An Evolution of Michigan s SCID Algorithm
|
|
|
- Preston Lester
- 5 years ago
- Views:
Transcription
1 An Evolution of Michigan s SCID Algorithm A qualitative approach for the T cell receptor excision circle (TREC) assay for the detection of primary immune deficiency syndromes (PIDS) demonstrates better sensitivity and specificity versus a quantitative approach Heather Wood M.S. Laboratory Scientist NBS MDCH
2 How To Screen For SCID And Other PID s? Real time polymerase chain reaction (PCR) of T cell receptor excision circles (TREC s) and reference gene (β-actin). TREC s are small pieces of DNA that are formed during the differentiation of T cells in the thymus as a result of the rearrangement of the T cell receptor genes.
3 TREC Formation This process doesn t work properly in PID s +
4 Overall Analysis Scheme Overall Analysis Scheme 3.2 mm DBS is punched into a 96 well plate Partially automated DNA extraction using an Eppendorf epmotion 5075 Automated set up of real time qpcr in a 384 well format using the epmotion 5075 Duplex qpcr amplification and analysis (TREC and β actin) on a 7900HT.
5 A Typical TREC Plasmid Standard Curve ,250 2,500 5,000 CT 5,000 10
6 TREC Plasmid Curve C T V a u l e s TREC Limit of Detection Log 10 quantity vs Ct 5 10 Too much variability in the area of interest. Last point on daily standard curve 10 copies , Log 10 quantity 625 2,500 5,000
7 Current Qualitative Algorithm Yes Normal TREC CT <35.00 No, repeat to confirm TREC CT <35.00 TREC CT 36.3 and normal β actin CT β actin not normal Inconclusive request another DBS Yes We have never reported quantities on our reports! Normal TREC CT to Low Borderline positive; request another DBS TREC CT Very Low Send to clinic for CBC differential and flow cytometry If there are 2 borderline positive or 3 inconclusive samples in a row patient is referred for flow cytometry
8 Timeline of algorithms A B C D E 10/1/2011 to 2/29/2012 3/1/2012 to 8/31/2012 9/1/2012 to 10/2/ /3/2012 to 1/31/2013 2/1/2013 to current Initial Michigan Method New and Improved Michigan Method
9 Algorithm A (10/1/2011 to 2/29/2012) Normal and low birth weight babies TREC quantity copies per µl of blood B actin Quantity copies per µl of blood Result < Strong positive <30 <4000 Inconclusive Time= ~5 months 32 cases per month N= 44,712 Total PPV= 18.58% Total FPR= 0.21%
10 Algorithm B (3/1/2012 to 8/31/2012) TREC quantity copies per µl of blood B actin Quantity copies per µl of blood Result Normal birth weight 2500 < Strong positive grams Low birth weight <2500 grams < Strong positive Low birth weight <2500 grams 20 to < Borderline positive All babies <30 <8000 Inconclusive Time= ~6 months 36 cases per month N= 57,023 Total PPV= 25.0% Total FPR= 0.09%
11 Algorithm C (9/1/2012 to 10/2/2012) Normal and low birth weight babies TREC quantity copies per µl of blood B actin CT value Result < Strong positive 20 to < Borderline positive <30 >30.00 Inconclusive Time= ~1 month *85 cases N= 9,054 Total PPV= 10.59% Total FPR= 0.83%
12 Algorithm D (10/3/2012 to 1/31/2013) Normal and low birth weight babies TREC quantity copies per µl of blood B actin CT value Result Strong positive 11 to Borderline positive 20 >30.00 Inconclusive Time= ~3 months 53 cases per month N= 36,728 Total PPV= 8.81% Total FPR= 0.39%
13 Algorithm E (2/1/2013 to current) Normal and low birth weight babies TREC CT value B actin CT value Result Strong positive Borderline positive >30.00 Inconclusive Time= ~17 months 4 5 cases per month N= 178,682 Total PPV= 28.57% Total FPR= 0.03%
14 Positive Predictive Values
15 False Positive Rate
16 How Many Michigan Babies Have Been Screened For PID s? 326,041 Michigan babies have been screened from 10/1/2011 to 8/31/2014 Using clinical categories from Region 4 2 SCID 3 Leaky SCID 18 Syndromes with T cell impairment 21 Non-preterm secondary T cell lymphopenia 29 Lymphopenia
17 Acknowledgements Michigan Newborn Screening Program This work was partially funded by a research cooperative agreement from CDC (Grant # 01EH000936) and does not represent the official view of CDC.
