenofovir diphosphate (TFV-DP) and GS-9148 diphosphate (GS-9148-DP) were provided by Gilead 89

106 Sciences, Inc. (Foster City, CA). datp was purchased from GE Healthcare (Piscataway, NJ), and [γ-32p]atp was acquired from PerkinElmer Life Sciences (Boston, MA). DNA oligonucleotides were synthesized by IDT (Coralville, IA). The sequences of the DNA template and primer were 5 - CTCAGACCCTTTTAGTCAGAATGGAAATTCTCTAGCAGTGGCGCCCGAACAGGGACA -3 and 5 -TCGGGCG CCACTGCTAGAGA-3, respectively. The DNA primer was 5 - radiolabeled with [γ- 32 P]ATP and annealed to the template as described previously (141) Pre-steady-state assays A rapid quench instrument (Kintek RQF-3 instrument, Kintek Corporation, Clarence, PA) was used for pre-steady-state experiments with reaction times ranging from 50 ms to 60 s. Experiments were performed and data were analyzed in the same manner described in CHAPTER ONE under the section Pre-steady-state assays except using GS-9148-DP and TFV-DP substrates and WT, K70N, K70E, D123N/T165I, and K70E/D123N/T165I HIV-1 RT. 4.5 RESULTS Pre-steady-state kinetic analyses were carried out to elucidate, in detail, the interactions of GS DP with the polymerase active site of HIV-1 RT. The natural nucleotide datp and TFV- DP were included as controls. The results (Table 4.1) show that the catalytic efficiency of incorporation (k pol /K d ) of GS-9148-DP for WT HIV-1 RT is ~32-fold less than the k pol /K d value determined for datp (selectivity with respect to datp). The decrease in the k pol /K d value for 90

107 Table 4.1 Pre-steady state kinetic values for GS-9148-DP incorporation by WT and drug-resistant HIV-1 RT. datp Nucleotide analog K pol (s -1 ) K d (µm) K pol /K d (µm -1 s -1 ) K pol (s -1 ) K d (µm) K pol /K d (µm -1 s -1 ) selectivity b resistance c datp/tfv-dp WT 29.6 ± 3.1 a 3.01 ± ± ± K70E 25.7 ± ± ± ± K70N 39.0 ± ± ± ± D123N/T165I 16.5 ± ± ± ± K70E/D123N/T165I 20.3 ± ± ± ± datp/gs-9148-dp WT 29.6 ± ± ± ± K70E 25.7 ± ± ± ± K70N 39.0 ± ± ± ± D123N/T165I 16.5 ± ± ± ± K70E/D123N/T165I 20.3 ± ± ± ± a Values represent mean ± SEM of at least 3 independent experiments. b Selectivity is (K pol /K d ) dntp /(K pol /K d ) NRTI-TP c Resistance (n-fold) is selectivity mutant /selectivity WT 91

108 GS-9148-DP (relative to datp) is driven by both a slower rate of nucleotide analog incorporation (k pol ) and by a diminished binding affinity (K d ) for the DNA polymerase active site of RT. This is contrary to TFV-DP in that the decreased k pol /K d value (compared to datp) is driven primarily by slower incorporation. In fact, TFV-DP (K d = 1.4 µm) demonstrated 2.2-fold stronger binding to the WT HIV-1 active site than datp (K d = 3.0 µm). The K70N RT showed no deficit in catalytic efficiency of incorporation (k pol /K d ) of GS-9148-DP compared to WT RT. The catalytic efficiency of TFV-DP incorporation by K70N RT, however was decreased 2-fold compared to WT. The D123N/T165I RT showed only a 1.2-fold decrease in the k pol /K d value compared to WT RT. Importantly, the catalytic efficiencies of GS-9148-DP incorporation by K70E RT (k pol /K d = 0.196) and K70E/D123N/T165I RT (k pol /K d = 0.131) were 1.6-fold and 2.4- fold lower, respectively, compared to WT RT (k pol /K d = 0.312). The decreased catalytic efficiency of GS-9148-DP incorporation by K70E RT (compared to WT RT) is due to small changes in both incorporation rate and binding affinity. However, the decreased catalytic efficiency of GS-9148-DP incorporation by K70E/D123N/T165I RT relative to WT RT is driven strongly by decreased nucleotide binding affinity (K d values of 12.5 μm and 29.3 μm for WT RT and K70E/D123N/T165I RT, respectively). Also of note, the K70E/D123N/T165I RT incorporated datp 1.5-fold less efficiently than WT RT, primarily due to a slower rate of incorporation. This decrease in datp incorporation rate was more pronounced with RT containing D123N/T165I alone, which also showed a slightly weaker datp binding affinity relative to WT RT. 92

109 4.6 DISCUSSION Overall, the pre-steady state kinetic assays we performed in this study indicate low levels of resistance to GS-9148 by progressively increasing discrimination phenotypes towards GS DP by K70N, K70E, and K70E/D123N/T165I RT, respectively. These results are consistent with the previously determined steady state kinetic data (267). Moreover, our results indicate that GS DP discrimination by K70E/D123N/T165I RT is driven by a 2.4-fold decrease in nucleotide binding affinity (K d ), compared to WT RT, with little effect on incorporation rate (Table 4.1). This is contrary to the previously described mechanisms of discrimination toward TFV-DP by RT containing the K65R or K70E mutations, which is due primarily to decreased incorporation rate with little effect on nucleotide binding to the active site (122, 161, 213). We found that K70E/D123N/T165I RT also showed a decreased rate of TFV-DP incorporation but this was accompanied by a decrease in TFV-DP binding affinity for the active site. Together, these factors resulted in a K70E/D123N/T165I RT discrimination phenotype toward TFV-DP that was not observed in the prior steady state kinetic assays (267). Taken together, these data show that the novel combination of mutations selected by GS-9148, K70E/D123N/T165I, confer resistance to GS-9148 and TFV by different mechanisms. Moreover, the fact that GS-9148 and TFV both contain an adenine base but differ only in their ribose sugar (TFV contains an acyclic pseudo-sugar ) structure, reaffirms that nucleotide sugar an important determinant for NtRTI resistance development. 93

110 5.0 CHAPTER THREE. SUBSTRATE MIMICRY: HIV-1 REVERSE TRANSCRIPTASE RECOGNIZES 6-MODIFIED-3 -AZIDO-2,3 - DIDEOXYGUANOSINE-5 -TRIPHOSPHATES AS ADENOSINE ANALOGS Brian D. Herman 1, Raymond F. Schinazi 2, Hong-wang Zhang 2, James H. Nettles 2, Richard Stanton 2, Mervi Detorio 2, Aleksandr Obikhod 2, Ugo Pradère 2, Steven J. Coats 3, John W. Mellors 1 and Nicolas Sluis-Cremer 1 1 Department of Medicine, Division of Infectious Diseases, University of Pittsburgh, Pittsburgh, PA 15261; 2 Center for AIDS Research, Department of Pediatrics, Emory University School of Medicine, and Veterans Affairs Medical Center, Decatur, Georgia 30033; 3 RFS Pharma, LLC, Tucker, Georgia

111 5.1 PREFACE This chapter is adapted in part from a manuscript originally published in Nucleic Acids Research; Herman, B. D., Schinazi, R. F., Zhang. H-W., Nettles, J. H., Stanton, R., Detorio, M., Obikhod, A., Pradère, U., Coats, S. J., Mellors, J.W. and N. Sluis-Cremer. (2012). Substrate mimicry: HIV-1 reverse transcriptase recognizes 6-modified-3'-azido-2',3'-dideoxyguanosine-5'- triphosphates as adenosine analogs. Nucleic Acids Res. 40(1): pp The Author(s) Published by Oxford University Press. Additionally this work was presented in part as a poster at The XVIII International HIV Drug Resistance Workshop June 9-13, 2009 Fort Myers, Fl, USA. Abstract # 144. Herman, B. D., Obikhod, A., Detorio, M., Zhang, H-W., Nettles, J., Coats, S.J., Schinazi, R. F., Mellors, J. W. and N. Sluis-Cremer. Structure-activity-resistance relationships of 6-modified 3 -azido-2,3 - dideoxyguanosine nucleotides as inhibitors of HIV-1 reverse transcriptase. Antiviral Therapy 2009; 14 Suppl 1:A144; and in part at The 17 th Conference on Retroviruses and Opportunistic Infections February 16-19, 2010, San Francisco, CA USA. Abstract # 489. Herman, B. D., Obikhod, A., Asif, G., Zhang, H-W., Coats, S. J., Schinazi, R. F., Mellors, J. W. and N. Sluis- Cremer. RS-788, a Prodrug of β-d-3 -Azido-2,6-diamino-2,3 -dideoxypurine, Exhibits Potent Activity Against NRTI-Resistant HIV-1. The work presented in this chapter is in partial fulfillment of dissertation Aim 2. Brian Herman performed all work with the exception of synthesis of the triphosphate (TP) forms of the 6-modified-3 -azido-ddg analogs and the molecular modeling studies. Synthesis of the 6- modified-3 -azido-ddg analogs and their triphosphate forms was performed by Steven J. Coats, Hong-Wang Zhang, Aleksandr Obikhod, and Ugo Pradère. The molecular modeling studies were performed by James H. Nettles and Richard Stanton. 95