18 TREC Plasmid Curve TREC Ct values S8=5000 S7=2500 S6=1250 S5=625 S4=156 S3=78 S2=39 S1=10 N Mean SD SD SD
Newborn Screening for Severe Combined Immunodeficiency (SCID) by Quantifying T-cell Receptor Excision Circles (TREC)
Newborn Screening for Severe Combined Immunodeficiency (SCID) by Quantifying T-cell Receptor Excision Circles (TREC) Patricia R. Slev, PhD, D(ABCC) Medical Director, Serologic Hepatitis and Retrovirus
Adam S. Coleman, Ph.D.
The Challenges of Severe Combined Immunodeficiency Screening in a Two Screen State 9/13/2017 Laboratories Administration 73,000 births annually 2 sample state for NBS Adam S. Coleman, Ph.D. Supervisor,
Chapter 26. Newborn Screening
Chapter 26 Newborn Screening Severe Combined Immune Deficiency (SCID) leads to life-threatening infections unless the immune system can be restored through a bone marrow transplant, enzyme replacement
SCID Secondary Conditions Identified by the Texas Newborn Screening Program
SCID Secondary Conditions Identified by the Texas Newborn Screening Program Debra Freedenberg M.D. PhD, Rachel Lee PhD, Daisy Johnson, Ginger Scott, Kim LaBoard, and Karen Hess Texas Department of State
CDC Laboratory Support
Newborn Bloodspot Screening for Severe Combined Immune Deficiency (NBS-SCID) CDC Laboratory Support APHL Webcast Robert F. Vogt, Jr., Ph.D. Research Chemist Newborn Screening and Molecular Biology Branch
Newborn Screening for SCID and T Cell Lymphopenia
Newborn Screening for SCID and T Cell Lymphopenia Jennifer Puck, MD Jennifer.Puck@ucsf.edu Department of Pediatrics University of California San Francisco and Benioff Children s Hospital San Francisco,
Immunology, Asthma and Allergy Research Institute (IAARI)
Immunology, Asthma and Allergy Research Institute (IAARI) Prenatal and postnatal genetic diagnosis of PIDs: From routine methods to new molecular assessments for newborn screening Maryam Nourizadeh (PhD
INFANTS WITH SEVERE T-CELL LYMphopenia,
ORIGINAL CONTRIBUTION Statewide Newborn Screening for Severe T-Cell Lymphopenia John M. Routes, MD William J. Grossman, MD, PhD James Verbsky, MD, PhD Ronald H. Laessig, PhD Gary L. Hoffman, BS Charles
Median Normalization of Newborn Screening Analyte Data to Improve Screening Performance
Median Normalization of Newborn Screening Analyte Data to Improve Screening Performance T Henry 1, C Wolf 2, M McCann 2, and S Berberich 1 1 Iowa Newborn Screening Program 2 Minnesota Newborn Screening
CALIFORNIA NEWBORN SCREENING FOR SCID. Joseph A. Church, M.D. Children s Hospital Los Angeles and Keck School of Medicine at U.S.C.
CALIFORNIA NEWBORN SCREENING FOR SCID Joseph A. Church, M.D. Children s Hospital Los Angeles and Keck School of Medicine at U.S.C. CELLS, DNA AND GENES HOW GENES GO WRONG - MUTATIONS MONOGENIC TRAIT: Determined
Adenosine deaminase severe combined immunodeficiency (ADA-SCID)
Adenosine deaminase severe combined immunodeficiency (ADA-SCID) Christopher A. Haynes, PhD Service Fellow, CDC National Conversation: Tandem Mass Spectrometry in Newborn Screening February 5-6, 2015 National
Disclosures. Newborn Screening for Severe Combined Immune Deficiency Syndromes (SCIDS): Why; why now? Learning objectives.