112 5.2 ABSTRACT β-d-3 -Azido-2,3 -dideoxyguanosine (3 -azido-ddg) is a potent inhibitor of HIV-1 replication with a superior resistance profile to zidovudine. Recently, we identified five novel 6-modified- 3 -azido-ddg analogs that exhibit similar or superior anti-hiv-1 activity compared to 3 -azidoddg in primary cells. To gain insight into their structure-activity-resistance relationships, we synthesized their triphosphate (TP) forms and assessed their ability to inhibit HIV-1 RT. Steadystate and pre-steady-state kinetic experiments show that the 6-modified-3 -azido-ddgtp analogs act as adenosine rather than guanosine mimetics in DNA synthesis reactions, and are incorporated by HIV-1 RT opposite thymine (in DNA) or uracil (in RNA). The order of potency of the TP analogs was: 3 -azido-2,6-diaminopurine > 3 -azido-6-chloropurine; 3 -azido-6-nallylaminopurine > 2-amino-6-N,N-dimethylaminopurine; 2-amino-6-methoxypurine. Molecular modeling studies reveal unique hydrogen bonding interactions between the nucleotide analogs and the template thymine base in the active site of RT. Surprisingly, the structure-activity relationship of the analogs differed in HIV-1 RT ATP-mediated excision assays of their monophosphate forms, suggesting that it may be possible to rationally design a modified base analog that is efficiently incorporated by RT but serves as a poor substrate for ATP-mediated excision reactions. Overall, these studies identify a promising strategy to design novel nucleoside analogs that exert profound antiviral activity against both WT and drug-resistant HIV-1. 96

113 5.3 INTRODUCTION Most combination therapies used to treat antiretroviral-naïve and -experienced HIV-1 infected individuals include at least two NRTIs. NRTIs are analogs of 2 -deoxyribonucleosides that lack a 3 -OH group on the ribose sugar/pseudosugar. Once metabolized by host cell kinases to their active -TP forms, they inhibit viral reverse transcription by acting as chain-terminators of HIV-1 RT DNA synthesis (292). Although combination therapies that contain two or more NRTIs have substantially reduced mortality from HIV-1 associated disease, the approved NRTIs have significant limitations that include acute and chronic toxicity, and the selection of drug-resistant variants of HIV-1 that exhibit cross-resistance to other NRTIs. Accordingly, there is a need to develop potent and safe NRTIs that demonstrate activity against a broad-range of drug-resistant HIV-1. To date, most NRTIs were discovered by an empirical approach in which novel sugarmodified nucleoside analogs were synthesized without a priori knowledge of their activity against WT or drug-resistant HIV-1. To specifically identify NRTIs that retain activity against a broad spectrum of drug-resistant HIV-1, our group adopted a rational discovery approach that utilized structure-activity-resistance relationships to identify NRTI base and sugar moieties that retain potent activity against drug-resistant HIV-1 (141, 212). Importantly, this approach identified 3 -azido-2,3 -dideoxyguanosine (3 -azido-ddg) as a lead compound that exhibits potent activity against HIV-1 variants that contain the discrimination mutations K65R, L74V or M184V and against HIV-1 that contains multiple TAMs that enhance nucleotide excision (172). Furthermore, 3'-azido-ddG does not exhibit cytotoxicity in primary lymphocytes or epithelial and T-cell lines, and does not decrease the mitochondrial DNA content of HepG2 cells (172). 97

114 To further improve the antiviral activity of 3 -azido-ddg, we recently synthesized and characterized a series of novel base modified 3 -azido-2,3 -dideoxypurine analogs (143). Of the 26 analogs studied, five (namely, 3 -azido-2,3 -dideoxy-2,6-diaminopurine (3 -azido-2,6-da- P), 3 -azido-2,3 -dideoxy-2-amino-6-chloropurine (3 -azido-6-cl-p), 3 -azido-2,3 -dideoxy -2- amino-6- N,N-dimethylaminopurine (3 -azido-6-dm-p), 3 -azido-2,3 -dideoxy-2-amino-6- methoxypurine (3 -azido-6-mx-p) and 3 -azido-2,3 -dideoxy-2-amino-6-n-allylaminopurine (3 -azido-6-aa-p)) exhibited superior or equivalent activity to 3 -azido-ddg in primary lymphocytes (Figure 5.1). To gain additional insight into the structure-activity-resistance relationships of these compounds, we synthesized their TP forms and assessed their ability to inhibit DNA synthesis by recombinant purified HIV-1 RT. Importantly, we show for the first time that HIV-1 RT recognizes and incorporates these 6-modified-3 -azido-ddgtp nucleotides as adenosine analogs. These findings reveal new avenues for developing novel, ambiguous nucleoside analogs that could be used to treat HIV-1 infection. 5.4 MATERIALS AND METHODS Reagents WT, K65R, L74V, M184V, A62V/V75I/F77L/F116Y/Q151M (Q151M complex, Q151M c ), M41L/L210W/T215Y (TAM41) and D67N/K70R/T215F/K219Q (TAM67) HIV-1 RTs were purified as described previously (284, 285). The protein concentration of the purified enzymes was determined spectrophotometrically at 280 nm using an extinction coefficient (ε 280 ) of M 1 cm 1, and by Bradford protein assays (Sigma-Aldrich, St. Louis, MO). The RNA- 98

115 Figure 5.1 Structures of 6-modified-3 -azido-dideoxyguanosine analogs. The molecular structures of zidovudine (ZDV), 3 -azido-2,3 -dideoxyadenosine (3 -azido-dda), 3 -azido-2,3 -dideoxyguanosine (3 -azido-ddg), 3 -azido-2,3 -dideoxy-2,6-diaminopurine (3 - azido-2,6-da-p), 3 -azido-2,3 -dideoxy-2-amino-6-chloropurine (3 -azido-6-cl-p), 3 -azido- 2,3 -dideoxy-2-amino-6-n,n-dimethylaminopurine (3 -azido-6-dm-p), 3 -azido-2,3 -dideoxy- 2-amino-6-methoxypurine (3 -azido-6-mx-p) and 3 -azido-2,3 -dideoxy-2-amino-6-nallylaminopurine (3 -azido-6-aa-p) are shown. The EC 50 values, determined for WT HIV-1 in peripheral blood mononuclear (PBM) cells, were adapted from reference (143). 99

116 and DNA-dependent DNA polymerase activities of the purified WT and mutant enzymes were similar (data not shown). The triphosphate (TP) forms of each of the 6-modified-3 -azido-ddg analogs were synthesized and purified using the methods of Ludwig and Eckstein (250). 3 - Azido-ddGTP, 3 -azido-ddatp, 3 -azido-ddctp and zidovudine-tp (ZDV-TP) were purchased from TriLink Biotechnologies, Inc. (San Diego, CA). [γ- 32 P]ATP was obtained from PerkinElmer Life Sciences (Boston, MA). All DNA oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA) Inhibition of HIV-1 RT DNA synthesis under steady-state conditions by the 6- modified-3 -azido-ddgtp analogs The ability of the 6-modified-3 -azido-ddgtp analogs to inhibit HIV-1 RT DNA- or RNAdependent DNA synthesis was determined using two different template/primer (T/P) substrates, as described below: (i) RT DNA synthesis was evaluated using a 214 nucleotide RNA or DNA template that corresponds to the HIV-1 sequence used for ( ) strong stop DNA synthesis. The RNA and DNA templates were prepared as described previously (141). Both the RNA- and DNA-dependent DNA synthesis reactions were primed with the same 5 -end- 32 P-labeled 18 nucleotide DNA primer (5 - GTCCCTGTTCGGGCGCCA-3 ) that corresponds to the HIV-1 primer binding site. DNA synthesis reactions (20 µl) were carried out in a 50 mm Tris-HCl (ph 7.5) buffer that contained 50 mm KCl, 10 mm MgCl 2, 20 nm T/P, 0.5 µm of each dntp and varying concentrations of the 6-modified-3 -azido-ddgtp analogs. Reactions were initiated by the addition of 200 nm WT HIV-1 RT, incubated at 37 C for 30 min (DNA-dependent DNA synthesis) or 60 min (RNA-dependent DNA synthesis) and then quenched by addition of 20 µl 100

117 of gel loading buffer (98 % deionized formamide containing 1 mg/ml each of bromophenol blue and xylene cyanol). Samples were then denatured at 95 C for 10 min and polymerization products were separated from substrates by denaturing gel electrophoresis using 14 % acrylamide gels containing 7 M urea. DNA synthesis was analyzed by phosphorimaging using a GS-525 Molecular Imager and Quantity One Software (Bio-Rad Laboratories, Inc., Hercules, CA). (ii) Inhibition of HIV-1 RT DNA synthesis was also evaluated to determine IC 50 values using a 5 -end- 32 P-labeled 19 nucleotide DNA primer (5 -TTGTAGCACCATCCAAAGG-3 ) that was annealed to one of three 36 nucleotide DNA templates that contained five consecutive thymine, cytosine, or adenosine bases. In this regard, inhibition of HIV-1 RT DNA synthesis by analogs with adenine, guanine, or thymine bases were evaluated using the templates (T1, 5 -CAGACTTTTTCAGACCTTTGGATGGTGCTACAAGCT-3 ), (T2, 5 -CAGAGCCCCCGAGACCTTTGGATGGTGCTACAAGCT-3 ), or (T3, 5 -CTGCTAAAAACTGCCCTTTGGATGGTGCTACAAGCT-3 ), respectively. The T1 template was used for inhibition of WT and mutant HIV-1 RT DNA synthesis by each of the 6- modified-3 -azido-ddgtp analogs. Reaction conditions and gel electrophoresis were identical to those described above except 100 nm of WT or mutant HIV-1 RT was used to initiate the reaction. Reactions were quenched following incubation at 37 C for 10 min. The amount of final product on the denaturing PAGE gels was quantified by densiometric analysis using Quantity One Software. The concentration of each 6-modified-3 -azido-ddgtp analog required to inhibit the formation of final product by 50 % was calculated using non-linear regression analyses (SigmaPlot Software Version 11, Systat Software, Inc., San Jose, CA) from at least 101

118 three independent experiments. Two-tailed homoscedastic T-tests were used to calculate the reported p-values Pre-steady-state incorporation of 6-modified-3 -azido-ddgtp analogs A rapid quench instrument (Kintek RQF-3 instrument, Kintek Corporation, Clarence, PA) was used for pre-steady-state experiments. Experiments were performed and data were analyzed in the same manner described in CHAPTER ONE under the section Pre-steady-state assays. A 5 -radiolabeled primer (5 -TCGGGCGCCACTGCTAGAGA-3 ) was annealed to one of two different templates. The sequence of the template used to evaluate the 6-modified-3 -azidoddgtp nucleotides as A analogs was 3 - ACAGGGACAAGCCCGCGGTGACGATCTCTTAAAGGTAAGACTGATTTTCCCAGACTC -5. The sequence of the template used to evaluate the 6-modified-3 -azido-ddgtp nucleotides as G analogs was 3 - ACAGGGACAAGCCCGCGGTGACGATCTCTCAAAGGTAAGACTGATTTTCCCAGACT C

119 5.4.4 Excision of the 6-modified-3 -azido-ddg monophosphate (MP) analogs by WT or TAM-containing HIV-1 RTs The ability of WT or TAM-containing HIV-1 RT to facilitate ATP-mediated excision of the 6- modified-3 -azido-ddg-mp analogs from a DNA/DNA chain-terminated T/P was assessed as described previously (141). Briefly, a 23-nucleotide DNA primer was 5 -radiolabeled with [γ- 32 P]ATP, annealed to the appropriate 36-nucleotide DNA template, and then chain-terminated with the appropriate nucleotide analog. For excision of 3 -azido-ddgmp the T/P pair was T2/pr23G (pr23g: 5 -TTGTAGCACCATCCAAAGGTCTC-3 ) whereas for the excision of 3 - azido-ddamp and each 6-modified-3 -azido-ddgmp analog the T/P pair was T1/pr23A (pr23a: 5 -TTGTAGCACCATCCAAAGGTCTG-3 ). Reactions were carried out in a 50 mm Tris-HCl (ph 7.5) buffer that contained 50 mm KCl, 10 mm MgCl 2, 3 mm ATP and 1 μm dgtp/10 μm ddctp (for the excision of 3 -azido-ddgmp) or1 μm datp/10 μm ddgtp (for excision of 3 - azido-ddamp and each 6-modified-3 -azido-ddgmp analog). Reactions were initiated by the addition of 200 nm WT or mutant RT. Aliquots (5 µl) were removed at defined times, quenched with gel loading buffer, denatured at 95 C for 10 min, and product was then resolved from substrate by denaturing polyacrylamide gel electrophoresis and analyzed, as described above Molecular modeling Molecular models of incorporation were constructed using the X-ray crystallographic coordinates (PDB entry 1 RTD) for the RT-T/P-TTP ternary complex (77). The 3 -OH of the primer strand as well as the 6-modified-3 -azido-2,3 -ddgtp analogs and complementary bases in the template strand were built into the model to generate a pre-initiation complex, as described 103

120 previously (84). Tautomerization and protonation potential of the entire system was calculated using the Generalized Born/Volume Integral (GB/VI) electrostatics method of Labute (293). Energy gradient minimization was carried out using MMFF94x force field in the Molecular Operating Environment (MOE ; Chemical Computing Group, Montreal, Quebec, Canada). Ligand interactions were quantified and images generated using the LigX interaction function in MOE. Structural models comparing incorporation and excision of specific nucleotide analogs used the PDB co-ordinates 3KLF and 3KLE that contain the excision product AZT adenosine dinucleoside tetraphosphate (AZTppppA) in complex with HIV-1 RT containing multiple TAMs (82). To eliminate the potential force field bias from alignment of bases, empirically derived angle relations were used for all analogs tested. 3KLF and 3KLE were fit to the p66 subunit of 1RTD using the Matchmaker function in Chimera version 1.51 (UCSF Chimera, Resource for Biocomputing, Visualization, and Informatics at the University of California, San Francisco). Aligned structures were opened in MOE and dihedral angles were measured from bases relative to the ribose ring O and C1 of both template and bound nucleotides for each complex. MOE s builder function was used to modify each template/bound nucleotide base pair retaining the experimental dihedrals. Hydrogen bonding potential between the aligned base pairs was quantified using the FindHBond function in Chimera with default settings. Parts of the modeling workflow were automated using Pipeline Pilot 7.5 (Accelrys Corporation, San Diego, California). 104

121 5.5 RESULTS Steady-state incorporation of 6-modified 3 -azido-ddgtp nucleotides by HIV-1 RT To characterize the ability of WT HIV-1 RT to incorporate the 6-modified-3 -azido-ddgtp analogs, we first conducted steady-state DNA synthesis reactions using heteropolymeric DNA/DNA and RNA/DNA T/P substrates (Figure 5.2). The sequences of the RNA and DNA templates correspond to the HIV-1 sequence used for ( ) strong stop DNA synthesis, and both reactions were primed with the same 18 nucleotide DNA primer that was complementary to the HIV-1 primer binding site (141). 3 -Azido-ddGTP, 3 -azido-ddatp, 3 -azido-ddctp and ZDV- TP were included as controls in these experiments. Unexpectedly, we found that HIV-1 RT recognized all of the 6-modified-3 -azido-ddgtp nucleotides as adenosine analogs and incorporated them opposite thymine in DNA (Figure 5.2A) or uracil in RNA (Figure 5.2B). As anticipated, their incorporation resulted in chain-termination of DNA synthesis. Under the assay conditions described in Figure 5.2, the 6-modified-3 -azido-ddgtp nucleotides were not incorporated into the nascent DNA opposite cytosine. However, if the dntp concentration was lowered to 0.1 μm, chain-termination opposite cytosine was observed (data not shown). We also determined the concentration of 6-modified-3 -azido-ddgtp analog required to inhibit DNA synthesis (i.e. IC 50 ) using a different heteropolymeric DNA/DNA T/P substrate, as described in the Materials and Methods (Table 5.1). Their order of potency against WT RT was determined to be: 3 -azido-ddatp, 3 -azido-ddgtp > 3 -azido-2,6-da-p-tp > 3 -azido-6-cl-p-tp, 3 - azido-6-aa-p-tp > 3 -azido-6-dm-p-tp, 3 -azido-6-mx-p-tp. 105

122 A No RT ZDV-TP 3 -azidoddctp 3 -azidoddgtp 3 -azidoddatp 3 -azido-2,6- DA-P-TP 3 -azido-6- Cl-P-TP 3 -azido-6- AA-P-TP 3 -azido-6- MX-P-TP 3 -azido-6- DM-P-TP Final Product [NRTI-TP] (μm) Primer B ZDV-TP No RT 3 -azidoddctp 3 -azidoddgtp 3 -azidoddatp 3 -azido-2,6- DA-P-TP 3 -azido-6- Cl-P-TP 3 -azido-6- AA-P-TP 3 -azido-6- MX-P-TP 3 -azido-6- DM-P-TP Final Product [NRTI-TP] (μm) Primer Figure 5.2 The 6-Modified-3 -azido-ddgtp analogs are recognized and incorporated by WT HIV-1 as adenosine analogs. (A) Representative denaturing polyacrylamide gel showing chain-termination of HIV-1 RT DNA synthesis by each of the 3 -azido-ddgtps on a heteropolymeric DNA/DNA T/P under steadystate assay conditions. (B) Representative denaturing polyacrylamide gel showing chain termination of WT HIV-1 RT DNA synthesis by each of the 3 -azido-ddgtps on a heteropolymeric RNA/DNA T/P under steady-state assay conditions. Reaction conditions are described in the Materials and Methods section. 106

123 Table 5.1 Inhibition of steady-state WT and mutant HIV-1 RT DNA synthesis by 6-modified-3 -azido-ddgtp analogs. Nucleotide analog HIV-1 RT WT K65R L74V M184V Q151M a ZDV-TP IC 50 (µm) b 0.13 ± ± ± ± ± 1.0 Fold-R c 3 -azido-ddgtp IC 50 (µm) Fold-R 3 -azido-ddatp IC 50 (µm) Fold-R 3 -azido-2,6-da-p-tp IC 50 (µm) Fold-R p-value d 3 -azido-6-cl-p-tp IC 50 (µm) Fold-R p-value 3 -azido-6-aa-p -TP IC 50 (µm) Fold-R p-value 3 -azido-6-dm-p-tp IC 50 (µm) Fold-R p-value 3 -azido-6-mx-p-tp IC 50 (µm) Fold-R p-value ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 13.0 >50 >50 n.d. e >50 - >2.0 >2.0 > ± ± 6.1 > ± ± > a The Q151M RT contains the A62V, V75I, F77L, F116Y and Q151M mutations. b IC 50 values are the concentration of drug required to inhibit 50% of DNA synthesis under steady-state assay conditions. Data are shown as the means ± standard deviations of at least three independent experiments. c Fold-resistance (Fold-R) values are calculated by IC 50 mutant RT /IC 50 WT RT. d P-value compares the Fold-R values determined for the 6-modified 3 -azido-ddgtp analogs to the Fold-R value determined for 3 -azido-ddatp. e n.d. Not determined 107