Newborn Screening for Severe Combined Immune Deficiency Syndromes (SCIDS): Why; why now? Anthony J. Infante, MD, PhD Professor, Pediatrics and Microbiology & Immunology Chief, Division of Immunology &
For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.
For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are
Disorder name: Severe Combined Immunodeficiency Acronym: SCID
Genetic Fact Sheets for Parents Other Disorders Screening, Technology, and Research in Genetics is a multi-state project to improve information about the financial, ethical, legal, and social issues surrounding
CLSI Guidelines on Newborn Screening for Severe Combined Immunodeficiency (SCID)
CLSI Guidelines on Newborn Screening for Severe Combined Immunodeficiency (SCID) Lisa Kobrynski, MD, MPH Marcus Professor of Immunology Department of Pediatrics Emory University, Atlanta, GA Clinical Laboratory
Attachment 1. Newborn Screening Program Description
Attachment 1 Newborn Screening Program Description The core mission of Texas Newborn Screening Program is to save children s lives through the early detection of life-threatening disorders. 34 Newborn
THE USE OF WT1-QPCR TO MEASURE AND DETECT MINIMAL RESIDUAL DISEASE IN ACUTE MYELOID LEUKEMIA. Ava Greco
THE USE OF WT1-QPCR TO MEASURE AND DETECT MINIMAL RESIDUAL DISEASE IN ACUTE MYELOID LEUKEMIA Ava Greco REVIEW OF LITERATURE What is Leukemia? Abnormal growth of cells in the blood stream Progresses rapidly
CYP21A2 Mutations Found in Congenital Adrenal Hyperplasia Patients in the California Population
CYP21A2 Mutations Found in Congenital Adrenal Hyperplasia Patients in the California Population Christopher N. Greene, Ph.D. Newborn Screening and Molecular Biology Branch National Center for Environmental
Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML
Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML Imran Mirza, MD, MS, FRCPC Pathology & Laboratory Medicine Institute Sheikh Khalifa Medical City, Abu Dhabi, UAE. imirza@skmc.ae
Total genomic DNA was extracted from either 6 DBS punches (3mm), or 0.1ml of peripheral or
Material and methods Measurement of telomere length (TL) Total genomic DNA was extracted from either 6 DBS punches (3mm), or 0.1ml of peripheral or cord blood using QIAamp DNA Mini Kit and a Qiacube (Qiagen).
Chlamydia pneumoniae PCR reagents Detection with real time PCR reagents
Chlamydia pneumoniae PCR reagents Detection with real time PCR reagents Overview:... 1 Products... 2 C. pneumoniae FAM-BHQ1 Primer-probe PP3400 0.055ml... 2 AttoMaster 2X Mix for qpcr AM10 1.25 ml... 2
Overview of role of immunologic markers in HIV diagnosis
Overview of role of immunologic markers in HIV diagnosis Savita Pahwa, M.D. Departments of Microbiology & Immunology and Pediatrics University of Miami, Miller School of Medicine, Miami, Florida Background:
A look across the border
A look across the border Dr. Jim Bonham PNS-congres 17 april 2018 Disclosure I have no disclosures of commercial support. Professionally, I am a member of the Executive Committee of ISNS 2 PNS-congres
UK Newborn Screening for X-ALD - progress from a lab perspective
UK Newborn Screening for X-ALD - progress from a lab perspective Mrs. Leila Cornes Senior Clinical Scientist, Newborn Screening Southmead Hospital, Bristol May 2016 C26:0-lysoPC C26:0-lysophosphatidylcholine
Sequencing in Newborn Screening Introduction and Background
Sequencing in Newborn Screening Introduction and Background Suzanne Cordovado, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Centers for Disease Control and Prevention
Laboratory and Clinical Diagnosis of HCV Infection
Laboratory and Clinical Diagnosis of HCV Infection Jean-Michel Pawlotsky,, MD, PhD Department of Virology (EA 3489) Henri Mondor Hospital University of Paris XII Créteil,, France I Nonspecific Liver Tests
TB NAAT testing at the Los Angeles County Public Health Laboratory