124 5.5.2 Pre-steady-state incorporation of 6-modified 3 -azido-ddgtp nucleotide analogs by HIV-1 RT Pre-steady-state kinetic analyses were carried out to elucidate, in detail, the interactions between the 6-modified-3 -azido-ddgtp analogs and the polymerase active site of WT HIV-1 RT (Table 5.2). Because the 6-modified-3 -azido-ddgtp analogs behave as adenine nucleotide analogs, we included 3 -azido-ddatp as a control. The results (Table 5.2) show that the catalytic efficiency of incorporation (k pol /K d ) of 3 -azido-2,6-da-p-tp was similar to that of datp and 3 -azidoddatp. Consistent with the steady-state kinetic experiments, 3 -azido-6-cl-p-tp, 3 -azido-6- AA-P-TP, and 3 -azido-6-mx-p-tp were all less efficiently incorporated by WT HIV-1 compared to datp. The observed decreases in catalytic efficiency for each of these substrates was driven by both a decrease in the rate of nucleotide incorporation (i.e. k pol ) and a decrease in the affinity of the nucleotide for the polymerase active site (i.e. K d ). Due to limited quantities of the 3 -azido-6-dm-p-tp, we were unable to obtain pre-steady-state kinetic data for this analog. We also assessed the ability of the 6-modified-3 -azido-ddgtp analogs to be incorporated opposite cytosine (Table 5.2). The data show that, in comparison to dgtp, the 6-modified-3 - azido-ddgtp analogs were inefficiently incorporated by HIV-1 RT. The only compound with reasonable activity as a G-analog was 3 -azido-6-cl-p-tp; however its selectivity value versus dgtp (SI = 254) was ~ 7-fold less than its selectivity value versus datp (SI = 35). 108

125 Table 5.2 Pre-steady-state kinetic values for incorporation of 6-modified-3 -azido-ddgtp analogs by WT HIV-1 RT. Incorporation as an A analog Nucleotide Analog k pol (sec -1 ) K d (µm) k pol / K d (µm -1 sec -1 ) Selectivity a vs datp datp 17.0 ± 2.1 b 0.33 ± '-azido-ddATP 14.0 ± ± '-azido-2,6-DA-P-TP 14.0 ± ± '-azido-6-Cl-P-TP 2.7 ± ± '-azido-6-AA-P-TP 2.1 ± ± '-azido-6-MX-P-TP 2.8 ± ± Incorporation as a G analog Nucleotide Analog k pol (sec -1 ) K d (µm) k pol / K d (µm -1 sec -1 ) Selectivity vs dgtp dgtp 17.3 ± ± '-azido-2,6-DA-P-TP 0.16 ± ± '-azido-6-Cl-P-TP 0.37 ± ± '-azido-6-AA-P-TP n.m. c > 50 n.m. n.m. 3'-azido-6-MX-P-TP 0.22 ± ± a Selectivity is (kpol/kd) dntp /(kpol/kd) 3 -azido-ddntp. b Values represent the means ± standard deviations of three to four independent experiments. c n.m. Not measurable. The rate of incorporation was so inefficient that accurate kinetic parameters could not be determined. 109

126 5.5.3 Activity of the 6-modified-3 -azido-ddgtp analogs against HIV-1 RT containing NRTI discrimination mutations The amino acid substitutions K65R, L74V, Q151M (in complex with A62V, V75I, F77L and F116Y) or M184V in HIV-1 RT improve the enzyme s ability to discriminate between the natural dntp substrate and an NRTI-TP. These substitutions are typically referred to as NRTI discrimination mutations. To determine whether NRTI discrimination mutations impacted the ability of RT to recognize and incorporate the 6-modified-ddGTP analogs, we determined the concentration of nucleotide analog required to inhibit 50% of the DNA polymerase activity (i.e. IC 50 ) under steady-state assay conditions using the heteropolymeric DNA/DNA T/P substrates as described in the Materials and Methods (Table 5.1). 3 -Azido-ddATP, 3 -azido-ddgtp and ZDV-TP were again included as controls. The 6-modified-3 -azido-ddgtp analogs were also incorporated as adenosine analogs by the mutant HIV-1 RTs (data not shown). In general, the mutant HIV-1 RTs exhibited fold-resistance values to each of the 6-modified-3 -azido-ddgtp analogs that were similar (i.e. less than 2-fold) to the fold-change in resistance values determined for 3 -azido-ddatp. The only statistically significant exceptions (p < 0.05) included 3 -azido-6- AA-P-TP and 3 -azido-2,6-da-p-tp which exhibited better activity against K65R HIV-1 RT and M184V HIV-1 RT, respectively. Of interest, all of the 3 -azido-dideoxypurines exhibited greater activity than ZDV-TP against multi-nrti resistant HIV-1 RT containing A62V/V75I/F77L/Y116F/Q151M. 110

127 Figure 5.3 ATP-mediated excision of 6-modified-3 -azido-ddgmp analogs by WT (A), TAM67 (B), or TAM41 (C) HIV-1 RT. Data are the means ± standard deviations from at least three independent experiments. Reaction conditions are described in the Materials and Methods section. 111

128 5.5.4 Excision of 6-modified-3 -azido-ddg-5 -MP analogs by WT and TAM containing HIV-1 RT HIV-1 RT has the intrinsic ability to rescue DNA synthesis from an NRTI-MP blocked primer, using ATP as a phosphate donor (130). This ATP-mediated excision activity of HIV-1 RT is selectively increased by TAMs (131). Accordingly, we investigated the ability of WT and TAMcontaining RT to excise the 6-modified-3 -azido-ddgmp analogs from a DNA chain-terminated T/P (Figure 5.3). Two RT enzymes that contained different patterns of TAMs (i.e. D67N/K70R/T215F/K219Q (TAM67) and M41L/L210W/T215Y (TAM41)) were studied. Our results showed that the WT, TAM67, and TAM41 RTs could unblock T/Ps chain-terminated with 3 -azido-ddamp, 3 -azido-2,6-da-p-mp and 3 -azido-6-aa-p-mp, although TAM41 RT and TAM67 RT were more efficient in this regard than was the WT enzyme. By contrast, both the WT and TAM-containing RTs could not efficiently unblock T/P substrates chain-terminated with 3 -azido-ddgmp, 3 -azido-6-mx-p-mp, 3 -azido-6-cl-p-mp or 3 -azido-6-dm-p-mp. 112

129 5.5.5 Molecular models of 3 -azido-2,6-da-p-tp and 3 -azido-6-cl-p-tp in the active site of HIV-1 RT We used molecular modeling to gain structural insight into the binding interaction between the 6- modified-3 -azido-ddgtp analogs and the thymine base in the DNA template in the active site of HIV-1 RT. Specifically, we modeled 3 -azido-2,6-da-p-tp and 3 -azido-6-cl-p-tp into the active site of HIV-1 RT using the co-ordinates (1RTD) from the RT-T/P-TTP complex (77). Both 3 -azido-2,6-da-p-tp and 3 -azido-6-cl-p-tp, were found to fit comfortably into the active site of HIV-1 RT and formed hydrogen bond interactions with the thymine base in the DNA template (Figure 5.4). However, the base hydrogen bonding characteristics differed for each analog. The base of 3 -azido-6-cl-p-tp forms two hydrogen bond interactions through the nitrogen (NH) at position 1 and the amine (NH 2 ) at position 2 with the template thymine (Figure 5.4B). In addition to these two hydrogen bonding interactions, 3 -azido-2,6-da-p-tp can form an additional hydrogen bond via the amino group (NH 2 ) at the 6-position of the purine base (Figure 5.4D). Therefore, the 2,6-diaminopurine:thymine base pairing interaction mimics the canonical Watson-Crick guanine:cytidine interaction Molecular models for ATP-mediated excision of the 6-modified-3 -azido-ddg-5 -MP analogs To gain structural insight into why the 6-modified-3 -azido-ddg analogs are differentially excised by HIV-1 RT containing TAMs, we modeled their excision products (6-modified-3 - azido-ddg adenosine dinucleoside tetraphosphate) in the enzyme s active site. These models reveal a hydrogen bonding network that is different from those observed for the TP forms. 113

130 Figure 5.4 Molecular models of 3 -azido-ddgtp (A), 3 -azido-6-cl-p-tp (B), 3 -azidoddatp (C), and 3 -azido-2,6-da-p-tp (D) in the DNA polymerase active site of WT HIV-1 RT. Each of the analogs was modeled into the ternary RT-T/P-TTP complex (pdb co-ordinates 1RTD). A schematic representation of the hydrogen-bonding patterns between the incoming nucleotide analog and the template base is depicted below each model. 114

131 Figure 5.5 Molecular models of the excision products of 3 -azido-dda (A), 3 -azido-2,6-da- P (B), 3 -azido-6-aa-p (C), and 3 -azido-6-cl-p (D) in the DNA polymerase active site of HIV-1 RT containing TAMs. Each of the analogs was modeled into the ternary RT-T/P-AZTppppA complex (pdb co-ordinates 3KLE). A schematic representation of the hydrogen-bonding patterns between the excised nucleotide analog and the template base is depicted below each model. 115

132 3 -azido-dda forms hydrogen bonds from the 1 and 6 atoms to the 3 and 4 atoms of the complementary thymine template in both the incorporation (Figure 5.4C) and excision (Figure 5.5A) models. By contrast, the hydrogen bond observed between the 2-amino substitution and the 2-carbonyl of the thymine template observed for the nucleotide triphosphate analogs (Figure 5.4B, 5.4D) is lost in all related excision complexes (Figure 5.5B, 5.5C, 5.5D). 3 -azido-2,6- DA-P (Figure 5.5B) and 3 -azido-6-aa-p (Figure 5.5C) retain an H-bond from the 6 atom position of the purine ring and the 4 atom position on the template thymine, whereas this interaction is not maintained for 3 -azido-6-cl-p (Figure 5.5D), 3 -azido-6-dm-p and 3 -azido- 6-MX-P (data not shown). Taken together, these different hydrogen bonding patterns may explain why 3 -azido-2,6-da-p and 3 -azido-6-aa-p are more efficiently excised by HIV-1 RT than are 3 -azido-6-cl-p, 3 -azido-6-dm-p and 3 -azido-6-mx-p. 5.6 DISCUSSION In this study, we demonstrated that 6-modified-3 -azido-ddgtp nucleotides act as adenosine mimetics for DNA synthesis carried out by HIV-1 RT. Of the five analogs studied, 3 -azido-2,6- DA-P-TP, which has a 2,6-diaminopurine base, was found to be the most efficient substrate for incorporation by HIV-1 RT. In pre-steady-state kinetic experiments, 3 -azido-2,6-da-p-tp was recognized and incorporated by WT HIV-1 RT as efficiently as datp and 3 -azido-ddatp. The analogs that contain the 2-amino-6-N,N-dimethylaminopurine (3 -azido-6-dm-p-tp) or 2- amino-6-methoxypurine (3 -azido-6-mx-p-tp) bases, however, were poor substrates for incorporation by HIV-1 RT. Our molecular modeling studies suggest that 6-modifications with a branched side-chain (e.g. 3 -azido-6-dm-p-tp) or one with electronic incompatibility (e.g

133 azido-6-mx-p-tp) may alter the alignment of the bases and move their α phosphate away from the primer 3 -OH thus impairing nucleotide incorporation. In contrast, 3 -azido-2,6-da-p-tp, 3 -azido-6-cl-p-tp, and 3 -azido-6-aa-p-tp form relatively planar base pairing interactions with the template thymine that enhance their α-phosphate interaction with the 3 -OH of the primer. Compared to the canonical A:T base pair, the additional hydrogen bond achieved by the 3 -azido-2,6-da-p:thymine base pair may further stabilize the α-phosphate, facilitating the favorable catalytic efficiency observed in pre-steady-state assays. In contrast, the 6-modified-3 - azido-ddgtp nucleotide analogs are inefficiently incorporated by HIV-1 RT opposite cytosine bases. Taken together, these findings are consistent with those of Cheong et al., who reported that oligodeoxyribonucleotide duplexes containing 2,6-diaminopurine formed more stable base pairs opposite thymine than cytosine (294). The mutations K65R, L74V, Q151M (in complex with A62V, V75I, F77L and F116Y) or M184V in HIV-1 RT allow the enzyme to discriminate between the natural dntp substrate and modified nucleotide analogs. In Table 5.2, we show that the K65R, L74V and Q151M mutations confer low levels of resistance to both 3 -azido-ddatp and 3 -azido-ddgtp at the enzyme level. Modification at the 6-position of the purine base does not appear to enhance this discrimination phenotype: the K65R, L74V or A62V/V75I/F77L/F116Y/Q151M HIV-1 RTs all exhibited foldresistance changes to each of the 6-modified-3 -azido-ddgtp analogs that were largely similar (i.e. less than 2-fold) to the fold-change in resistance values determined for 3 -azido-ddatp. Interestingly, the structure-activity relationship for the ATP-mediated excision of the 6- modified-3 -azido-ddgmp analogs by WT or TAM-containing HIV-1 RT differed from the structure-activity relationship for their incorporation. For example, whereas 3 -azido-6-cl-p-tp is a relatively good substrate for incorporation, it is not efficiently excised by either WT or 117

134 TAM-containing HIV-1 RT. In this regard, our excision complex modeling data show that the hydrogen bonding pattern observed for 3 -azido-6-cl-p-tp differs from that of 3 -azido-2,6-da- P and 3 -azido-6-aa-p (Figure 5.5). As such, it is possible that the change in transition state geometry needed for excision is not sufficiently stabilized by the 6-Cl substituted guanine analog base paired with thymine. Taken together, these data suggest that the optimal conformation of the HIV-1 RT active site differs for incorporation and excision and further suggests that 6- position modifications differentially effect these two reactions. This finding provides proof of concept that modified base analogs can be identified that are efficiently incorporated by HIV-1 RT but serve as a poor substrate for HIV-1 ATP-mediated excision reactions. Further optimization of these divergent but favorable properties of purine analogs is in progress to develop novel, ambiguous NRTI that exert profound antiviral activity against WT and drugresistant HIV

135 6.0 CHAPTER FOUR. RS-788, A PRODRUG OF 3 -AZIDO-2,6-DIAMINO-2,3 - DIDEOXYPURINE: UNIQUE METABOLISM, EXCELLENT RESISTANCE PROFILE, AND SYNERGISTIC INHIBITION OF HIV-1 RT Brian D. Herman 1, Hong-wang Zhang 2, Aleksandr Obikhod 2, Ghazia Asif 2, Steven J. Coats 3, Raymond F. Schinazi 2, John W. Mellors 1 and Nicolas Sluis-Cremer 1 1 Department of Medicine, Division of Infectious Diseases, University of Pittsburgh, Pittsburgh, PA 15261; 2 Center for AIDS Research, Department of Pediatrics, Emory University School of Medicine, and Veterans Affairs Medical Center, Decatur, Georgia 30033; 3 RFS Pharma, LLC, Tucker, Georgia

136 6.1 PREFACE The data described in this chapter were presented in part as a poster at The 17 th Conference on Retroviruses and Opportunistic Infections February 16-19, 2010, San Francisco, CA USA. Abstract # 489. Herman, B. D., Obikhod, A., Asif, G., Zhang, H-W., Coats, S. J., Schinazi, R. F., Mellors, J. W. and N. Sluis-Cremer. RS-788, a Prodrug of β-d-3 -Azido-2,6-diamino-2,3 - dideoxypurine, Exhibits Potent Activity Against NRTI-Resistant HIV-1; and in part at The 18 th Conference on Retroviruses and Opportunistic Infections February 27- March 2, 2011, Boston, MA USA. Abstract # 519. Herman, B. D., Zhang, H-W., Coats, S., Schinazi, R,, Mellors, J. and N. Sluis-Cremer. The 5 -triphosphates of 3 -azido-2,3 -dideoxyguanosine and 3 -azido-2,6- diamino-2,3 -dideoxypurine act synergistically to inhibit wild-type and NRTI-resistant HIV-1 reverse transcriptase. The work presented in this chapter is in partial fulfillment of dissertation Aim 2. Brian Herman performed all the experiments presented in this chapter. The detection of NRTI-TP metabolites in P4/R5 cells was performed by Brian Herman, along with Aleksandr Obikhod, and Ghazia Asif. 6.2 ABSTRACT Although 3 -azido-2,6-da-p-tp potently inhibited DNA synthesis by NRTI-resistant RT through incorporation and chain-termination as an adenosine analog in biochemical assays, 3 - azido-2,6-da-p is extensively metabolized to 3 -azido-ddg in cells. To further improve 3 - azido-2,6-da-p antiviral activity by increasing the intracellular delivery of its triphosphate form, 120