TB NAAT testing at the Los Angeles County Public Health Laboratory Hector Rivas Public Health Microbiology Supervisor II Los Angeles County Public Health Laboratory hrivas@ph.lacounty.gov April 2012 1
Using Multiples of the Median (MoM) for Normalization of TREC Results Meets the Need for Standardized SCID Reporting
Using Multiples of the Median (MoM) for Normalization of TREC Results Meets the Need for Standardized SCID Reporting 2013 Joint Meeting of the Newborn Screening and Genetic Testing Symposium and the International
Cutoff and Validation-MPS I and Pompe. NewSTEPs National New Disorders Implementation Meeting 6/19/18 Mike Sarzynski Michigan NBS
Cutoff and Validation-MPS I and Pompe NewSTEPs National New Disorders Implementation Meeting 6/19/18 Mike Sarzynski Michigan NBS Michigan LSD Screening Start MI went live with full population MPS I and
Maryland Department of Health and Mental Hygiene 201 W. Preston Street Baltimore, Maryland 21201
STATE OF MARYLAND DHMH Maryland Department of Health and Mental Hygiene 201 W. Preston Street Baltimore, Maryland 21201 Martin O Malley, Governor Anthony G. Brown, Lt. Governor Joshua M. Sharfstein, M.D.,
MolecularMD. One-Step qrt-pcr BCR-ABL Kit. Product Description and User Manual. For Quantitative RT-PCR Analysis of BCR-ABL. Contact Us.
Contact Us If you have any questions for or comments about MolecularMD, please feel free to contact us. Email Customer Service CustomerService@MolecularMD.com Technical Support TechSupport@MolecularMD.com
November Janet Marcadier, MSc, CCGC, CGC Genetic Counsellor Newborn Screening Ontario, Children s Hospital of Eastern Ontario
November 2012 Janet Marcadier, MSc, CCGC, CGC Genetic Counsellor Newborn Screening Ontario, Children s Hospital of Eastern Ontario Objectives 1. To outline the provincial advisory committee structure 2.
NEWBORN METABOLIC SCREEN, MINNESOTA
Lab Dept: Test Name: Chemistry NEWBORN METABOLIC SCREEN, MINNESOTA General Information Lab Order Codes: Synonyms: CPT Codes: Test Includes: PKUN Newborn Screen for Hyopothyroidism, Phenylketonuria (PKU),
Short Term Follow Up Tandem Mass Spectrometry Workshop Agenda
Short Term Follow Up Tandem Mass Spectrometry Workshop Agenda June 11-15, 2018 APHL Headquarters 8515 Georgia Ave Silver Spring, MD 20910 This meeting is sponsored by the Association of Public Health Laboratories
Case Presentations in Primary Immune Deficiency Diseases. John W. Sleasman, M.D. St Petersburg, FL Mark Ballow, M.D. Buffalo NY & Sarasota, FL
Case Presentations in Primary Immune Deficiency Diseases John W. Sleasman, M.D. St Petersburg, FL Mark Ballow, M.D. Buffalo NY & Sarasota, FL COPD and recurrent infections 42 WF non- smoker with diagnosis
RNA PCR, Proviral DNA and Emerging Trends in Infant HIV Diagnosis
RNA PCR, Proviral DNA and Emerging Trends in Infant HIV Diagnosis 1 B R E N D A N M C M U L L A N I N F E C T I O U S D I S E A S E S, S Y D N E Y C H I L D R E N S H O S P I T A L S C H O O L O F W O
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Annual Report Zurich 2017 Date of issue: 19 th April 2018 Amended report issued: 1 st May
ERNDIM Administration Office Manchester Centre for Genomic Medicine 6 th Floor, St Mary's Hospital, Oxford Road, Manchester M13 9WL, United Kingdom. Tel: +44 161 276 6741 Fax: +44 161 850 1145 Email: admin@erndim.org
RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
AmoyDx TM BRAF V600E Mutation Detection Kit
AmoyDx TM BRAF V600E Mutation Detection Kit Detection of V600E mutation in the BRAF oncogene Instructions For Use Instructions Version: B3.1 Date of Revision: April 2012 Store at -20±2 o C 1/5 Background
Droplet Digital PCR, the new tool in HIV reservoir quantification? Ward De Spiegelaere
Droplet Digital PCR, the new tool in HIV reservoir quantification? Ward De Spiegelaere Droplet Digital PCR, the new tool in HIV reservoir quantification? Content: - Digital PCR - Applications - Total HIV
Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.
Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described
July, Years α : 7.7 / 10, Years α : 11 / 10,000 < 5 Years: 80 / 10, Reduce emergency department visits for asthma.
What are the Healthy People 1 objectives? July, 6 Sponsored by the U.S. Department of Health and Human Services, the Healthy People 1 initiative is a comprehensive set of disease prevention and health
Connecticut Newborn Screening For X-Linked Adrenoleukodystrophy
Connecticut Newborn Screening For X-Linked Adrenoleukodystrophy Adrienne Manning, Division Director, Newborn Screening Connecticut Department of Public Health Katherine A. Kelley Public Health Laboratory
BMI 541/699 Lecture 16
BMI 541/699 Lecture 16 Where we are: 1. Introduction and Experimental Design 2. Exploratory Data Analysis 3. Probability 4. T-based methods for continous variables 5. Proportions & contingency tables -
New CT/GC Tests. CDC National Infertility Prevention Project Laboratory Update Region II May 13-14, 2009
CDC National Infertility Prevention Project Laboratory Update Region II May 13-14, 2009 Richard Steece, Ph.D., D(ABMM) DrRSteece@aol.com New CT/GC Tests New Nucleic Acid Amplification Tests (NAATs) for
Practice Problems 8. a) What do we define as a beneficial or advantageous mutation to the virus? Why?
Life Sciences 1a Practice Problems 8 1. You have two strains of HIV one is a wild type strain of HIV and the second has acquired a mutation in the gene encoding the protease. This mutation has a dual effect
CUMULATIVE PERINATAL HIV EXPOSURE, AUSTRALIA. Date
CUMULATIVE PERINATAL HIV EXPOSURE, AUSTRALIA 350 300 250 Number 200 150 100 50 0 1/01/1997 1/01/1998 1/01/1999 1/01/2000 31/12/2000 31/12/2001 31/12/2002 Date July 2004 Reported number of perinatally exposed
The Many Lives of the Newborn Screening Dried Blood Spot (the LIFE CYCLE of a Blood Spot)
The Many Lives of the Newborn Screening Dried Blood Spot (the LIFE CYCLE of a Blood Spot) Piero Rinaldo, MD, PhD Professor of Laboratory Medicine T. Denny Sanford Professor of Pediatrics Mayo Clinic College
Neonatal screening for PID. T cell defects (SCID) B cell defects (XLA) Phagocytic disorders (CGD) Complement defects (C2, P)
Lennart Hammarström Stephan Borte Ulrika von Döbeln Clinical Immunology Karolinska Institutet at KUS Huddinge γc JAK 3 Pro NK Periphery NK Common lymphoid progenitors Haematopoetic stem cells γc JAK 3
Information for health professionals
Changes to the Newborn Bloodspot Screening Policy for Congenital Hypothyroidism (CHT) in Preterm Babies A UK policy change has been agreed that will mean changes to: which preterm babies require second
Opportunities Created by Diagnostic HCV and HIV Nucleic Acid Tests
Opportunities Created by Diagnostic HCV and HIV Nucleic Acid Tests Ann Winters, MD Medical Director, Viral Hepatitis Program, Bureau of Communicable Disease, New York City Department of Health and Mental
IDEA Early Intervention Due Process Complaints and Hearing Requests Part C Procedures
IDEA Early Intervention Due Process Complaints and Hearing Requests Part C Procedures A Guide for Families of Infants and Toddlers (Birth through Age 2) September 2018 This publication is part of a series
Epidemiology of Asthma. In Wayne County, Michigan
Epidemiology of Asthma In Wayne County, Michigan Elizabeth Wasilevich, MPH Asthma Epidemiologist Bureau of Epidemiology Michigan Department of Community Health 517.335.8164 Publication Date: August 2005
Acylcarnitine Analysis using the Perkin Elmer Neobase Kit. Katherine Wright Alder Hey, Liverpool
Acylcarnitine Analysis using the Perkin Elmer Neobase Kit Katherine Wright Alder Hey, Liverpool 2007 Work on an in-house method for acylcarnitines (Waters, Quattro Micro) However... - Newborn Screening