137 we synthesized RS-788, a novel phosphoramidate prodrug of 3 -azido-2,6-da-p. RS-788 has potent anti-hiv-1 activity and is metabolized ~1:1 to both 3 -azido-2,6-da-p-tp and 3 -azidoddg-tp in peripheral blood mononuclear (PBM) cells. Thus, RS-788 delivers two chemically distinct metabolites, each of which are potent HIV-1 RT chain terminators that are incorporated opposite different complementary bases; thymine for 3 -azido-2,6-da-p-tp and cytosine for 3 - azido-ddg-tp. In the current study, we further characterized the activity of this unique prodrug by examining the intracellular metabolism and antiviral cross-resistance profiles of RS-788, and its parent analogs, 3 -azido-2,6-da-p and 3 -azido-ddg. We found that RS-778 exhibits a superior phenotypic cross-resistance profile against a broad range of NRTI-resistant viruses compared to 3 -azido-2,6-da-p or 3 -azido-ddg. For example, against HIV-1 with the multi- NRTI resistance mutation Q151M (in complex with A62V/F77L/V75I/F116Y; Q151M complex) the potency of RS-788 was decreased only 2.3-fold compared to WT, whereas that of 3 -azido-2,6-da-p and 3 -azido-ddg were decreased 23- and 26-fold, respectively. Therefore, the potent inhibition of multi-drug resistant HIV-1 by RS-788 may be due to incorporation and chain termination at both thymine and cytosine positions by 3 -azido-2,6-da-p-tp and 3 -azidoddg-tp, respectively. To evaluate this hypothesis, we examined the inhibitory activity of combinations of the active metabolites 3 -azido-2,6-da-p-tp+3 -azido-ddg-tp against WT and multi-nrti-resistant HIV-1 RT DNA synthesis. Drug synergy analyses by both the medianeffect and normalized isobologram methods indicated synergistic inhibition of multi-nrti resistant HIV-1 RT DNA synthesis by combinations of 3 -azido-2,6-da-p-tp+3 -azido-ddg-tp at the intracellular molar ratios detected in P4/R5 and PBM cells. Furthermore, the excision mechanism conferred by TAMs did not diminish the observed synergy. Taken together, our data 121

138 demonstrate that the combined intracellular delivery of 3 -azido-2,6-da-p-tp and 3 -azido-ddg- TP by RS-788 provides synergistic inhibition of reverse transcription by NRTI-resistant RT. 6.3 INTRODUCTION The rational design of a series of novel 3 -azido-2,3 -dideoxypurine analogs led to the identification of 3 -azido-2,3 -dideoxy-2,6-diaminopurine (3 -azido-2,6-da-p) as a potent and selective inhibitor of HIV-1 replication in primary lymphocytes (Figure 5.1) (143). 3 -azido- 2,6-DA-P showed superior activity against WT and NRTI resistant HIV-1 replication compared to its parent analog 3 -azido-2,3 -dideoxygaunosine (3 -azido-ddg). The kinetic and molecular modeling studies described in the previous chapter indicated that the triphosphate form, 3 -azido- 2,6-DA-P-TP, was specifically recognized by HIV-1 RT as an adenosine analog and efficiently incorporated across from thymine in DNA or uracil in RNA, resulting in chain termination (Table 5.1, Figure 5.2, and Figure 5.4). Intracellular pharmacology analyses, however, revealed that 3 -azido-2,6-da-p was extensively metabolized to 3 -azido-ddg in PBM cells, resulting in the production of 382-fold more 3 -azido-ddg-tp than 3 -azido-2,6-da-p-tp (Figure 6.1) (295, 296). Incubation with purified adenosine deaminase in vitro led to the efficient conversion of 3 - azido-2,6-da-p to 3 -azido-ddg (143). Therefore, the potent anti-hiv-1 activity of 3 -azido-2,6- DA-P is primarily attributed to RT inhibition by 3 -azido-ddg-tp and not due to incorporation of 3 -azido-2,6-da-p-tp as an adenosine analog. In order to further improve 3 -azido-2,6-da-p antiviral activity by increasing the intracellular delivery of its triphosphate form, we synthesized a series of 5 -monophosphate prodrugs. 122

139 Figure 6.1 Structures and intracellular pharmacology in PBM cells of 3 -azido-2,6-da-p and RS-788. PBM cells were incubated with 50 µm 3 -azido-2,6-da-p or RS-788 for 4 hours and the resulting nucleotide-tp metabolites were detected using LC-MS/MS. Values are in pmol/million cells and are from references (295, 296). One such prodrug, RS-788, is a chemically shielded 5 -phosphoramidate prodrug of 3 -azido- 2,6-DA-P. In PBM cells, RS-788 was metabolized approximately 1:1 to both 3 -azido-2,6-da-p- TP and 3 -azido-ddg-tp, whereas the parent molecules 3 -azido-2,6-da-p and 3 -azido-ddg were both converted to 3 -azido-ddg-tp as the major active metabolite (Figure 6.1). Consequently, RS-788 delivers two chemically distinct metabolites, each of which are potent HIV-1 RT chain terminators that are incorporated opposite different complementary bases: thymine for 3 -azido-2,6-da-p-tp and cytosine for 3 -azido-ddg-tp. Intracellular delivery of two different chain terminating nucleotides from one parent prodrug has not been previously reported. RS-788 showed 60- and 17-fold more potent anti-hiv-1 activity in PBM cells than its parent molecules 3 -azido-ddg and 3 -azido-2,6-da-p, respectively (Table 6.1) (295, 296). Importantly, RS-788 also showed a good cytotoxicity profile in PBM, CEM, and Vero cells. The selectivity index (SI; calculated as CC 50 /EC 50 ) of RS-788 (CC 50 = 17.6 μm) in PBM cells was 123

140 Table 6.1 Activity, cytotoxicity, and selectivity index of 3 -azido-ddg, 3 -azido-2,6-da-p and RS-788 in peripheral blood mononuclear (PBM) cells. NRTI a EC 50 (µm) b CC 50 (µm) c Selectivity Index d 3 -azido-ddg azido-2,6-da-p RS a Data are from references (295, 296). b EC 50 is the concentration required to inhibit 50 % wild-type (WT) HIV-1 replication. c CC 50 is the concentration required to inhibit 50% cell growth. d Selectivity index is calculated as CC 50 /EC fold and 5.4-fold better than 3 -azido-ddg (CC 50 = 100 μm) and 3 -azido-2,6-da-p (CC 50 = 54 μm), respectively. Unlike the tenofovir prodrug (TDF) that delivers significantly higher concentrations of TFV-DP to cells than tenofovir alone, the increased potency of RS-788 was not due to increased delivery of active metabolite (206, 207). The total intracellular concentrations of 3 -azido-ddg-tp/3 -azido-2,6-da-p-tp in PBM cells treated with 50 μm of drug were 57.5 х 10 6 and 38.3 х 10 6 pmol/million cells for 3 -azido-2,6-da-p and RS-788, respectively (Figure 6.1). The unique cellular pharmacology of RS-788 and the improved anti-hiv-1 activity over its parent analogs warranted further investigation of its activity and mechanisms of inhibition against WT and NRTI-resistant RT. Accordingly, this chapter describes the metabolism and antiviral cross-resistance profiles of RS-788, 3 -azido-2,6-da-p, and 3 -azido-ddg in HIV-1 reporter cell line P4/R5. We found that RS-778 exhibits a superior phenotypic cross-resistance profile against a broad range of NRTI-resistant viruses compared to 3 -azido-2,6-da-p or 3 - azido-ddg. The activity of RS-788 against HIV-1 with the multi-nrti resistance mutation Q151M (in complex with A62V/F77L/V75I/F116Y; Q151M complex) and the 69-insertion mutations (T69S-SS in the background of TAMs M41L/L210W/T215Y; T69SSS) was 124

141 particularly compelling. To gain mechanistic insight into the potent activity of RS-788 against multi-nrti resistant HIV-1, we also evaluated the inhibitory activity of the active metabolites 3 -azido-2,6-da-p-tp and 3 -azido-ddg-tp and combinations of 3 -azido-2,6-da-p-tp+3 - azido-ddg-tp against WT and NRTI-resistant HIV-1 RT. 6.4 MATERIALS AND METHODS Cells, viruses, and NRTI for intracellular metabolism and drug susceptibility studies The human T-cell leukemia MT-2 cell line (AIDS Research and Reference Reagent Program) was cultured in RPMI 1640 with 2 mm L-glutamine (Lonza, Walkersville, MD) supplemented with 10% fetal bovine serum (HyClone Laboratories, Inc., Logan, UT), 10 mm HEPES buffer (Gibco, Grand Island, NY), and 50 IU/ml of penicillin and 50 µg/ml of streptomycin (Gibco). The HeLa cell derived P4/R5 reporter cell line (provided by Nathaniel Landau, Salk Institute), which expresses the β-galactosidase gene under the control of the HIV-1 LTR that is transactivated by HIV-1 Tat, was maintained in phenol red-free Dulbecco s modified Eagle medium (Gibco) supplemented with 10% fetal bovine serum, 50 IU/ml of penicillin, 50 µg/ml of streptomycin, and 0.5 µg/ml of puromycin (Clontech, Palo Alto, CA). The L74V, M184V, K65R, D67N/K70R/T215F/K219Q (AZT2), M41L/L210W/T215Y (AZT3), M41L/D67N/K70R/T215F/K219Q (AZT7), and M41L/D67N/K70R/L210W/T215Y/K219Q (AZT9) NRTI-resistant HIV-1 LAI full-length proviral clones were kindly provided by Dianna Koontz (University of Pittsburgh). RT clones 125

142 containing the mutations A62V/F77L/V75I/F116Y/Q151M (Q151M complex, Q151M c ) and M41L/T69S-SS/L210W/T215Y (T69SSS) were generated by site-directed mutagenesis (QuikChange II site-directed mutagenesis kit; Stratagene, La Jolla, CA) using the p6hrt-mo plasmid. This plasmid contains the entire RT and protease coding sequence and four silent restriction sites (XmaI, MluI, XbaI, and NgoMIV from the 5 to 3 ends of RT at codons 14, 358, 490, and 554, respectively) (297). After site-directed mutagenesis, the mutated RT was ligated into pxxhiv-1 LAI -MO, which contains the entire genome of HIV-1 LAI and the same silent restriction sites in RT as p6hrt-mo plasmid provided by Jessica Brehm (University of Pittsburgh). All mutations in recombinant viruses were confirmed by sequencing. Stock viruses were prepared in MT-2 cells as described previously (212). Briefly, 5-10 µg of plasmid DNA was electroporated into MT-2 cells. Cell-free supernatants were collected 5 to 7 days post-transfection at peak cytopathic effect (CPE) and stored at -80 C. The infectivity of the virus stocks were determined by 3-fold end point dilution in P4/R5 cells, and the 50% tissue culture infectivity dose was calculated using the Reed and Muench equation (298). Zidovudine (AZT) was obtained from Sigma Chemical Corporation (St. Louis, MO) and 3 -azido-ddg was obtained from Berry & Associates, Inc. (Ann Arbor, MI). 3 -azido-2,6-da-p and RS-788 were synthesized as described previously and kindly provided by Raymond Schinazi (Emory University) (143). All NRTIs were prepared as 40 mm stock solutions in dimethyl sulfoxide and stored at -20 C. 126

143 6.4.2 Quantification of the intracellular metabolites of 3 -azido-2,6-da-p, 3 -azido-ddg, and RS-788 in P4/R5 cells MT-2 cells ( ) were incubated with 50 µm 3 -azido-2,6-da-p, 3 -azido-ddg, or RS-788 for 4 hours. The cells were then centrifuged for 10 min at 350 g at 4 C, and the pellet was resuspended and washed three times with cold phosphate-buffered saline (PBS). Nucleoside triphosphates were extracted by incubation overnight at -20 C with 1 ml 60% methanol in water. The supernatant was collected and centrifuged at 16,000 g for 5 min. After decanting the supernatant, an additional 200 µl of 60% methanol in water was added to the pellets, which were then incubated on ice for 1 hour followed by centrifugation at 16,000 g for 5 min. The extracts were dried under a gentle filtered airflow and stored at -20 C. The dried residues were resuspended in 100 µl of water prior to liquid chromatography (LC)-tandem mass spectrometry analysis. The LC system was an UltiMate 3000 modular system (Dionex, Sunnyvale, CA) consisting of a quaternary pump, vacuum degasser, temperature-controlled autosampler (4 C), and temperature-controlled column compartment (28 C). An API5000 mass spectrometer (AB/SCIEX, Foster City, CA) was used as the detector. LC Analyst software version was used to control both the LC and the mass spectrometer as well as for the data analysis and quantification. Phosphorylated nucleosides were quantified by ion exchange, with the separation performed on a 5µm particle-size Biobasic C 18 (50-mm by 1.0-mm) column (Thermo Electron, Bellefonte, PA) using a gradient. The mobile phase consisted of A (10 mm ammonium acetate), B (ammonia buffer [ph 9.6]), and C, acetonitrile. Sample volumes of 5 µl were injected onto the column. 127

144 The flow was diverted to waste for the initial 1 min of the analysis. Initial composition of the mobile phase was 70 % A and 30 % C with a gradient at 3.5 min to 70 % B and 30 % C for 5 min. The mass spectrometer was operated in positive ionization mode with a spray voltage of 5 kv, gas 1 at 15 (arbitrary units), gas 2 at 20 (arbitrary units), and source temperature of 230 C. A standard curve was prepared by spiking standards of synthesized 3 -azido-2,6-da-p, 3 -azidoddg, or RS-788 in the range of 1 nm to 500 nm in control cell lysates Drug susceptibility assays for WT and NRTI-resistant HIV-1 The susceptibilities of WT and NRTI-resistant HIV-1 to 3 -azido-2,6-da-p, 3 -azido-ddg, RS- 788, and AZT (as a control) were determined in P4/R5 cells as described previously (212). Briefly, 3-fold dilutions of inhibitor were added to P4/R5 cells in triplicate, and the cells were infected with an amount of virus that produced 100 relative light units (RLU) in control wells without drug. After 48 h, the cells were lysed (Gal-Screen; Tropix/Applied Biosystems, Foster City, CA) and the RLU were measured using a ThermoLab Systems luminometer (Waltham, MA). The concentration of drug required to inhibit viral replication by 50% (EC 50 ) was calculated by linear regression from data points in the linear dose-response range. Data are reported as the mean EC 50 ± standard deviations from 3-4 independent experiments. Fold resistance was calculated as the ratio EC mutant 50 /EC WT

145 6.4.4 Reagents for Steady RT DNA synthesis assays WT, T69SSS, and Q151M c HIV-1 RTs were purified as described previously (284, 285). The protein concentration of the purified enzymes was determined spectrophotometrically at 280 nm using an extinction coefficient (ε 280 ) of M 1 cm 1, and by Bradford protein assays (Sigma-Aldrich, St. Louis, MO). The RNA- and DNA-dependent DNA polymerase activities of the purified WT and mutant enzymes were similar (data not shown). The triphosphate forms of 3 -azido-2,6-da-p and 3 -azido-ddg were synthesized and purified using the methods of Ludwig and Eckstein (299). The dntps, ATP, [α- 32 P]dATP, and [α- 32 P]dGTP and Whatman DE81 anion exchange paper were obtained from GE Healthcare (Piscataway, NJ). Activated calf thymus DNA was purchased from Sigma-Aldrich (St. Louis, MO) Steady-state RT DNA synthesis assays with 3 -azido-2,6-da-p-tp, 3 -azido-ddg- TP, and their fixed-ratio combinations Steady State DNA synthesis reactions with WT, T69SSS, or Q151M c HIV-1 RT were carried out in a reaction buffer containing 50 mm Tris-HCl (ph 7.5), 50 mm KCl, and 10 mm MgCl 2. All concentrations refer to the final concentration after mixing unless noted otherwise. Reactions were initiated by mixing solutions A and B, which were preincubated at 37 C. Solution A contained 0.5 μm datp and dgtp, 0.5 μci/μl [α- 32 P]dATP or [α- 32 P]dGTP, 10 nm RT, and various concentrations of 3 -azido-2,6-da-p-tp, 3 -azido-ddg-tp, or their fixed-ratio combinations in reaction buffer. Solution B contained 100 ng/μl activated calf thymus DNA, 50 μm dttp, and 50 μm dctp in reaction buffer. Reactions were incubated at 37 C for 4 min and then 5 μl aliquots were spotted onto DE81 anion exchange paper. After successive washes with 129

146 Na 2 PO 4 buffer (50 g/l, 3 5 min washes), dh 2 0 (5 min), and EtOH (5 min) the paper was air dried, sealed in saran wrap, and then exposed to a phosphorimaging screen. Products were analyzed using BioRad Quantity One Software. 3 -azido-2,6-da-p-tp+3 -azido-ddg-tp combinations were evaluated using a series of assays with increasing total drug concentrations at three fixed ratios. The 3 -azido-2,6-da-p-tp: 3 -azido-ddg-tp ratios of 2.4:1 and 1.1:1 were chosen because these are the intracellular molar ratios of 3 -azido-2,6-da-p-tp: 3 -azido-ddg-tp detected in PBM and P4/R5 cells, respectively. The third series of assays used the experimental ratio of 1:3 3 -azido-2,6-da-p-tp: 3 -azido-ddg-tp. Assays using each of three 3 -azido-2,6-da-p-tp: 3 -azido-ddg-tp ratios were performed using [α- 32 P]dATP as the reporter nucleotide and using [α- 32 P]dGTP as the reporter nucleotide. Experimental control combinations of 1:1 3 -azido-2,6-da-p-tp:3 -azido- 2,6-DA-P-TP and 3 -azido-ddg-tp: 3 -azido-ddg-tp were also performed and, as expected, these combinations were always additive, regardless of whether [α- 32 P]dATP or [α- 32 P]dGTP was used as the reporter nucleotide (data not shown). Lastly, assays using all three combination ratios and both reporter nucleosides were also performed with the addition of 3 mm ATP in order to examine steady state DNA synthesis in the presence of a functional excision mechanism. All assays were performed at least 3 times Synergy analysis using the median-effect principle The degree of synergy or antagonism for inhibition of HIV-1 RT DNA synthesis by fixed-ratio combinations of 3 -azido-2,6-da-p-tp and 3 -azido-ddg-tp was evaluated based on the median-effect principal of Chou and Talalay (300). Using CompuSyn Software (ComboSyn, Inc, Paramus, NJ) the log (f a /f u ) was plotted versus the log ([drug]), where f a is the fractional 130