Newborn Screening for Cystic Fibrosis
Newborn Screening for Cystic Fibrosis Three States Experience with IRT/IRT/DNA Marci Sontag PhD, Norm Brown, Dan Wright, Art Cowes, Rachel Lee, Susan Tanksley Colorado School of Public Health and Children
Influenza A viruses Detection with real time RT-PCR reagents
Influenza A viruses Detection with real time RT-PCR reagents Overview:... 1 Products... 2 Influenza A matix FAM-BHQ1 PP500 0.055ml... 2 Influenza A Plasmid 200 pg/ml PLAS500 0.25ml... 2 Detection Influenza
WHO recommendations. Diagnostic testing in infants
WHO recommendations Diagnostic testing in infants Recommendations 2- testing in infants Intervention Reco QoE Comment At or around 6 weeks of age is most efficient time at which to perform a viral test
HIV Update in Laboratory Testing. Patricia Slev, PhD, D(ABCC)
HIV Update in Laboratory Testing Patricia Slev, PhD, D(ABCC) Objectives Explain the advances in HIV diagnostics, including fourth generation Ag/Ab combination HIV screening assays Describe the new CDC
Saving Lives Through Newborn Screening: Making the Most of a Simple Blood Test
Saving Lives Through Newborn Screening: Making the Most of a Simple Blood Test February 26, 2018 John D. Thompson, PhD, MPH, MPA Director - NBS Program Washington State Public Health Laboratories What
Human Rotavirus A. genesig Advanced Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Human Rotavirus A Non structural protein 5 (NSP5) genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus A Rotavirus is a genus
UPDATE MOLECULAR DIAGNOSTICS IN SEXUAL HEALTH. Dr Arlo Upton Clinical Microbiologist Labtests Auckland
UPDATE MOLECULAR DIAGNOSTICS IN SEXUAL HEALTH Dr Arlo Upton Clinical Microbiologist Labtests Auckland Talk outline Chlamydia trachomatis NAAT What does a positive test mean Interpreting low level positives
Development of a Multiplex CYP21A2 Genotyping Assay for Congenital Adrenal Hyperplasia Screening
Development of a Multiplex CYP21A2 Genotyping Assay for Congenital Adrenal Hyperplasia Screening Christopher N. Greene, Ph.D. Newborn Screening and Molecular Biology Branch National Center for Environmental
Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit
Revision No.: ZJ0003 Issue Date: Aug 7 th, 2008 Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit Cat. No.: TR-0126-02 For use with ABI Prism 7000/7300/7500/7900(96 well); Smart Cycler II; icycler iq 4/iQ
Improving Communication of Negative Newborn Screening Results. Whitney Thompson MPhil Amy Gaviglio MS, CGC Susan Berry MD
Improving Communication of Negative Newborn Screening Results Whitney Thompson MPhil Amy Gaviglio MS, CGC Susan Berry MD Positive newborn blood spot results in MN Presumptive positive and borderline results
Learning Objectives. New HIV Testing Algorithm from CDC. Overview of HIV infection and disease 3/15/2016
New HIV Testing Algorithm from CDC ASCLS-Michigan March 31, 2016 Dr. Kathleen Hoag Learning Objectives Following attendance and review of material provided, attendees will be able to: 1. Describe the new
Human Rotavirus C. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Non structural protein 5 (NSP5) 150 tests
TM Primerdesign Ltd TM Primerdesign Ltd Human Rotavirus C Non structural protein 5 (NSP5) genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research
Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
Potential Effect of Alternative HIV Testing Algorithms on HIV Case Surveillance
Potential Effect of Alternative HIV Testing Algorithms on HIV Case Surveillance Kristen Mahle, MPH HIV Incidence & Case Surveillance Branch DHAP, NCHHSTP, CDC 2010 Diagnostics Conference March 24, 2010
AIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria
AIDS - Knowledge and Dogma Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/17 2010, Vienna, Austria Reliability of PCR to detect genetic sequences from HIV Juan Manuel
Conventional or molecular measurement of Aspergillus load. Dr Karl Clemons California Institute for Medical Research
Conventional or molecular measurement of Aspergillus load Dr Karl Clemons California Institute for Medical Research Everyone quantifies burdens or numbers of organisms, so what s the big deal?? Why does
Retinoic Acid/Embryo Laboratory Exam
Name: Date: Retinoic Acid/Embryo Laboratory Exam 1. What is the difference between a qualitative and a quantitative observation? 2. Chronologically order the following research activities: (1 - first >
Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
Collection of Dried Blood Spots from Infants for Diagnosis of HIV by DNA PCR. MOH Regional Trainings March 2013
Collection of Dried Blood Spots from Infants for Diagnosis of HIV by DNA MOH Regional Trainings March 2013 Outline Introduce DBS testing Rationale Testing algorithm Sample collection, storage and transportation
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Neonatal Pneumonia-2 assay
Neonatal Pneumonia-2 assay For the detection of Ureaplasma species (Ureaplasma parvum and Ureaplasma urealyticum), Chlamydia trachomatis and Mycoplasma hominis using the BD MAX TM system. Instructions
Human Alpha 1 microglobulin ELISA Kit
Human Alpha 1 microglobulin ELISA Kit Catalogue No.: EH4144 Size: 48T/96T Reactivity: Human Range:0.625-40ng/ml Sensitivity:
Newborn Screening for Cystic Fibrosis in Switzerland - Evaluation after two years
Newborn Screening for Cystic Fibrosis in Switzerland - Evaluation after two years R. Fingerhut, T. Torresani, S. Gallati, M.H. Schoeni, C. Kuehni, C. Rueeg, M. Baumgartner, J. Barben and the Swiss CF Screening
Instructions for Chronic Lymphocytic Leukemia Post-HSCT Data (Form 2113)
Instructions for Chronic Lymphocytic Leukemia Post-HSCT Data (Form 2113) This section of the CIBMTR Forms Instruction Manual is intended to be a resource for completing the CLL Post-HSCT Data Form. E-mail
PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human
Anti-CD19-CAR transduced T-cell preparation PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human AB serum (Gemini) and 300 international units/ml IL-2 (Novartis). T cell proliferation
NEWBORN SCREENING in Massachusetts: Answers for you and your baby
NEWBORN SCREENING in Massachusetts: Answers for you and your baby The New England Newborn Screening Program University of Massachusetts Medical School 305 South St. Jamaica Plain, MA 02130 617-983-6300
Human Rotavirus A. genesig Standard Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Human Rotavirus A Non structural protein 5 (NSP5) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus A Rotavirus is a genus
Epidemiology of Asthma. In the Western Michigan Counties of. Kent, Montcalm, Muskegon, Newaygo, and Ottawa
Epidemiology of Asthma In the Western Michigan Counties of Kent, Montcalm, Muskegon, Newaygo, and Ottawa Elizabeth Wasilevich, MPH Asthma Epidemiologist Bureau of Epidemiology Michigan Department of Community
Short Communication. Int Arch Allergy Immunol 2016;171: DOI: /
Short Communication Int Arch Allergy Immunol 216;171:136 14 DOI: 1.119/49 Received: March 24, 216 Accepted after revision: September 2, 216 Published online: December 1, 216 Limitation of Simultaneous
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against
Buprenorphine & Controlled Substance Treatment Agreement