147 inhibition of drug relative to no drug control and f u = (1-f a ). The IC 50 values were calculated from the antilog of the x-intercept. The combination index (CI) was calculated in a mutually exclusive model by the equation: CI = [(f a /f u ) 1 / (f a /f u ) 1,2 ] + [(f a /f u ) 2 / (f a /f u ) 1,2 ]; where 1 and 2 represent drugs 1 and 2 individually, while 1,2 represents their combined activity. The CI values of < 1, = 1, and > 1 indicate synergy, additive effect, and antagonism, respectively. The degree of synergy is further categorized based on CI values as: very strong synergy (< 0.1), strong synergy (0.1 to 0.3), synergy (0.3 to 0.7), moderate synergy (0.7 to 0.85), additive effect (0.85 to 1.20), moderate antagonism (1.20 to 1.45), antagonism (1.45 to 3.3), strong antagonism (3.3 to 10), and very strong antagonism (> 10). For each experiment, a set of CI values was determined at the 50 %, 75 %, 90 %, and 95 % inhibition levels (i.e. IC 50, IC 75, IC 90, and IC 95, respectively). As recommended in the software manual, we report the average CI calculated from those at each of the four inhibition levels. On some occasions when the effect did not reach the 95 % inhibition level, the IC 95 CI value was not included in the average CI calculation. Additionally, data points that were > 99 % inhibition were also excluded from analysis Synergy analysis using normalized isobolograms In order to eliminate bias based on the analysis method, we also evaluated the data set by plotting normalized (equipotent) isobolograms (301, 302). These were constructed by plotting drug 1 as [IC 50 ] 1,2 /[IC 50 ] 1 and drug 2 as [IC 50 ] 1,2 /[IC 50 ] 2 on the x- and y- axes, respectively. The terms [IC 50 ] 1 and [IC 50 ] 2 represent the IC 50 of each drug individually and [IC 50 ] 1,2 represents the IC 50 of the combination. The diagonal line between coordinates (1,0) and (0,1) represents additivity. Data points that are above the additivity line represent antagonism between the compounds, 131

148 whereas data points below the additivity line represent synergy between the compounds. The relative strength of synergy or antagonism can be specified by average deviation from additivity (ADA), which indicates the statistical distance from dose-wise additivity line (302). ADA is calculated by the equation ([Σ(IC 50a,IC 50b )]-N)/N where N is the population size. ADA significance (p-value < 0.05) was measured by a one-tailed homoscedastic t-test. If the ADA value is statistically significant, then negative values represent synergy. Values of -0.5 and lower indicate strong synergy. 6.5 RESULTS Intracellular pharmacology of 3 -azido-2,6-da-p, 3 -azido-ddg, and RS-788 in P4/R5 cells We quantified the levels of nucleotide triphosphate that accumulated in P4/R5 cells treated with 50 µm 3 -azido-2,6-da-p, 3 -azido-ddg, or RS-788 for 4 hours (Figure 6.2, Table 6.2,). As expected, 3 -azido-ddg-tp ( pmol/million cells) was the only NRTI-TP species found in P4/R5 cells treated with 3 -azido-ddg. Consistent with data from PBM cells, almost all of the NRTI-TP quantified from 3 -azido-2,6-da-p-treated P4/R5 cells was 3 -azido-ddg-tp (295, 296). Cells treated with 3 -azido-2,6-da-p contained 470-fold more 3 -azido-ddg-tp ( pmol/million cells) than 3 -azido-2,6-da-p-tp ( pmol/million cells). Conversely, cells treated with RS-788 accumulated 2.4-fold more 3 -azido-2,6-da-p-tp ( pmol/million cells) than 3 -azido-ddg-tp ( pmol/million cells). Also of note, incubation with RS- 788, but not 3 -azido-ddg or 3 -azido-2,6-da-p, reduced the intracellular levels of natural 132

149 Figure 6.2 Intracellular pharmacology of 3 -azido-2,6-da-p and RS-788 in P4/R5 cells. P4/R5 cells were incubated with 50 µm 3 -azido-2,6-da-p or RS-788 for 4 hours and the resulting nucleotide-tp metabolites were detected using LC-MS/MS as described in the Materials and Methods. Values are in pmol/million cells. Table 6.2 Levels of NRTI-TP and dntp detected in P4/R5 cells incubated with 50 µm 3 - azido-ddg, 3 -azido-2,6-da-p, or RS-788 for 4 hours. nucleotide triphosphates detected ( 10 6 pmol/million cells) a drug incubated 3 -azidoddg-tp 3 -azido-2,6- DA-P-TP dgtp datp dctp dttp None ± ± ± ± azidoddg 3 -azido- 2,6-DA-P 20.8 ± 2.8 no peak 35.3 ± ± ± ± ± 5.9 b 0.05 ± ± ± ± ± 2.9 RS ± 2.2 b 27.0 ± ± ± ± ± 4.3 a Values are means ± standard deviations from triplicate experiments performed as described in the Materials and Methods. b The actual concentration of 3 -azido-ddg-tp in cells treated with either 3 -azido-2,6-da-p or RS-788 could be lower than reported due to interfering signal from 3 -azido-2,6-da-p-tp in the LC-MS/MS analyses. 133

150 dgtp, datp, and dctp (but not dttp) nucleotide pools. This is presumably due to competition for host nucleoside/nucleotide phosphorylating enzymes. These data show that RS-788 is efficiently metabolized in P4/R5 cells to both 3 -azido-2,6-da-p-tp and 3 -azido-ddg-tp, two structurally distinct active NRTI-TP metabolites that are recognized by HIV-1 RT as adenosineand guanosine-analogs, respectively Antiviral activity of 3 -azido-2,6-da-p, 3 -azido-ddg, and RS-788 against WT and NRTI-resistant HIV-1 The activities of 3 -azido-2,6-da-p, 3 -azido-ddg, and the 3 -azido-2,6-da-p-prodrug RS-788 against WT HIV-1 replication were determined in P4/R5 cells (Table 6.3). The anti-hiv-1 activity of AZT was also examined as a control. RS-788 potently inhibited WT HIV-1 replication with an EC 50 value of 0.12 µm. RS-788 had similar potency as AZT (EC 50 against WT = 0.13 µm) against WT HIV-1 and was approximately 10-fold more potent than 3 -azidoddg and 3 -azido-2,6-da-p that showed EC 50 values of 1.1 µm and 1.2 µm, respectively. The phenotypic cross-resistance of a broad panel of NRTI-resistant HIV-1 to 3 -azido-2,6-da-p, 3 - azido-ddg, and RS-788 was also examined in P4/R5 cells (Table 6.3, Figure 6.3). As described above, 3 -azido-2,6-da-p was almost entirely converted to 3 -azido-ddg- TP in P4/R5 cells. Therefore, it was expected that 3 -azido-2,6-da-p and 3 -azido-ddg would demonstrate similar activity against each virus. The data confirm that there was no statistically significant difference between the activities of 3 -azido-2,6-da-p and 3 -azido-ddg against any virus examined. RS-788 potently inhibited the replication of every virus examined with EC 50 values between 0.05 µm and 0.28 µm (Table 6.3). 134

151 Table 6.3 Antiviral activity of RS-788, 3 -azido-2,6-da-p, and 3 -azido-ddg against WT and NRTI-resistant HIV-1 in P4/R5 cells. Virus RS azido- 2,6-DA-P NRTI 3 -azidoddg AZT WT EC50 (µm) 0.12 ± 0.06 a 1.2 ± ± ± 0.06 M184V EC50 (µm) 0.05 ± ± ± ± 0.06 Fold-R b 0.4 b L74V EC50 (µm) 0.07 ± ± ± ± 0.06 Fold-R K65R EC50 (µm) 0.11 ± ± ± ± 0.06 Fold-R AZT3 41L/210W/215Y EC50 (µm) 0.19 ± ± ± ± 0.06 Fold-R AZT2 67N/70R/215F/219Q EC50 (µm) 0.27 ± ± ± ± 0.06 Fold-R AZT7 41L/67N/70R/215F/219Q EC50 (µm) 0.27 ± ± ± 0.1 >90 Fold-R >714 AZT9 41L/67N/70R/210W/215Y/219Q EC50 (µm) 0.25 ± ± ± 0.4 >90 Fold-R >714 69SSS 41L/69SSS/210W/215Y EC50 (µm) 0.44 ± ± ± 3.8 >90 Fold-R >714 Q151M c 62V/75I/77L/116Y/151M EC50 (µm) 0.28 ± ± ± 7.3 >90 Fold-R >714 a Values represent the EC 50 means ± standard deviations determined from 3-4 independent experiments. b Values represent fold-change (Fold-R) compared to WT HIV

152 Figure 6.3 Fold-change in the susceptibility of NRTI-resistant HIV-1 to RS-788, 3 -azido- 2,6-DA-P, and 3 -azido-ddg compared to WT HIV-1. Bars represent the mean fold-resistance values ± standard deviations of drug-resistant HIV-1 compared to WT HIV-1 calculated from EC 50 values determined from 3-4 independent experiments. Asterisks indicate p-value <0.05 compared to 3 -azido-ddg. HIV-1 containing the NRTI discrimination mutation M184V was slightly more susceptible to inhibition by 3 -azido-2,6-da-p and 3 -azido-ddg than WT virus and the L74V and K65R mutations conferred only low level resistance (up to 2.1-fold over WT) to 3 -azido- 2,6-DA-P and 3 -azido-ddg (Figure 6.3). Similarly, the M184V and L74V mutations conferred hypersusceptibility to RS-788 with fold-resistance values of 0.4 and 0.6, respectively, compared to WT virus. RS-788 inhibited HIV-1 containing the K65R discrimination mutation to a similar degree as WT virus. Viruses containing 3 to 6 TAMs showed decreased susceptibility to 3 - azido-2,6-da-p and 3 -azido-ddg with fold-resistance values between 2.3-fold and 5.1-fold as compared to WT HIV-1 (Table 6.3, Figure 6.3). The same TAM-containing viruses were less resistant to inhibition by RS-788 with fold-resistance values between 1.6- and 2.3-fold relative to 136