Buprenorphine & Controlled Substance Treatment Agreement I agree to accept the following treatment contract for buprenorphine office-based opioid addiction treatment: 1. I will keep my medication in a
5. Hospitals will provide the family with a copy of the Michigans Community Program: Information for Parents (MDCH /01). Copies can be ordered,
GUIDELINES FOR HEARING SCREENING A goal of newborn hearing screening is to ensure that all newborns receive a hearing screen before discharge from the hospital or before one month of age. All hospitals
RealLine Mycoplasma genitalium Str-Format
Instructions for use ASSAY KIT FOR THE QUALITATIVE DETECTION OF MYCOPLASMA GENITALIUM DNA BY REAL-TIME PCR METHOD In vitro Diagnostics () VBD4396 96 Tests valid from December 2018 Rev06_1218_EN Page 1
Chlamydia trachomatis
Chlamydia trachomatis 2012 EQA Programme A Final Report QAB004101 (CTDNA12A) Version 2 Dr Anton M van Loon Scientific Experts on behalf of QCMD Report authorised by the QCMD Executive in May 2012 A UKAS
Quantification of HBV, HCV genotype and HIV subtype panels
Quantification of HBV, HCV genotype and HIV subtype panels Harry van Drimmelen 1,2, Wim Quint 2, Nico Lelie 3 and the international NAT study group 1. Biologicals Quality Control, 2. DDL Diagnostic Laboratory,
Newborn Screening in Washington State Saving lives with a simple blood spot
Newborn Screening in Washington State Saving lives with a simple blood spot Ashleigh Ragsdale, MPH Gauri Gupta, MScPH Objectives Newborn Screening Overview Process and Law Completing Collection Cards Video
(DNA) Real-time PCR. Exicycler 96 Rotor-Gene Q/6000 PCR
Real-Time (DNA) Real-time Exicycler 96 Rotor-Gene Q/6000 IU Mix1 Mix2 IU/μl IU/μl IU/μl IU/μl IU/μl IPC NTC C 1 Lot# 2 Freeze & thawing 1 MSDS: Material Safety Data Sheets (TaqMan Real-time ' FAM ' BHQ1
Ali Alabbadi. Bann. Bann. Dr. Belal
31 Ali Alabbadi Bann Bann Dr. Belal Topics to be discussed in this sheet: Particles-to-PFU Single-step and multi-step growth cycles Multiplicity of infection (MOI) Physical measurements of virus particles
WHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: Abbott RealTime HIV-1 (m2000sp) Number: PQDx
WHO Prequalification of Diagnostics Programme PUBLIC REPORT Product: Abbott RealTime HIV-1 (m2000sp) Number: PQDx 0145-027-00 Abstract The Abbott RealTime HIV-1 (m2000sp) assay with product code 2G31 (which
Complicated viral infections
Complicated viral infections Clinical case discussion Diagnostic dilemmas NSW State Reference Laboratory for HIV St Vincent s Hospital Sydney Diagnostic dilemmas Indeterminate or discordant serology (western
Newborn Screening for Severe Combined Immunodeficiency-A History of the TREC Assay
International Journal of Neonatal Screening Review Newborn Screening for Severe Combined Immunodeficiency-A History of the TREC Assay Mary T. Bausch-Jurken 1, James W. Verbsky 2 and John M. Routes 1, *
Development of Real Time RT-PCR Assays for Neuraminidase Subtyping of Avian Influenza Virus
Development of Real Time RT-PCR Assays for Neuraminidase Subtyping of Avian Influenza Virus Yanyan Huang 1, Mazhar Khan 1, and Ion Măndoiu 1 Department of Pathobiology & Veterinary Science, University
Evaluation of the Alethia TM assay for newborn cytomegalovirus testing using oral swab samples
Evaluation of the Alethia TM assay for newborn cytomegalovirus testing using oral swab samples Soren Gantt, David M. Goldfarb, Wendy van Zuylen, William Rawlinson, Heather F. Thiesset, Albert H. Park,
Cladosporium_spp genesig Standard Kit
TM Primerdesign Ltd Cladosporium_spp genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Cladosporium_spp Cladosporium is a genus of slow growing fungi, colonies